Articles on this page are available in 2 other languages: Chinese (Simplified) (12), Dutch (1) (learn more)

Overview

Brief Summary

Reed buntings have a black head and white 'shawl' in the summer. You can then find them singing while perching in the top of bushes or reed. This is how they define their territory. When sensing danger, the bird races lower down. In the Netherlands, reed buntings can be seen the whole year round just about anywhere where there is reed. Some of the Dutch reed bunting population migrates a short distance to more southerly regions in the winter.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Adults feed amongst low vegetation, close to or on the ground. They mainly feed on seeds, but the young are fed on invertebrates. During the breeding season, which lasts from April to mid-July, males try to attract a female to their territory by singing. The female builds the nest from grass, twigs and pieces of reed with a soft lining of moss close to the ground amongst dense vegetation. Two to three broods are usually produced each year; each brood consists of about 3-6 black spotted green-brown eggs. Predators threatening the nest may be drawn away by one of the parents pretending to be injured, crawling or running away with its wings partly open (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The reed bunting is a sparrow-sized bird with a long notched tail. Both sexes have reddish-brown upperparts with dark streaks, and pale creamy-white underparts with brown streaks. In the breeding season, males can be identified by their black head, white collar and a characteristic 'moustache' (2). The song is a series of high-pitched notes or a characteristic 'seeoo' produced whilst perching on a reed or bush (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The reed bunting is distributed throughout the UK, but is not as common in the uplands and the far north and west (4). Elsewhere it is widespread throughout central and northern Europe (2). Northern populations tend to migrate to southern France, Italy and Spain to over-winter, whereas the population in the UK and some areas of Europe tend to remain in the same area all year round (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.758 - 9.758
  Nitrate (umol/L): 3.256 - 3.256
  Salinity (PPS): 33.882 - 33.882
  Oxygen (ml/l): 6.553 - 6.553
  Phosphate (umol/l): 0.345 - 0.345
  Silicate (umol/l): 2.505 - 2.505
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The reed bunting tends to occur in wetland sites such as reedbeds, and is found mainly in dense stands of vegetation on waterlogged soils typically at the edge of water (2). The specific name schoeniclus derives from the Greek skhoinos, meaning reed (5). The species has recently tended to move into gardens and farmland habitat such as overgrown ditches and hedgerows, particularly in winter (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Emberiza schoeniclus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Emberiza schoeniclus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATTTTNGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTTGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATCGGCGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCTACCGTCGAAGCAGGTGTCGGTACAGGCTGAACAGTGTACCCACCACTAGCCGGTAACCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTGCACCTGGCCGGTATCTCCTCAATCCTAGGAGCAATCAACTTTATCACTACAGCAATTAACATAAAACCCCCTGCCCTCTCACAATACCAAACTCCCCTATTCGTTTGATCAGTCCTAATCACCGCAGTACTCCTACTCCTGTCCCTCCCAGTCCTCGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACTACATTCTTTGACCCCGCTGGAGGAGGAGACCCCGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTCCCAGGATTTGGAATTATCTCCCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Listed on the Birds of Conservation Concern Red List, and Appendix II of the Bern Convention. Protected in the UK under the Wildlife and Countryside Act 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 4,800,000-8,800,000 breeding pairs, equating to 14,400,000-26,400,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 29,400,000-106,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.10,000-100,000 breeding pairs, c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in China; c.10,000-100,000 breeding pairs, c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The reasons for the decline of this species are not yet fully understood (4), however it coincided with the decline in many other farmland birds that have similar diets and feed their young on invertebrates. Changes in agricultural practices may be largely to blame, including the increase in pesticide and fertiliser use, the loss of winter stubble fields due to sowing in autumn rather than spring, and a general loss of farm diversity due to specialisation (4). In addition, many wetland habitats have been damaged or have deteriorated due to harsh river engineering, scrub encroachment and land drainage. In recent years, the main period of land drainage occurred between 1968-1985. It is perhaps no coincidence that the reed bunting population declined by 50% between 1970-1980 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Reed beds are one of Britain's most important habitats for birds, supporting four other rare breeding birds, the marsh harrier, Cetti's warbler, Savi's warbler and the bittern. As part of the UK Biodiversity Action Plan English Nature has produced an action plan for reed bed birds in England and individual Species Action Plans (SAPs) for these five birds. The reed bunting is included in English Nature's Species Recovery Programme, which aims to restore existing reed beds back to favourable condition and to create new reedbed habitats. Furthermore, agri-environment schemes, in particular the Pilot Arable Stewardship Scheme and new measures encouraging the retention of winter stubbles in the South Downs Environmentally Sensitive Area should aid the reed bunting (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Reed Bunting

The common reed bunting (Emberiza schoeniclus) is a passerine bird in the bunting family Emberizidae, a group now separated by most modern authors from the finches, Fringillidae. It breeds across Europe and much of temperate and northern Asia. Most birds migrate south in winter, but those in the milder south and west of the range are resident. It is common in reedbeds and also breeds in drier open areas such as moorland and cultivation. For example it is a component of the purple moor grass and rush pastures, a type of Biodiversity Action Plan habitat in the UK. It occurs on poorly drained neutral and acidic soils of the lowlands and upland fringe. It is found in the South West of England, especially in Devon

The familiar, if somewhat monotonous, song of the cock is a repetitive zrip.

Description[edit]

The common reed bunting is a medium sized bird, 13.5-15.5 cm long, with a small but sturdy seed-eater's bill. The male has a black head and throat, white neck collar and underparts, and a heavily streaked brown back. The female is much duller, with a streaked brown head, and is more streaked below.

Food and feeding[edit]

Its natural food consists of insects when feeding young, and otherwise seeds. The nest is in a bush or reed tussock. 4-7 eggs are laid, which show the hair-like markings characteristic of those of buntings.

Gallery[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!