Articles on this page are available in 2 other languages: Chinese (Simplified) (12), Dutch (1) (learn more)

Overview

Brief Summary

Reed buntings have a black head and white 'shawl' in the summer. You can then find them singing while perching in the top of bushes or reed. This is how they define their territory. When sensing danger, the bird races lower down. In the Netherlands, reed buntings can be seen the whole year round just about anywhere where there is reed. Some of the Dutch reed bunting population migrates a short distance to more southerly regions in the winter.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults feed amongst low vegetation, close to or on the ground. They mainly feed on seeds, but the young are fed on invertebrates. During the breeding season, which lasts from April to mid-July, males try to attract a female to their territory by singing. The female builds the nest from grass, twigs and pieces of reed with a soft lining of moss close to the ground amongst dense vegetation. Two to three broods are usually produced each year; each brood consists of about 3-6 black spotted green-brown eggs. Predators threatening the nest may be drawn away by one of the parents pretending to be injured, crawling or running away with its wings partly open (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The reed bunting is a sparrow-sized bird with a long notched tail. Both sexes have reddish-brown upperparts with dark streaks, and pale creamy-white underparts with brown streaks. In the breeding season, males can be identified by their black head, white collar and a characteristic 'moustache' (2). The song is a series of high-pitched notes or a characteristic 'seeoo' produced whilst perching on a reed or bush (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Perdix perdix occurs throughout much of the western Palearctic, with a native range encompassing Portugal, Spain, France, the Netherlands, Germany, Ireland, the United Kingdom, Norway, Sweden, Finland, Belgium, Luxembourg, Denmark, Poland, Estonia, Latvia, Lithuania, Russia, Belarus, Ukraine, the Czech Republic, Slovakia, Switzerland, Liechtenstein, Austria, Italy, Hungary, Slovenia, Croatia, Bosnia and Herzegovina, Serbia, Romania, Moldova, The Former Yugoslav Republic of Macedonia, Bulgaria, Greece, Turkey, Armenia, Georgia, Azerbaijan, Iran, Kazakhstan and China (del Hoyo et al. 1994). The subspecies italica, endemic to parts of Italy, has been extinct since the 1980s as a result of hybridisation with introduced individuals of the nominate subspecies (Liukkonen-Anttila et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The reed bunting is distributed throughout the UK, but is not as common in the uplands and the far north and west (4). Elsewhere it is widespread throughout central and northern Europe (2). Northern populations tend to migrate to southern France, Italy and Spain to over-winter, whereas the population in the UK and some areas of Europe tend to remain in the same area all year round (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.758 - 9.758
  Nitrate (umol/L): 3.256 - 3.256
  Salinity (PPS): 33.882 - 33.882
  Oxygen (ml/l): 6.553 - 6.553
  Phosphate (umol/l): 0.345 - 0.345
  Silicate (umol/l): 2.505 - 2.505
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.758 - 9.758
  Nitrate (umol/L): 3.256 - 3.256
  Salinity (PPS): 33.882 - 33.882
  Oxygen (ml/l): 6.553 - 6.553
  Phosphate (umol/l): 0.345 - 0.345
  Silicate (umol/l): 2.505 - 2.505
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The reed bunting tends to occur in wetland sites such as reedbeds, and is found mainly in dense stands of vegetation on waterlogged soils typically at the edge of water (2). The specific name schoeniclus derives from the Greek skhoinos, meaning reed (5). The species has recently tended to move into gardens and farmland habitat such as overgrown ditches and hedgerows, particularly in winter (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Emberiza schoeniclus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATTTTNGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTTGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATCGGCGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCTACCGTCGAAGCAGGTGTCGGTACAGGCTGAACAGTGTACCCACCACTAGCCGGTAACCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTGCACCTGGCCGGTATCTCCTCAATCCTAGGAGCAATCAACTTTATCACTACAGCAATTAACATAAAACCCCCTGCCCTCTCACAATACCAAACTCCCCTATTCGTTTGATCAGTCCTAATCACCGCAGTACTCCTACTCCTGTCCCTCCCAGTCCTCGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACTACATTCTTTGACCCCGCTGGAGGAGGAGACCCCGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTCCCAGGATTTGGAATTATCTCCCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Emberiza schoeniclus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5