Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Overview

Distribution

Range

Taiga of n Eurasia; > to India, SE Asia and Philippines.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Emberiza pusilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Emberiza pusilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCTCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTGGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGATTCGGAAACTGATTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGTTTCTGACTACTCCCCCCATCCTTTCTCCTCCTTCTAGCATCTTCCACTGTCGAAGCAGGTGTTGGAACAGGCTGAACAGTATACCCACCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTACACCTAGCCGGTATCTCTTCNATCCTGGGGGCAATTAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTGTCACAATACCAAACCCCTCTGTTCGTCTGATCAGTCCTAATCACCGCAGTACTNCTACTCCTATCCCTACCAGTTCTTGCCGCAGGGATTACAATACTACTTACAGACCGTAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGAGACCCCGTCCTATATCAACACCTCTTCTGATTCTTCGGTCACCCGGAGGTCTACATCCTAATCCTGCCAGGATTTGGAATTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 5,000,000-8,000,000 breeding pairs, equating to 15,000,000-24,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 30,600,000-96,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.1,000-10,000 wintering individuals in China; c.50-1,000 individuals on migration and < c.50 wintering individuals in Taiwan; < c.1,000 individuals on migration and < c.1,000 wintering individuals in Korea; < c.1,000 individuals on migration and < c.1,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Bunting

The Little Bunting (Emberiza pusilla) is a passerine bird. It belongs to the bunting and American sparrow family (Emberizidae), a group separated by most modern authors from the true finches (Fringillidae).

Description[edit]

This is a small bunting at 12–13.5 centimetres (4.7–5.3 in) in length. It has a heavily streaked brown back and white underparts with fine dark streaking. With its chestnut face and white malar stripe, it resembles a small female Reed Bunting, but has black crown stripes, a white eye-ring, and a fine dark border to the rear of its chestnut cheeks. Sexes are similar.

The call is a distinctive zik, and the song is a rolling siroo-sir-sir-siroo.

Ecology[edit]

The Little Bunting breeds across the taiga of the far northeast of Europe and northern Asia. It is migratory, wintering in the subtropics in northern India, southern China and the northern parts of southeast Asia.[citation needed] The birds remain in their winter quarters for quite long; specimens were taken in Yunnan in late March.[2] It is a rare vagrant to western Europe.[citation needed] This species is adaptable; in the mountains of Bhutan for example, where small numbers winter, it is typically found in agricultural habitat, mostly between 1,000 and 2,000 metres (3,300 and 6,600 ft) ASL.[3]

It breeds in open coniferous woodland, often with some birch or willow. 4–6 eggs are laid in a tree nest. Its natural food consists of insects when feeding young, and otherwise seeds.

A common and widely-ranging species, it is not considered threatened on the IUCN Red List.[4]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Emberiza pusilla". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Bangs (1932)
  3. ^ Inskipp et al. (2000)
  4. ^ BirdLife International (2008)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!