Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Overview

Distribution

Range

Taiga of n Eurasia; > to India, SE Asia and Philippines.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Emberiza pusilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Emberiza pusilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCTCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTGGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGATTCGGAAACTGATTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGTTTCTGACTACTCCCCCCATCCTTTCTCCTCCTTCTAGCATCTTCCACTGTCGAAGCAGGTGTTGGAACAGGCTGAACAGTATACCCACCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTACACCTAGCCGGTATCTCTTCNATCCTGGGGGCAATTAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTGTCACAATACCAAACCCCTCTGTTCGTCTGATCAGTCCTAATCACCGCAGTACTNCTACTCCTATCCCTACCAGTTCTTGCCGCAGGGATTACAATACTACTTACAGACCGTAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGAGACCCCGTCCTATATCAACACCTCTTCTGATTCTTCGGTCACCCGGAGGTCTACATCCTAATCCTGCCAGGATTTGGAATTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 5,000,000-8,000,000 breeding pairs, equating to 15,000,000-24,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 30,600,000-96,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.1,000-10,000 wintering individuals in China; c.50-1,000 individuals on migration and < c.50 wintering individuals in Taiwan; < c.1,000 individuals on migration and < c.1,000 wintering individuals in Korea; < c.1,000 individuals on migration and < c.1,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Little bunting

The little bunting (Emberiza pusilla) is a passerine bird belonging to the bunting and American sparrow family (Emberizidae), a group most modern authors separate from the true finches (Fringillidae).

Taxonomy[edit]

First described by Peter Simon Pallas in 1776, the little bunting is a monotypic species,[2] with no geographical variation across its extensive Eurasian range.[3]

Description[edit]

This is a small bunting, measuring only 12–14 cm (4.7–5.5 in) in length.[2] It has a heavily streaked brown back and white underparts with fine dark streaking. With its chestnut face and white malar stripe, it resembles a small female reed bunting, but has black crown stripes, a white eye-ring, and a fine dark border to the rear of its chestnut cheeks. The sexes are similar.

The call is a distinctive zik, and the song is a rolling siroo-sir-sir-siroo.

Ecology[edit]

The little bunting breeds across the taiga of the far north-east of Europe and northern Asia. It is migratory, wintering in the subtropics in northern India, southern China and the northern parts of south-east Asia.[3] The birds remain in their winter quarters for quite long; specimens were taken in Yunnan in late March.[4] It is a rare vagrant to western Europe.[3] This species is adaptable; in the mountains of Bhutan for example, where small numbers winter, it is typically found in an agricultural habitat, mostly between 1,000 and 2,000 metres (3,300 and 6,600 ft) ASL.[5]

It breeds in open coniferous woodland, often with some birch or willow. Four to sex eggs are laid in a tree nest. Its natural food consists of seeds, or when feeding young, insects.

A common and widely-ranging species, it is not considered threatened on the IUCN Red List.[1]

References[edit]

  1. ^ a b BirdLife International (2012). "Emberiza pusilla". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Byers, Olsson & Curson (1995), p. 154.
  3. ^ a b c Byers, Olsson & Curson (1995), p. 156.
  4. ^ Bangs, Outram (1932). "Birds of western China obtained by the Kelley-Roosevelts expedition". Field Mus. Nat. Hist. Zool. Ser. 18 (11): 343–379. 
  5. ^ Inskipp, Carol; Inskipp, Tim; Sherub (2000). "The ornithological importance of Thrumshingla National Park, Bhutan" (PDF). Forktail 16: 147–162. 

Cited works[edit]

  • Byers, Clive; Olsson, Urban; Curson, Jon (1995). Buntings and Sparrows: A Guide to the Buntings and North American Sparrows. Mountfield, East Sussex, UK: Pica Press. ISBN 1-873403-19-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!