Articles on this page are available in 1 other language: Chinese (Simplified) (13) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: northern Eurasia, from Scandinavia to Anadyrland and Kamchatka. WINTERS: China and Japan, occasionally west to British Isles, southern Europe, and Iran (Sibley and Monroe 1990). Uncommon spring migrant in western and central Aleutian Islands, rare in fall; casual spring visitor on St. Lawrence Island; accidental elsewhere on west coast of Alaska (NGS 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Bushes and wet grassy areas in taiga, undergrowth of mixed woodland, thickets along streams (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Emberiza rustica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Emberiza rustica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTGTACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAGCCTGGAGCCCTTCTAGGAGACGACCAAGTCTATAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGGTTCGGAAACTGACTAGTTCCCNTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTTCTCCTAGCATCTTCCACTGTCGAAGCAGGTGTCGGAACAGGCTGAACAGTATACCCACCACTGGCCGGCAACCTGGCCCACGCTGGAGCTTCAGTCGACCTCGCAATTTTCTCCTTACACCTAGCCGGCATCTCTTCGATCCTAGGAGCAATTAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTAATCACCGCAGTACTTCTACTCCTATCCCTACCAGTTCTTGCCGCAGGAATCACAATGCTACTTACAGACCGCAACCTCAACACCACATTCTTTGACCCTGCAGGCGGAGGAGACCCCGTTCTATACCAACATCTCTTCTGATTCTTCGGTCACCCAGAAGTCTATATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 6,100,000-10,000,000 breeding pairs, equating to 18,300,000-30,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 37,300,000-120,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.50-10,000 wintering individuals in China; < c.1,000 individuals on migration in Taiwan; c.50-10,000 wintering individuals in Korea; c.50-10,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rustic bunting

The rustic bunting (Emberiza rustica) is a passerine bird in the bunting family Emberizidae, a group now separated by most modern authors from the finches, Fringillidae.

It breeds across northern Europe and Asia. It is migratory, wintering in south-east Asia, Japan, and eastern China. It is a rare wanderer to western Europe.

It breeds in wet coniferous woodland. Four to six eggs are laid in a nest in a bush or on the ground. Its natural food consists of seeds, and when feeding young, insects.

This bird is similar in size to a reed bunting. It has white underparts with reddish flank, pink legs and a pink lower mandible. The summer male has a black head with a white throat and supercilium and a reddish breast band.

The female has a heavily streaked brown back and brown face with a whitish supercilium. She resembles a female reed bunting, but has the reddish flank streaks, a chestnut nape and a pink, not grey, lower mandible.

The call is a distinctive zit, and the song is a melancholic delee-deloo-delee.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!