Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Song thrushes take a variety of food but earthworms form a very important part of the diet. Towards the end of summer if the ground is too hard to obtain earthworms, they take snails and break the shells by tapping them on stones (2). These 'snail anvils' can often be found in gardens with the remains of a snail around them. This behaviour is unique to the song thrush, but occasionally a blackbird will steal the snail once an unfortunate thrush has carried out the hard work of breaking the shell (2). The long breeding season lasts from March to August. Two or three broods are produced in this time; each clutch contains 3 to 5 pale blue-black spotted eggs that are incubated by the female. Both parents feed the young, which become independent about 5 weeks after hatching (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Slightly smaller than the blackbird, the familiar song thrush has brown upperparts and creamy underparts with obvious dark brown spots. The beautiful song is loud and musical, with repeated phrases. In flight, a soft 'sip' call is produced (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The song thrush is widespread throughout Europe reaching east to Siberia. Populations in the north of the range are migratory; the wintering areas extend down into North Africa, whereas in central Europe including the UK, populations tend to be resident throughout the year. In the UK they are found in the largest numbers in south-east England and East Anglia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.533 - 10.696
  Nitrate (umol/L): 1.473 - 7.309
  Salinity (PPS): 34.170 - 35.082
  Oxygen (ml/l): 6.271 - 6.443
  Phosphate (umol/l): 0.359 - 0.491
  Silicate (umol/l): 1.720 - 2.943

Graphical representation

Temperature range (°C): 9.533 - 10.696

Nitrate (umol/L): 1.473 - 7.309

Salinity (PPS): 34.170 - 35.082

Oxygen (ml/l): 6.271 - 6.443

Phosphate (umol/l): 0.359 - 0.491

Silicate (umol/l): 1.720 - 2.943
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in parks, small woodlands, hedgerows, and gardens. They require trees and bushes with areas of open grassland and moist soil with a plentiful supply of invertebrate food (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / associate
larva of Fannia nidica is associated with nest of Turdus philomelos

Animal / parasite / endoparasite
Prosthorhynchus cylindraceus endoparasitises small intestine (middle third) of Turdus philomelos

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 17.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Nest lined with protective material: song thrush
 

Cup-shaped nests of song thrush are lined with wood pulp because it hardens into a protective, cardboard-like material.

   
  "The song-thrush (Turdus philomelos) lines its nest cup with rotting wood fibres, which creates a kind of a pulp that hardens into a cardboard-like material." (Pallasmaa 1995:20)
  Learn more about this functional adaptation.
  • Pallasmaa, J. 1995. Animal architecture. Helsinki: Museum of Finnish Architecture. 126 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Turdus philomelos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACCCTCTACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGCACTGCCCTAAGTCTTCTCATTCGAGCAGAACTGGGACAACCAGGCGCCCTACTAGGCGATGACCAGATCTACAATGTCGTCGTTACTGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGATTCGGAAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGGCTCCTCCCCCCATCCTTCCTCCTTCTCCTAGCCTCCTCCACAGTAGAAGCGGGAGCAGGAACGGGCTGAACTGTTTATCCCCCCCTCGCCGGCAACCTAGCACACGCAGGAGCTTCAGTAGACCTGGCCATCTTCTCCCTCCACCTGGCAGGAATCTCCTCAATCCTGGGGGCTATCAACTTCATCACAACAGCAATTAACATAAAACCACCCGCCCTCTCACAATACCAAACCCCCCTATTTGTCTGATCAGTCCTAATTACCGCAGTGCTACTCCTCCTATCTCTTCCTGTCCTCGCTGCTGGTATTACTATACTCCTTACCGACCGCAACCTAAACACCACCTTCTTCGACCCAGCGGGAGGAGGAGACCCAGTACTGTACCAACACCTCTTCTGATTTTTCGGCCACCCTGAAGTCTACATTCTCATTCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Turdus philomelos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed under the Birds of Conservation Concern Red List and the EC Birds Directive. Protected in the UK under the Wildlife and Countryside Act 1981, and the Wildlife (Northern Ireland) Order 1985 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 20,000,000-36,000,000 breeding pairs, equating to 60,000,000-108,000,000 individuals (BirdLife International 2004). Europe forms 50-74% of the global range, so a very preliminary estimate of the global population size is 81,100,000-216,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

After the mid-1970s there was a steady decline in song thrush numbers; since then a decline of 73% has occurred in farmland and 49% in woodland habitats (3). Although the reasons for this decline are not yet understood, it is thought that the widespread changes in agricultural practices have been involved; removal of hedgerows has caused a loss of nesting sites, and the increased use of pesticides and the loss of winter stubbles have reduced the food supply. Predation by crows and foxes and competition with blackbirds may also be important (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The severity of the song thrush decline was recognised fairly recently, so very little conservation work has focused on this species to date. The RSPB is promoting environmentally sensitive farming practices as a means to conserve the song thrush and other threatened farmland birds. Research into the ecology of this species and the causes of the decline is ongoing. Gardens are important habitats for this species; certain measures can be taken to make a garden more attractive to wildlife (2). The song thrush is a priority species under the UK Biodiversity Action Plan (UK BAP), and a Species Action Plan has been produced to coordinate its conservation (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!