Articles on this page are available in 2 other languages: Spanish (2), Dutch (1) (learn more)

Overview

Brief Summary

Ringed seals are fat little seals and are therefore also referred to as the small seal. They live in and around the Arctic region, but sometimes wander into the North Sea. In the Arctic region, ringed seals make fortresses in snow mounds on the pack ice, where the young are born. The mother can reach her young through a breathing hole in the pack ice. These breathing holes are often favorite spots for polar bears, where they will wait to catch a good meal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

"Ringed seals have dark gray or blackish coats with white or pale gray rings splotched across the back and sides. They are the smallest and most common earless seals of the icy northern seas. Unlike other seals, ringed seals use a ""lair"" for shelter, consisting of one of more chambers built against a ridge of ice or within a snowdrift, with a hole dug through to the water to permit dives for feeding. The seals keep the hole open by scratching at the ice with the strong nails on their foreflippers. Lairs may help protect the seals from predation by polar bears, arctic foxes, and walruses. Ringed seals have traditionally been hunted by native peoples for food, dog food, clothing, and oil. The population in North America waters seems secure, but some subspecies in other parts of their circumpolar distribution are classified as threatened or endangered."

Links:
Mammal Species of the World
  • Original description: "Schreber, J.C.D., 1775.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; 2(13):pl. 86[1775]; text, 3(17):312[1776]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The ringed seal Phoca hispida is member of the 'true seal' family. Like all true seals, it has a tapering and pointed muzzle, small, clawed pectoral flippers, and small hind flippers that cannot rotate under the body. Like similar species, it has beaded whiskers on the muzzle. The ringed seal is quite a plump seal, with a small head and a short, thick neck. It can reach 1.6 m in length. It has a short muzzle and large conspicuous eyes. It is most easily recognised by the light rings it has all over its upper body. The background colour is variable but normally medium to dark grey above and light grey below.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Ringed Seal: A very common, small, pan-Arctic ice seal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black spots with gray rings round them on sides and back, generally gray background; Short and robust body; Heavy claws on front flippers
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Ringed seals have a circumpolar distribution throughout the Arctic Basin including records of individuals near the North Pole (Rice 1998); arctic ringed seals also range widely into adjacent seas being found in the Bering Sea, Chukchi Sea, Beaufort Sea, Canadian Arctic Archipelago, Hudson Bay, Hudson Strait, Davis Strait, and Greenland, Barents, White, Kara, Laptev and East Siberian Seas, and they extend into some lake and river systems in Northern Canada (Heide-Jørgensen and Lydersen 1989). Separate populations occur in the Baltic Sea, Lake Ladoga in the Russian Federation, Lake Saimaa in Finland, and the Sea of Okhotsk south to northern Japan (Frost and Lowry 1981, Reeves 1998). Extralimital records for ringed seals extend far south on both sides of the Atlantic, to New Jersey in the west and Portugal in the east. In the Pacific vagrants have been recorded south to the Zhejiang in China and southern California (Rice 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The ringed seal is the most common seal in the Arctic. This species is rarely found on the open sea, but instead is prefers areas where the ice is firm. It is found along Pacific Japanese coasts, the northern parts of the Baltic Sea, Canada, Alaska, and Siberia (Harris 1991).

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumpolar, encompassing all of the Eurasian and Canadian arctic and extending southward to Japan, Hudson Bay, Labrador and occasionally northeast Newfoundland and the Gulf of St. Lawrence.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic Ocean, Azores Exclusive Economic Zone, Baltic sea, Belgian Exclusive Economic Zone, Bering Sea, Hudson Bay, Hudson Strait, North West Atlantic, Polish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Wide general distribution in seasonally and permanently ice-covered waters of Northern Hemisphere; Arctic Ocean and several adjoining seas and freshwater lakes. Local abundance varies with winter ice conditions. In North America, ranges seasonally into North Atlantic as far south as Labrador and Newfoundland, Hudson and James bays, and Bering Sea (usually to Nunivak Island or Bristol Bay); in winter and spring, ranges as far south as the limit of sea ice. See Reeves et al. (1992) for information on distribution in Eastern Hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult ringed seals are 140-150 cm in length, and females are generally slightly smaller than males. Pusa hispida is similar in shape and color to common seals, but it is generally darker. The belly is silver gray color and the dorsal side is pale gray with dark spots that are surrounded with pale colored rings (Harris 1991).

Range mass: 65 to 95 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 160 cm

Weight: 101000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger than females.

Length:
Average: 1.3 m
Range: 1-1.5 m

Weight:
Average: 68 kg
Range: 45-107 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Arctic ringed seals are in many respects the “classic” ice-seal. The subspecies P. h. hispida and P. h. ochotensis use sea ice exclusively as their breeding, moulting and resting (haulout) habitat, rarely if ever coming onto land (Smith and Stirling 1975, Frost and Lowry 1981, Kelly 1988). Their ability to create and maintain breathing holes in sea ice using the well-developed claws on their fore-flippers allows them to thrive in areas where even other ice-associated seals cannot reside. Although ringed seals are quite small they deal with the thermal challenges posed by the arctic winter by having a very thick blubber layer, and by building lairs (small caves) in the snow on top of sea ice during the winter. The lairs are particularly important for neonatal survival (e.g., Lydersen and Smith 1989). Each seal builds several lairs so that they can escape if a predator attacks one of their structures; ringed seals have co-evolved with their principal predator, the polar bear (Ursus maritimus) over the last tens of thousands of years (Stirling and Øritsland 1995). Arctic foxes (Alopex lagopus) are also an important predator in some coastal areas (Smith 1976, Lydersen 1998). In addition to the constructed holes and lairs, ringed seals also use natural cracks along pressure ridges and leads in the sea ice for breathing.

Reported mean age at sexual maturity (MAM) for ringed seals females varies in the literature from 3.5 – 7.1 years (Holst and Stirling 2002, Krafft et al. 2006). Males likely do not participate in breeding before they are 8 and 10 years old. The average size of adults 10 years and older varies between locations and different age cohorts, but averages of 115-136 cm in length and 40-65 kg in weight have been reported, with males being slightly larger than females (Smith 1973, Frost and Lowry 1981, Smith 1987, Lydersen and Gjertz 1987). Ringed seals are long lived, with ages close to 50 reported (e.g. Lydersen and Gjertz 1987). Reproductive rates of adult female ringed seals vary between 0.45-0.86 (see Reeves 1998), with a maximum of 0.91 (Lydersen and Gjertz 1987). Regional production rates are variable; reproductive success depends on many factors including prey availability, the relative stability of the ice, sufficient snow accumulation prior to the commencement of breeding, etc. (e.g., Lukin 1980, Kelly 1988, Smith 1987, Lydersen 1995).

A single pup, weighing 4.0-4.5 kg, is born in the spring (March to May), with most pups being born in early April (Frost and Lowry 1981). In Lake Saimaa and in the southern part of Baltic Sea pups are born somewhat earlier, in late February or early March (Pälsi 1924, Sipilä 2003). Births occur in subnivean lairs excavated in snow that accumulates upwind and downwind of ice ridges (Smith and Stirling 1975, Furgal et al. 1996), or in cavities occurring between blocks of ice in pressure ridges (McLaren 1958, Kelly 1988). Lairs provide thermal protection against cold air temperatures and high wind chill and afford at least some protection from foxes and polar bears (Smith 1976, 1980, Smith and Stirling 1975, Gjertz and Lydersen 1986). A female will move a young pup between lairs within her complex of lairs (usually 4-6 per female) if one lair is attacked by a predator; older pups are able to shift between structures independently as they develop swimming skills in the first weeks of life (Lydersen and Hammill 1993a,b). Lactation lasts an average of 39 days and pups are weaned at approximately 20 kg (Lydersen and Kovacs 1999). Females mate towards the end of the lactation period, similar to other phocid seals. Shore-fast ice is considered to be the most important habitat for pupping, although the importance of pack ice is not well known; this habitat is used at least in the Davis Strait and in the Barents Sea (e.g. Wiig et al. 1999).

Ringed seals moult from around mid-May to mid-July when they spend quite a bit of time hauled out on ice at the edge of the permanent pack ice, or on remnant land-fast ice along coastlines (Reeves 1998). Feeding intensity is at a minimum at this time (Ryg et al. 1990).

Outside the breeding and moulting seasons, arctic ringed seals are distributed in waters of nearly any depth; their distribution is strongly correlated with seasonally and permanently ice-covered waters and food availability (e.g. Simpkins et al. 2003, Freitas et al. 2008).

Many studies of the diet of arctic ringed seal diet have been conducted and although there is considerable variation in the diet regionally, several patterns emerge. Most ringed seal prey is small, and preferred prey tends to be schooling species that form dense aggregations. Fishes are usually in the 5-10 cm range and crustacean prey in the 2-6 cm range. Typically, a variety of 10-15 prey species are found with no more than 2-4 dominant prey species for any given area. Fishes are generally more commonly eaten than invertebrate prey, but diet is determined to some extent by availability of various types of prey during particular seasons as well as preference, which in part is guided by energy content of various available prey (Reeves 1998, Wathne et al. 2000). Polar cod (Boreogadus saida) is often reported to be the most important prey species for ringed seals (see Labansen et al. 2007 for review). Young polar cod (≤2 yrs) are often found closely associated with sea ice, living under and even in spaces within sea ice (Falk-Petersen et al. 1986). Ringed seals also eat a variety of other members of the cod family, including arctic cod (Arctogadus glacialis; Holst et al. 2001), and saffron cod (Eleginus gracilis) with the latter being particularly important during the summer months in Alaskan waters (Lowry et al. 1980). Redfish (Sebastes spp.), capelin (Mallotus villosus) and herring (Clupea harengu) are also important in the diet of arctic ringed seals in some regions. Invertebrate prey seems to become more important to ringed seals in the open-water season and often dominates the diet of young animals (e.g. Lowry et al. 1980, Holst et al. 2001). Large amphipods (e.g. Themisto libellula), krill (e.g. Thysanoessa inermis) mysids (e.g. Mysis oculata), shrimps (e.g. Pandalus spp., Eualus spp., Lebbeus polaris, Crangon septemspinosa) and cephalopods (e.g. Gonatus spp.) are all eaten by ringed seals and can be very important in some regions at least seasonally.

Ringed seals in the Baltic sea as well as in Lakes Saimaa and Ladoga use ice for breeding and moulting, but are forced to haul out on islands and shorelines during the summer season when ice is not available. Their general season patterns are similar to those of arctic dwelling ringed seals. One notable difference in social structure is that Ladoga ringed seals form large herds during the open water period; this behaviour of mass haulouts is concentrated in the Valamm Nature Park (Agafonova et al. 2007).

Saimaa and Ladoga ringed seals are confined to freshwater lakes where they prey on a wide variety of fish and some invertebrates, especially smelt (Osmerus eperlanus), vendace (Coregonus albula), burbot (Lota lota), perch (Perca fluviatalis), roach (Rutilus rutilus), whitefish (Coreogonus lavaretus) and other fishes in small quantities (Sipilä and Hyvärinen 1998, Agafonova et al. 2007).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The preferred habitat of P. hispida is areas that freeze to stable ice in winter (Kingsley 1990). This species lives in darkness under ice for several months during the year (Hyvarinen 1988). Ringed seals make lairs in the snow and ice for protection from predators and thermal shelter. They can occupy ice covered areas by maintaining breathing holes and breathing through cracks in the ice. Ringed seals make their lairs by rubbing away the ice with their fore flippers (Smith and Stirling 1975).

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 125 specimens in 1 taxon.
Water temperature and chemistry ranges based on 45 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 1.290
  Nitrate (umol/L): 0.703 - 7.860
  Salinity (PPS): 27.042 - 33.247
  Oxygen (ml/l): 7.898 - 8.919
  Phosphate (umol/l): 0.451 - 1.130
  Silicate (umol/l): 1.170 - 6.034

Graphical representation

Temperature range (°C): -1.109 - 1.290

Nitrate (umol/L): 0.703 - 7.860

Salinity (PPS): 27.042 - 33.247

Oxygen (ml/l): 7.898 - 8.919

Phosphate (umol/l): 0.451 - 1.130

Silicate (umol/l): 1.170 - 6.034
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Nonbreeders occur in flaw zone and moving pack ice during breeding season; congregate along leads in ice in late spring. In summer all age classes and both sexes occur along edge of permanent ice pack and in near-shore ice remnants. Some, mainly juveniles, occupy ice-free areas through the summer. In winter, maintains individual breathing holes through ice and is able to inhabit areas of continuous ice cover. Individuals seasonally use one or more lairs under snow (Kelly and Quakenbush 1990). Relict lake-dwelling populations occur in the Baltic region. Highest densities of breeding adults occur on stable landfast ice; stable pack ice also is important in some areas (Sea of Okhotsk, Baffin Bay); some are born on drifting pack ice of the northern Chukchi Sea and Arctic Ocean (Reeves et al. 1992). In most areas pups born in den made under snow by female or in natural snow cave, above breathing hole through ice (Frost and Lowry 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The ringed seal usually inhabits cold oceanic waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic and sub-Arctic; Associated with sea ice year-round; Pup and breed mostly in landfast ice areas
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

May migrate many hundreds of kilometers between southern winter range and northern summer range. In the high arctic, many adults occupy the same bay or fiord year-round.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Ringed seals spend most of their time feeding from late summer to early spring (Frost and Lowry 1981). During the spring and summer, Pusa hispida feeds on saffron cod (Eleginus gracilis), various shrimps, hypeni amphipods, and euphausiids. In the fall, Pusa hispida eats mostly saffron cod, and from winter to early spring, ringed seals feed mainly on Arctic cod (Boreogadus saida) (Lowry et al. 1980).

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Fishes of cod family, pelagic amphipods, euphausiids, shrimps, and other crustaceans make up bulk of diet. Feeding activity is minimal during molt period (peaks in June).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic and near bottom feeder; Primary prey includes schooling fishes and zooplankton
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Pusa hispida is an important source of food for humans, dogs, foxes, and polar bears in the Arctic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Ringed seals are preyed on by humans and polar bears in the Arctic. Pups are taken by bears, foxes, and humans when they are in the birth lair (Hammill and Smith 1991). As a result of strong predation, ringed seal pups spend a large proportion of time in the water and learn to dive at an extremely young age (Lydersen and Hammill 1993).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Phoca hispida (ringed seals) preys on:
zooplankton
Copepoda
Parathemisto
Boreogadus saida

Based on studies in:
Arctic (Marine)
Canada, high Arctic (Ice cap)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
  • M. S. W. Bradstreet and W. E. Cross, Trophic relationships at High Arctic ice edges, Arctic 3(1)5:1-12, from p. 9 (1982).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Phoca hispida (ringed seals) is prey of:
Orcinus orca
Somniosus microcephalus

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: The most abundant of arctic seals. Total population is in the millions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Distances between subnivean lairs used by a single seal may be up to a couple of miles (Kelly and Quakenbush 1990). Polar bears, arctic foxes, and humans are the only significant predators (Frost and Lowry 1981); polar bear sometimes may kill one-third or more of the pups in an area (Reeves et al. 1992). Avian predation on pups might be an important factor limiting the southern breeding range (Reeves et al. 1992). In the Sea of Okhotsk, mortality rate is about 35% in the first year, average of 11% for each of the next 12 years (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Size at birth 0.6m (2 ft), 4-5kg (9-11 lbs); Sexual maturity at 5-7 years; Females have pups every year; Birthing occurs within lairs; Longevity 25-40 years; Behavior; Mostly solitary; Excavates lairs in snow on fast ice; Hauls out in center of ice floes, keeping breathing holes open
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 46 years (captivity) Observations: With a 3.5 months period of delayed implantation, the total gestation lasts 11 months (Ronald Nowak 2003). In the wild, these animals have been reported to live up to 46 years (Bernhard Grzimek 1990), which is plausible. Little is known about their longevity in captivity, but one wild born specimen was about 14.4 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males are thought to be polygynous and probably hold underwater territories.

Mating System: polygynous

The female ringed seal matures reproductively at about 6 years of age and may bear one pup per year (Kingsley 1990). Most mating occurs in late April and early May, which is within one month of parturition (Frost and Lowry 1981). Although mating occurs in May, the blastocyst does not implant until August or September. The gestation period is approximately 240 days (Kingsley 1990). Ringed seals require solid ice for pupping, which makes the pups more vulnerable to predators.

Breeding interval: Females generally breed once yearly.

Breeding season: Most mating occurs in late April and early May.

Average number of offspring: 1.

Average gestation period: 240 days.

Average age at sexual or reproductive maturity (female): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pups are born in late March and April (earlier in Baltic); usually a single pup. Female nurses pup 5-7 weeks, abandons pup at or around time of ice break up. Breeds mostly late April-early May within 1 month after parturition. Sexually mature at average age of 5-6 or 6-7 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pusa hispida

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTTAGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGATGACCAAATTTACAACGTAATTGTCACCGCCCATGCATTTGTAATAATTTTCTTCATGGTAATGCCTATCATAATTGGCGGCTTTGGGAACTGACTAGTGCCCCTAATAATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTTTTACCACCATCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGGACCGGGTGAACCGTTTATCCTCCCCTAGCCGGGAACCTGGCTCATGCAGGGGCATCTGTAGATCTAACGATTTTCTCCCTCCACTTGGCAGGTGTATCATCTATTCTCGGGGCTATCAACTTCATCACCACCATCATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTGTGATCCGTATTAATCACGGCAGTGCTCCTACTATTGTCATTACCAGTCCTAGCAGCTGGCATCACCATACTACTCACAGATCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCTATCCTGTACCAACATCTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pusa hispida

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phoca hispida

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCCACAAATCATAAGGATATTGGCACTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTTAGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTTGTAATAATTTTCTTCATGGTAATGCCTATCATAATTGGCGGCTTTGGGAACTGACTAGTGCCCCTAATAATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTTTTACCACCATCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGAACCGGGTGAACCGTTTATCCTCCCCTAGCCGGGAACCTGGCTCATGCAGGGGCATCTGTAGATCTAACGATTTTCTCCCTCCACTTGGCAGGTGTATCATCTATTCTCGGGGCTATCAACTTCATCACCACCATCATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTGTGATCCGTATTAATCACGGCAGTGCTCCTTCTATTGTCACTACCAGTCCTAGCAGCTGGCATCACCATGCTACTCACAGATCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCCATCCTGTACCAACATCTATTCTGATTCTTCGGACATCCCGAAGTATATATCCTAATCCTACCAGGATTCGGAATAATCTCACACATTGTTACCTACTATTCAGGGAAAAAAGAACCTTTTGGTTATATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCATATATTCACTGTAGGGATGGACGTCGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phoca hispida

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kovacs, K., Lowry, L. & Härkönen, T. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
P. h. hispida - Has a very large population size and broad distribution, however, there are future concerns for Arctic Ringed Seals with climate change impacts on Arctic sea ice; negative influences of climate change are already being documented in some parts of the subspecies range. Hence, this subspecies will need regular review.

P. h. botnica is currently showing an increase because of positive trends in one (its primary) breeding site, but there were recent-past population-wide declines, and current declines in some parts of its range. Additionally, climate change is likely to have a negative impact on this subspecies.

P. h. ladogensis has declined dramatically in recent decades. By-catch in fishing gear is the primary cause for the current declines, but climate change impacts are likely to be additive in the near future.

P. h. saimensis – The Saimaa Ringed Seal is a very small population that faces on-going threats from high mortality in fishing gear and virtually complete reproductive failure in recent years due to poor ice conditions within its limited range.

P. h. ochotensis – Ringed Seals in the Sea of Okhotsk have not been censused since the late 1960s. Population numbers and trends are unknown. Population work on this subspecies should be a high priority as climate change impacts are likely to have negative consequences for Ringed Seals in the Sea of Okhotsk.

For the global assessment at the species level, the Arctic Ringed Seals' numerous status and broad distribution leads to the classification of Least Concern for this species. However, given the risks posed by climate change to all Ringed Seal subspecies, including the Arctic Ringed Seals, this species should be reassessed within a decade.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pusa hispida is a very common species and, as of now, there are no measures to protect it The habitat is protected as it is the same habitat as the polar bear (Ursus maritimus). The ringed seal is an important part of the polar bear's diet (Kingsley 1990).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
P. h. hispida
The world-wide population size of arctic ringed seals is not accurately known. Citing many factors such as the vast geographic area occupied by the species, its highly variable distribution within areas that have been surveyed, the unknown relationship between the numbers of seals observed versus those not seen, and other factors, Frost and Lowry (1981) state that it is “unwise to attempt an estimate of the world population of this subspecies” (P. h. hispida). Despite numerous surveys at specific locales conducted since, Reeves (1998) believes that “this conclusion remains appropriate.”

Nevertheless, published world-wide population estimates exist including 6-7 million (Stirling and Calvert 1979) and 2.5 million (Miyazaki 2002). Some recent survey and pup production data are available from parts of the arctic ringed seal’s range (e.g. Frost and Lowry 2004, Bengtson et al. 2005, Moulton et al. 2005, Krafft et al. 2006), but these data are limited in spatial scope. Little information is available from large parts of the ringed seal’s arctic range, such as the eastern parts of the Russian Federation (but see Ognetov 1993). Decreased pup production and survival have recently been documented in some areas that have been attributed to climate change (e.g. Ferguson et al. 2005, Stirling 2005).

P. h. botnica
During the past century Baltic ringed seals declined precipitously from 190,000-220,000 to approximately 5,000 by the late 1970s (Harding and Härkönen 1999). The principle reason for the decline was over-harvesting, but low fertility caused by organochlorines and other contaminants may also have inhibited natural population growth during the decades following protection. The population of P. h. botnica was estimated to be between 5,000 and 8,000 individuals in the late 1990s; during 1998-2006 the number of ringed seals in Bothnia Bay, where about 75% of the population resides, has increased at a rate of 4.3 % per year (Karlsson et al. 2007). However, in the Gulf of Riga it is thought that the 1,400 seals counted in 1996 have been experiencing a steady decline since that time. The small subpopulation in the Gulf of Finland (~300 animals) has showed no increase since 1994. Current sea ice trends in the Baltic and future projections for the next 30 years pose a major threat to all southern populations in the Baltic; only the Bay of Bothnia is likely to retain fairly good winter sea-ice habitat for ringed seals (Meier et al. 2004).

P. h. ladogensis
The size of the P. h. ladogensis population was thought to be about 20,000 at the start of the 20th century, but bounties were paid to reduce the population and by the 1970s there were approximately 10,000 animals remaining (Agafonova et al. 2007). In 2001, the aerial survey of the basking population counted 2,000 (+-70) individuals on the ice (Verevkin 2002), which suggests a total population size of 3,000 to 5,000 seals (Agafonova et al. 2007).

By-catch in fishing gear is the major source of mortality in this population. Deaths due to this source alone account for 10-16% of the population annually (Verevkin et al. 2006), which is clearly unsustainable. The Ladoga ringed seal is listed in the Red Data Book of the Russian Federation.

P. h. saimensis
The number of P. h. saimensis in Lake Saimaa fell below 200 individuals in the early 1980s (Sipilä and Hyvärinen 1998). Thereafter, for a short period the population was increasing (to 240 in 2000, Sipilä 2003, Auvinen et al. 2005), reaching a maximum estimate of 280 in 2005 individuals for a brief time (Sipilä and Kokkonen 2008). A population viability analysis conducted by Ranta and Lundberg (2006, unpublished) suggested a potential for optimism regarding the survival of this population, as did projections in Sipilä (2006). But climate change impacts on Saimaa seal habitat were not incorporated into these predictions (Sipilä and Kokkonen 2008), nor was much attention paid to the fact that the population within the lake system is geographically subdivided (Sipilä at al. 2005), and the subdivision could markedly increase the future rate of inbreeding (Palo et al. 2003). Currently, mortality induced by fisheries by-catch is significant (Kokko et al. 1998, Sipilä and Hyvärinen 1998, Sipilä 2003). This mortality source, in addition to very high pup mortality during 2005-2007, is expected to cause this population to once again decline (Sipilä and Kokkonen 2008).

P. h. ochotensis
In the Sea of Okhotsk estimates for ringed seal abundance in 1968 and 1969 were 818,000 and 865,000 respectively (Reeves 1998). The population of P. h. ochotensis was estimated to be 800,000-1,000,000 by Miyazaki (2002). However, in reality no recent data are available and current population trends are unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Humans have hunted ringed seals in the Arctic since the arrival of people to the region millennia ago (e.g. Murdoch 1893, Riewe and Amsden 1979). They are a fundamental subsistence food item for most coastally dwelling northern peoples. Reeves (1998) reported an annual quota for shore-based hunters in the Sea of Okhotsk of 7,500 and a combined estimate of 10,000 taken per year from the Bering, Chukchi, and Western Beaufort Sea by Russians and Native Alaskans. Further, Reeves (1998) estimates that the annual removal of ringed seals in the Canadian Arctic is in the “high tens of thousands” at present, and that in 1980s, including animals killed and lost, the harvest was between 60,000 and 80,000, and may have exceeded 100,000 in some years. Another substantial annual harvest occurs in Greenland with nearly 100,000 taken per year in the 1970s and approximately 70,000 taken annually in the early 1990s (Teilmann and Kapel 1998).

Commercial harvests of ringed seals in the early to mid-20th century at southern latitudes were sometimes large and probably had significant local impacts on the respective populations. Annual harvests of 72,000 from 1955 to 1965 in the Sea of Okhotsk, 20,000 in the Baltic Sea, as well as commercial harvests in Lakes Ladoga and Saimaa (Reeves 1998, Sipilä and Hyvärinen 1998) all provide examples of the negative effect of localized over-harvesting on ringed seal populations. Kokko et al. (1997) have suggested that the sustainable harvest level for Baltic ringed seals at the end of the 1990s was close to zero (Kokko et al. 1997). Harvest statistics reported for Western Russia by Belikov and Boltunov (1998) suggest that maximum catches earlier in this century exceeded the total allowable catches (TACs) significantly, with harvests of up to 8,900 in the White Sea (1912), 13,200 in the Russian Barents Sea (1962), and 13,200 in the Kara Sea (1933). These harvests are thought to have dropped considerably in recent decades, though there are no available data. Reporting of harvest statistics and enforcement of TACs is difficult to manage in outlying areas, and the harvest of ringed seals in eastern Russia is largely unknown.

Ringed seals carry loads of organochlorine and heavy metal contaminants from human industry and agriculture which have been implicated in uterine pathology in Baltic seals (Bergman and Olsson 1986), and high concentrations of mercury in Saimaa seals is thought to have reduced pup production in the 1960s and 1970s (Sipilä and Hyvärinen 1998, Kostamo et al. 2002). However, following restrictions on the use and release of persistent organic pollutants (POPs) into the environment, levels are dropping rapidly in the Baltic (e.g. Kostamo et al. 2002). The same is true with regards to POPs in Arctic populations (e.g. Wolkers et al. 2008). Oil contamination poses poorly known risks to ringed seal populations. The greatest impacts would likely result if spills occurred during the pupping season or if food resources were negatively effected (Smith 1987, Reeves 1998).

Manipulation of water levels, recreational snow machine operation, net-fishing, boating, tourism and development of cottages on the shoreline at Lake Saimaa have been noted as threats to the ringed seals in Lake Saimaa, and industrial pollution, net fishing and poaching, as well as disturbance of on-shore summer haulout groups have been highlighted as threats for the Lake Ladoga ringed seals (Sipilä and Hyvärinen 1998, Agafonova et al. 2007). Predation by red fox (Vulpes vulpes), wolves (Canis lupus), feral and domestic dogs and even birds of prey are also risks for these lake seals (e.g. Kunnasranta et al. 2001). By-catch in fisheries and other negative impacts associated with fisheries conflicts seem at present to be the major threat to the two subspecies of ringed seals occupying Lakes Saimaa and Ladoga (Kokko et al. 1998, Sipilä and Hyvärinen 1998, Verevkin 2002, Sipilä 2003, Agafonova et al. 2007).

Global warming may pose the greatest threat to ringed seals in all subspecies if it leads to large losses of the stable ice habitat required by ringed seals for pupping and rearing their young (Tynan and DeMaster 1997, Learmonth et al. 2006, Kovacs and Lydersen 2008, also see Laidre et al. 2008). Early break-up of the ice results in poor condition of pups and higher mortality rates (e.g. Smith and Harwood 2001). Associated changes in precipitation and weather patterns could also negatively effect ringed seal populations if there is insufficient snow cover to protect pups in lairs in the spring (Stirling and Derocher 1993; Ferguson et al. 2005). Pups born outside lairs have a very low chance of survival; the pups are so small that even large gulls can be predators if they are exposed (e.g. Lydersen and Smith 1989). Declining trends in reproduction and survival of pups have already been noted in some regions that have been attributed to earlier break-up of the sea ice over recent decades and concomitant changes in the marine ecosystem (Ferguson et al. 2005, Stirling 2005).

Ice is also needed by ringed seals for moulting, resting, and in some populations foraging, but the type of ice and its stability is more flexible outside the breeding season, though northern ringed seals still exhibit a clear preference for areas with considerable ice coverage (Simpkins et al. 2003, Freitas et al. 2008). Reductions in arctic sea ice could have quite dramatic effects via prey availability if polar and arctic cod populations are negatively impacted. Climate change impacts could be particularly acute for ringed seals living in restricted habitats such as the Ladoga and Saimaa Lake populations (Learmonth et al., 2006), and possibly also for ringed seals in the Okhotsk and Baltic Seas (see Meier et al. 2004). In Lake Saimaa there was an abnormally high lair mortality of pups in 2006 and 2007 because of poor ice and snow conditions (Sipilä et al. 2007).

Reductions in sea ice cover will likely lead to increased human activity in the Arctic in the form of shipping and resource extraction industries, with associated increased threat of marine accidents and pollution discharge (Pagnan 2000). An increase in human created noise in the arctic environment could cause marine mammals, including ringed seals, to abandon areas (Tynan and DeMaster 1997). Disturbance seems to be disruptive to haulout groups in Lake Ladoga during summer and routine day-tourism seems to have caused the desertion of at least two previously used sites (Agafonova et al. 2007, Verevkin et al. 2007). However, it must be noted that Moulton et al. (2002, 2003, 2005) found no more than slight effects on ringed seals from construction, drilling and operation of the Northstar offshore island oil production facility in the Beaufort Sea, and other assessments of industrial activities in the Arctic suggest relatively minor impacts on ringed seals (Kelly et al. 1988, Davis et al. 1991, Blackwell et al. 2004), though over-flights by aircraft certainly cause disturbance to ringed seals if flights occur by helicopter at less than 1,500 m and by fixed-winged aircraft at closer than 500 m (Born et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Local or regional overexploitation has occurred.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ringed Seals live primarily in the high Arctic and are heavily dependent on Arctic ice, almost never coming onto land. Warming spring temperatures and early ice breakup are causing nursing young to be prematurely separated from their mothers and to be exposed to both the elements and to predators (IUCN 2009).

Ringed Seal breeding is dependent on the availability of sufficient ice, at the correct time of year, in areas with sufficient food nearby. As the Arctic ice continues to melt earlier each year, more and more pups may be separated prematurely from their mothers. Both ice and snow must be stable enough in the spring season to allow successful completion of the six week lactation period. If the ice breaks up too soon, pups may be separated prematurely from their mothers, resulting in high pup mortality. Spring rains or warm spring temperatures can cause the roofs of lairs to prematurely collapse, leaving Ringed Seals unsheltered and exposed to predators. Insufficient snow at the beginning of the breeding season can have the same effect. Ringed Seals in some areas are already showing relatively long-term declines in reproductive rates and pup survival (IUCN 2009). Marked decreases in abundance are likely to have cascading effects in Arctic food webs. Ringed Seals are the most important species in the diet of Polar Bears.


As Arctic conditions warm, a greatly increased presence of humans in previously inaccessible areas is anticipated. Activities such as shipping, agriculture, and oil exploration are predicted to disturb and further degrade habitats and increased fishing in the area may reduce food availability (IUCN 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Ringed seals are protected by a variety of laws and quotas in different parts of their range, but even within Europe the legal provisions are not always being fully implemented in domestic law (Wilson et al. 2001). The population in Lake Saimaa has been protected since 1955, and additional protection has been afforded via the establishment of two national parks within the lake, and regulation of shoreline development. Similarly, the hunting of seals in Lake Ladoga was prohibited in 1980 (Sipilä and Hyvärinen 1998). In the United States the Marine Mammal Protection Act of 1972 allows ringed seals to be harvested only by Alaskan Native hunters for subsistence purposes, and that Act generally prohibits all other forms of taking except where specifically permitted (Angliss and Outlaw 2005). State Nature Reserves at Franz Josef Land and in the White and Kara seas protect large areas of ringed seal habitat in the western Russian Arctic (Belikov and Boltunov 1998). Quotas and licensing of hunting have been in place in various parts of the Russian Federation for decades (Belikov and Boltunov 1998), though this has done little to stop the decline of ringed seals in Lake Ladoga. Baltic ringed seals were protected from all killing by the Soviet Union in 1980, by Sweden in 1986, and by Finland in 1988 (Härkönen et al. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The ringed seal is also used by Inuit for fuel and clothing (Kingsley 1990). Newly moulted ringed seal pups are hunted by Canadian fur traders for their pelts (Frost and Lowry 1981).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Hunted by humans in the far north for millennia; used for food, animal food, clothing, lamp oil, and construction material; in some parts of the range, has been the backbone of Native economies; harvested now mainly for food (Reeves et al. 1992). Tens of thousands are harvested annually by Eskimos for subsistence and commercial uses (Frost and Lowry 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ringed seal

The ringed seal (Pusa hispida), also known as the jar seal and as netsik or nattiq by the Inuit, is an earless seal (family: Phocidae) inhabiting the Arctic and sub-Arctic regions. The ringed seal is a relatively small seal, rarely greater than 1.5 m in length, with a distinctive patterning of dark spots surrounded by light grey rings, whence its common name. It is the most abundant and wide-ranging ice seal in the northern hemisphere: ranging throughout the Arctic Ocean, into the Bering Sea and Okhotsk Sea as far south as the northern coast of Japan in the Pacific, and throughout the North Atlantic coasts of Greenland and Scandinavia as far south as Newfoundland, and include two freshwater subspecies in northern Europe. Ringed seals are one of the primary prey of polar bears and have long been a component of the diet of indigenous people of the Arctic.

Contents

Description

backflippers

The ringed seal is the smallest and most common seal in the Arctic, with a small head, short cat-like snout, and a plump body. Its coat is dark with silver rings on the back and sides with a silver belly, from which this seal gets its vernacular name.[2] Depending on subspecies and condition, adult size can range from 100 to 175 cm (40–69 in) and weigh from 32 to 140 kg (70-308 lbs).[3] The seal averages about 5 ft (1.5 m) long with a weight of about 50–70 kg (110-150 lbs).[4] This species is usually considered the smallest species in the true seal family, although several related species, especially the Baikal, may approach similarly diminutive dimensions. Their small front flippers have claws more than 1 inch (2.5 cm) thick that are used to maintain breathing holes through 6.5 ft (2 m) thick ice.[4]

Taxonomy and phylogeny

The taxonomy of ringed seal has been much debated and revised in the literature. Due to its wide range, as many as ten subspecies have been described.[5] Currently, five distinct subspecies are recognized: P. h. hispida in the Arctic Ocean and Bering Sea, P. h. ochotensis in the Sea of Okhotsk, P. h. saimensis in Lake Saimaa in Finland, P. h. ladogensis in nearby Lake Ladoga in Russia and P.h. botnica in the Gulf of Bothnia.[2] The ringed seal is most closely related to the Caspian seal (P. caspica) and Baikal seal (P. sibirica), all of which share similar small sizes, features of skull morphology and affinity for ice.[2]

The closest phylogenetic relatives to the ringed seal are the grey seal (Halichoerus grypus) and the species in the Phoca genus (harbor seal and largha seal), to which the ringed seals were formerly attributed.[6] Together with the remaining northern latitude ice seals (ribbon seal, bearded seal, harp seal and hooded seal), these seals constitute the subfamily Phocinae.[6]

Range and habitat

Ringed seal emerging from under the ice

Ringed seals occur throughout the Arctic Ocean. They can be found in the Baltic Sea, the Bering Sea and the Hudson Bay. They prefer to rest on ice floe and will move farther north for denser ice. One subspecies can be found in freshwater.

Ringed seals have a circumpolar distribution from approximately 35°N to the North Pole, occurring in all seas of the Arctic Ocean. In the North Pacific, they are found in the southern Bering Sea and range as far south as the Seas of Okhotsk and Japan. Throughout their range, ringed seals have an affinity for ice-covered waters and are well adapted to occupying seasonal and permanent ice. They tend to prefer large floes (i.e., > 48 m in diameter) and are often found in the interior ice pack where the sea ice coverage is greater than 90%. They remain in contact with ice most of the year and pup on the ice in late winter-early spring.[7]

Distribution in Alaska: Ringed seals are found throughout the Beaufort, Chukchi, and Bering Seas, as far south as Bristol Bay in years of extensive ice coverage. During late April through June, ringed seals are distributed throughout their range from the southern ice edge northward. Preliminary results from recent surveys conducted in the Chukchi Sea in May–June 1999 and 2000 indicate that ringed seal density is higher in nearshore fast and pack ice, and lower in offshore pack ice. Results of surveys conducted by Frost and Lowry (1999) indicate that, in the Alaskan Beaufort Sea, the density of ringed seals in May–June is higher to the east than to the west of Flaxman Island. The overall winter distribution is probably similar, and it is believed there is a net movement of seals northward with the ice edge in late spring and summer. Thus, ringed seals occupying the Bering and southern Chukchi Seas in winter apparently are migratory, but details of their movements are unknown.[7]

Ringed seals reside in arctic waters and are commonly associated with ice floes and pack ice.[4] The ringed seal maintains a breathing hole in the ice thus allowing it to use ice habitat that other seals cannot.

Life history

Pup of ringed seal.

Females reach sexual maturity at 4 years while males do not reach maturity until 7 years old.[4] During the spring breeding season, females construct lairs within the thick ice and give birth in these structures. Females give birth to a single pup on ice floes or shorefast ice in March or April after a 9 month gestation period. Pups are weaned after one month[4] and build up a thick layer of blubber.

Females usually begin mating in late April.[4] Males will roam the ice for a mate. When found, the male and female may spend several days together before mating. Then the male looks for another mate.

Ringed seals live about 25 to 30 years.[4] They are solitary animals and when hauled out on ice separate themselves from each other by hundreds of yards.[4]

Diet

Ringed seals eat a wide variety of small prey that consists of 72 species of fish and invertebrates. Feeding is usually a solitary behavior and their prey of choice includes mysids, shrimp, arctic cod, and herring. While feeding, ringed seals dive to depths of 35 to 150 ft (10–45 m).[4] In the summer ringed seals feed along edge of the sea-ice for polar cod. In shallow water they feed on smaller cod. Ringed seals may also eat herring, smelt, whitefish, sculpin, perch, and crustaceans.

Predators

Ringed seal are an important food item in particular for polar bears.[8] During the pupping season, arctic fox and glaucous gulls take ringed seal pups born outside lairs while killer whales, Greenland sharks and occasionally Atlantic walruses prey upon them in the water.[9]

Human interactions

Ringed seals have long been an important component of the diet of Arctic indigenous peoples throughout their range, and continue to be harvested annually by many communities.[4] Early Paleoeskimo sites in Arctic Canada revealed signs of harvested ringed seals dating from ca. 4000–3500 B.P., likely captured in frozen cracks and leads in the ice, with a selection for juveniles and young adults.[10] However, in 2012 the Government of Nunavut warned pregnant women to avoid eating the liver due to elevated levels of mercury.[11]

Preparation of the ringed seal
skin of the ringed seal.

Bycatch in fishing gear, such as commercial trawls, is also another threat to ringed seals.[4] Climate change is potentially the most serious threat to ringed seal populations since much of their habitat is dependent upon pack ice.[4] Birthing lairs are often destroyed before the seal pup is able to forage on its own leading to poor body condition.[citation needed]

Conservation in the USA

The estimated population size for the Alaska stock of ringed seals is 249,000 animals.[4] Currently, the population trend for this stock is unknown.[4] Ringed seals are listed as a species of "least concern" by the IUCN,[1] and are considered not “threatened” under the Endangered Species Act.[7] Reliable estimates of the minimum population, potential biological removal, and human-caused mortality and serious injury are currently not available.[7] Because the potential biological removal for ringed seals is unknown, the level of annual U.S. commercial fishery-related mortality that can be considered insignificant and approaching zero mortality and serious injury rate is unknown.[7] No information is available on the status of ringed seals.[7] Due to a very low level of interactions between U.S. commercial fisheries and ringed seals, the Alaska stock of ringed seals is not considered a strategic stock.[7]

On March 28, 2008, the U.S. National Marine Fisheries Service initiated a status review[12] under the Endangered Species Act (ESA) to determine if listing this ice seal species under the ESA is warranted.

Subspecies

The populations living in different areas have evolved to separate subspecies, which are currently recognized as [2]:

The three last subspecies are isolated from the others, like the closely related Baikal seal and Caspian seal.

See also

References

This article incorporates public domain work of the United States Government from references.[4][7]

  1. ^ a b Kovacs, K., Lowry, L. & Härkönen, T. (2008). Pusa hispida. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009. Database entry includes justification for why this species is of least concern
  2. ^ a b c d Miyazaki, Nobuyuki (2009). "Ringed, Caspian and Baikal Seals". In Perrin, William F.; Wursig, Bernd; Thewissen, J. G. M. Encyclopedia of Marine Mammals (2 ed.). 30 Corporate Drive, Burlington Ma. 01803: Academic Press. pp. 1033–1036. ISBN 978-0-12-373553-9. 
  3. ^ [1] (2011).
  4. ^ a b c d e f g h i j k l m n o PD-icon.svg Office of Protected Resources - NOAA Fisheries. "Ringed Seal (Phoca hispida)". accessed 11 March 2010.
  5. ^ Masao Amano, Azusa Hayano and Nobuyuki Miyazaki (2002). "Geographic variation in the skull of the ringed seal Pusa hispida". Journal of Mammalogy 83 (2): 370–380. doi:10.1644/1545-1542(2002)083<0370:GVITSO>2.0.CO;2. 
  6. ^ a b Corey S. Davis, Isabelle Delisle, Ian Stirling, Donald B. Siniff and Curtis Strobeck (2004). "A phylogeny of the extant Phocidae inferred from complete mitochondrial DNA coding regions". Molecular Phylogenetics and Evolution 33 (2): 370–380. doi:10.1016/j.ympev.2004.06.006. PMID 15336671. 
  7. ^ a b c d e f g h PD-icon.svg Angliss R. P. & Outlaw R. B. (Revised 15 May 2006) "Ringed Seal (Phoca hispida): Alaska Stock". "Alaska Marine Mammal Stock Assessments". NOAA Technical Memorandum AFSC 168: 51-55.
  8. ^ C. Michael Hogan (2008) Polar Bear: Ursus maritimus, globalTwitcher.com, ed. Nicklas Stromberg
  9. ^ Bjørn A. Krafft, Kit M. Kovacs, Anne Kirstine Frie, Tore Haug and Christian Lydersen (2006). "Growth and population parameters of ringed seals (Pusa hispida) from Svalbard, Norway, 2002–2004". ICES Journal of Marine Science 63 (6): 1136–1144. doi:10.1016/j.icesjms.2006.04.001. 
  10. ^ Murray, M. S. (2005). "Prehistoric Use of Ringed Seals: A zooarchaeological Study from Arctic Canada". Environmental Archaeology 10 (1): 19-38
  11. ^ Study says ringed seal liver dangerous for pregnant women
  12. ^ (28 March 2008). "Proposed Rules". Federal Register 73(61).
  13. ^ Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  14. ^ "Simulated Distributions of Baltic Sea-ice in Warming Climate and Consequences for the Winter Habitat of the Baltic Ringed Seal". Allen Press. Retrieved 16 August 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Patterns of geographic variation in skull morphology showed that although ringed seals from Lake Ladoga and Saimaawere considerably differentiated, specimens from other localities were not distinguishable from each other, suggesting similar selection pressure or extensive gene flow especially in the Arctic basin (Amano et al. 2002). These authors considered it reasonable to recognize 5 subspecies in P. hispida: P.h. hispida, P. h. botnica, P. h. ladogensis, P. h. ochotensis, and P. h. saimensis.

The ringed seal was placed in the genus Pusa by Muizon (1982), Rice (1998), Baker et al. (2003), Wozencraft (in Wilson and Reeder 2005), and some other authors, but regarded (with the nominal genera Histriophoca and Pagophilus) as a member of the genus Phoca in other literature (e.g., King 1983; Riedman 1990; Nowak 1991; Reeves et al. 1992; Wozencraft, in Wilson and Reeder 1993).

A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995).

Mouchaty et al. (1995) examined the cytochrome b gene and found a close phylogenetic relationship between Pusa hispida and Halichoerus grypus, which, they noted, merits further study.

Árnason et al. (1995, 2006) assigned Pusa, Phoca, and Halichoerus to subgenera within Phoca. Noting the morphological distinctness of Halichoerus, Fulton and Strobeck (2010) considered the generic distinctions to be unresolved. NMFS follows Burns and Fay (1970) and Árnason et al. (2006) and classify ringed seals as Phoca hispida with the recognition that molecular and morphological analyses remain incompletely resolved (Kelly et al. 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!