Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

The distribution of crabeater seals is tied to seasonal fluctuations of the pack ice. They can be found right up to the coast of Antarctica, as far south as McMurdo Sound, during late summer ice break-up. They occur in greatest numbers in the seasonally shifting pack ice surrounding the Antarctic continent. As vagrants they travel as far north as New Zealand and the southern coasts of Africa, Australia, and South America. Crabeaters have been known to occasionally wander far inland and die in the dry valleys adjacent to McMurdo Sound. A live animal was found 113 km from open water at an elevation of 920 m above sea level, and carcasses have been found as high as 1,100 m above sea level (Kooyman 1981, Rice 1998, Bengtson 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The crabeater seal, Lobodon carcinophaga, is primarily found on the coast and pack ice of Antarctica. In the winter months, it may be found on the shores of South America, Australia, South Africa, Tasmania, New Zealand, and various islands surrounding Antarctica. In the winter its range covers about 22 million sq km. (Kooyman 1981, Nowak 1997).

Biogeographic Regions: ethiopian (Native ); neotropical (Native ); australian (Native ); antarctica (Native ); oceanic islands (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Kooyman, G. 1981. Crabeater Seal Lobodon carcinophagus. Pp. vol 2: 221-235 in S Ridgeway, R Harrison, eds. Handbook of Marine Mammals. London: Academic Press.
  • Nowak, R. 1997. "Walker's Mammals of the World 5.1 (online): John's Hopkins University Press" (On-line). Accessed May 31, 2002 at http://www.press.jhu.edu/books/walker/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

After the summer moult, the crabeater seal is dark brown dorsally and grades to blonde ventrally. It has darker brown markings on the back and sides over the paler brown pelage. The flippers are the darkest parts of the body. Its fur slowly changes to blonde throughout the year and it is almost entirely blonde by the summer. In fact it has been called "the white Antarctic seal" (Kooyman 1981). It has a long snout and a fairly slim body compared to other seals. Females are slightly larger on average than males with a length from 216 cm to 241 cm. Males range from 203 cm to 241 cm.

The crabeater seal often has long scars running along the sides of its body. These are most likely inflicted by its major predator, the leopard seal, Hydrurga leptonyx (Siniff and Bengston 1977).

Its teeth are very distinct and have been called "the most complex of any carnivore" (Kooyman 1981). There are several tubercles on each tooth with spaces between them that cut deeply into the tooth. The main cusps of upper and lower teeth fit perfectly together. When the crabeater seal closes its mouth, the only spaces are those between the tubercles. This arrangement probably serves as a sieve through which to strain krill, their primary food source. (Kooyman 1981, Nowak 1997).

Range mass: 200 to 300 kg.

Range length: 203 to 241 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Siniff, D., I. Stirling, J. Bengston, R. Reichle. 1979. Social and reproductive behavior of crabeater seals (Lobodon carcinophagus) during the austral spring. Canadian Journal of Zoology, 57: 2243-2256.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adults reach 2.6 m in length and weigh an estimated 200-300 kg. Neonates are thought to be at least 1.1 m and 20-40 kg. The mean age of sexual maturity in females varies from 2.5 to 4.2 years and these variations may be related to changes in food abundance (Bengtson and Laws 1985). Births occur mainly during the second half of October. Annual mortality is about 14.5% (Laws 1977b).

There are no specific rookeries and females haul-out singly on ice to give birth. Adult males attend female-pup pairs and stay with the female until her estrous one to two weeks after the pup is weaned. Mating has not been witnessed and presumably occurs in the water. Females are reported to bite males around the mouth and flippers and this may account for the abundant small scars on the faces of older males.

Pups are born from September to December (Southwell et al. 2003) in a soft woolly coat that is greyish-brown in colour and has been described as light, milk coffee brown, with darker colouring on the flippers. They are weaned in approximately three weeks (Southwell 2004) at which time they are moulting or just beginning their moult from the lanugo coat. The pup sheds into a sub-adult pelage similar to that of the adult.

Mortality is high in the first year, possibly reaching 80%. Much of this mortality is attributed to leopard seal predation, and up to 78% of crabeaters that survive through their first year have injuries and scars from leopard seal attacks. The presence of long scars and sets of parallel scars which are readily visible on the pale, relatively unmarked pelage of crabeaters, are testimony to the frequency of these attacks on young of this species. Leopard seal attacks appear to fall off dramatically after crabeaters reach one year of age.

Recent research has revealed that crabeater seals can dive to 430 m and stay submerged for 11 minutes, although most feeding dives were to 20-30 m, and shorter in duration. Foraging occurs primarily at night, and instrumented seals have been recorded to regularly dive continuously for periods up to 16 hours. Dives at dawn and dusk are deeper than at night, and indicate that crabeater feeding activity is also tied to the daily vertical migrations of krill. They have a general pattern of feeding from dusk until dawn, and hauling-out in the middle of the day.

Crabeater seals feed primarily on Antarctic krill, Euphausia superba and 95% of their diet is made up of this species. Small amounts of fish and squid are also part of the diet. All of the post-canine teeth are ornate, with multiple accessory cusps that interlock to form a network for straining krill from the seawater. A ridge of bone on each mandible fills the gap in the mouth behind the last upper post-canine teeth and the back of the jaw, which helps prevent the loss of krill from the mouth when feeding. Crabeater faeces are routinely a pinkish red, from their krill diet and reddish stains are frequently seen on the ice near where they are hauled-out.

Crabeaters are frequently encountered alone or in small groups of up to three on the ice or in the water. However, much larger groups of up to 1,000 hauled-out together have been observed. They can be seen swimming together in herds estimated to be up to 500 animals, breathing and diving almost synchronously. They are the only Antarctic phocid species that is highly gregarious. The moult is in January and February. A large proportion of the animals in an area are thought to be hauled-out during the annual moult.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The crabeater seal lives on the pack ice and the near freezing water surrounding Antarctica.

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6514 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6514 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.662 - 0.348
  Nitrate (umol/L): 23.142 - 30.651
  Salinity (PPS): 33.629 - 34.030
  Oxygen (ml/l): 7.542 - 8.213
  Phosphate (umol/l): 1.550 - 2.131
  Silicate (umol/l): 29.435 - 65.263

Graphical representation

Temperature range (°C): -1.662 - 0.348

Nitrate (umol/L): 23.142 - 30.651

Salinity (PPS): 33.629 - 34.030

Oxygen (ml/l): 7.542 - 8.213

Phosphate (umol/l): 1.550 - 2.131

Silicate (umol/l): 29.435 - 65.263
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6313 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6276 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.719 - 0.590
  Nitrate (umol/L): 22.624 - 30.357
  Salinity (PPS): 33.605 - 34.001
  Oxygen (ml/l): 7.399 - 8.213
  Phosphate (umol/l): 1.248 - 2.135
  Silicate (umol/l): 24.419 - 66.028

Graphical representation

Temperature range (°C): -1.719 - 0.590

Nitrate (umol/L): 22.624 - 30.357

Salinity (PPS): 33.605 - 34.001

Oxygen (ml/l): 7.399 - 8.213

Phosphate (umol/l): 1.248 - 2.135

Silicate (umol/l): 24.419 - 66.028
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The crabeater seal appears to be a misnomer as there is no evidence that it eats crabs. Its primary food is krill, Euphausia superba. It probably also eats other invertebrates. The crabeater seal feeds by swimming through a school of krill with its mouth open, sucking them in and then sieving the water out through its specialized dentition (Kooyman 1981, Nowak 1997). Klages and Cockcroft (1990) report that a captive crabeater seal was able to suck small fish into its mouth at distances of up to 50 cm. They note that this prey is much larger than the krill that it would consume in the wild, and suggest that it could probably suck krill in from a much greater distance. The seal preferred fish smaller than 12 cm and swallowed everything whole, in contrast to many seals which tear their food up with their teeth before swallowing. It was often observed exploring the bottom of its pool and sucking up debris. Klages and Cockcroft suggest that this is an adaption to winter feeding on krill in the Antarctic. At this time of year, krill is mainly found in crevices and caverns. The seal may be able to suck the krill out from these unreachable areas. Feeding probably occurs prinicipally at night (Nowak 1997).

Animal Foods: aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Eats non-insect arthropods)

  • Klages, N., V. Cockcroft. 1990. Feeding behaviour of a captive crabeater seal. Polar Biology, 10: 403-404.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

When the crabeater seal is approached it snorts, hisses, and bares its teeth. If caught, it rolls over several times. This is probably an avoidance tactic developed for its primary predators, the killer whale (Orcinus orca) and the leopard seal (Hydrurga leptonyx) (Stirling and Kooyman 1971).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Lobodon carcinophagus (crabeater seal) is prey of:
Odontoceti

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Lobodon carcinophagus (crabeater seal) preys on:
Euphausia superba
Euphausia crystallorophias

Based on studies in:
Antarctic (Estuarine)

This list may not be complete but is based on published studies.
  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: The total gestation time of about 10 months includes a period of delayed implantation (Ronald Nowak 2003). In the wild, these animals have been estimated to live up to 39 years (Ronald Nowak 1999). Their longevity in captivity has not been studied in detail and hence their maximum longevity remains unknown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction in the crabeater seal probably takes place on the pack ice surrounding Antarctica in the austral spring, from October to December (Kooyman 1981). Starting in September, a pregnant female occupies a space on the ice floe in which she gives birth and cares for her single pup. A male joins the female in her chosen area just before or just after parturition. He defends the female and the newborn pup. He is, in all likelihood, not the father of the pups. Females come into estrus just after weaning and Siniff et al. (1979) report that the male's only apparent interest is in waiting for the female to be sexually receptive. Males aggressively defend females from other intruding males. It is not clear if the males join the females because of a female cue such as scent or because of the pup.

Mating System: monogamous

Pups are born weighing approximately 20 kg and gain weight while nursing at about 4.2 kg/day (Shaughnessy and Kerry 1989). Physical contact between the mother and pup during this period is necessary. If either the pup or the mother strays, the other immediately follows. Pups are weaned at about 3 weeks old. It is unclear if physical mechanisms in the mother, such as reduced milk production, cause the weaning or if the defending male drives the pup and mother apart. Throughout the lactation period the male is aggressive towards the female. She defends herself by biting him on the neck and sides. By the end of lactation her body weight may be reduced by half, so she would be unable to defend herself adequately. She becomes sexually receptive shortly after weaning and, unlike most seals, copulation appears to occur on the ice floes instead of in the water (Shaughnessy and Kerry 1981; Siniff et al. 1979)

Gestation lasts about 11 months and probably includes a period of delayed implantation (Nowak 1997). Crabeater seals become sexually mature between 3 and 4 years of age and females may have successful pregnancies between 5 and 25 years old (Bengston and Siniff 1981).

Breeding season: Reproduction in the crabeater seal probably takes place on the pack ice surrounding Antarctica in the austral spring, from October to December.

Average number of offspring: 1.

Average gestation period: 11 months.

Average weaning age: 3 weeks.

Average time to independence: 3 weeks.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Bengston, J., B. Stewart. 1992. Diving and haulout behavior of crabeater seals in the Weddell Sea, Antarctica, during March 1986.
  • Shaugnessy, P., K. Kerry. January 1989. Crabeater Seals Lobodon carcinophagus during the breeding season: observations on five groups near enderby land, Antarctica. Marine Mammal Science, 5(1): 68-77.
  • Siniff, D., I. Stirling, J. Bengston, R. Reichle. 1979. Social and reproductive behavior of crabeater seals (Lobodon carcinophagus) during the austral spring. Canadian Journal of Zoology, 57: 2243-2256.
  • Kooyman, G. 1981. Crabeater Seal Lobodon carcinophagus. Pp. vol 2: 221-235 in S Ridgeway, R Harrison, eds. Handbook of Marine Mammals. London: Academic Press.
  • Nowak, R. 1997. "Walker's Mammals of the World 5.1 (online): John's Hopkins University Press" (On-line). Accessed May 31, 2002 at http://www.press.jhu.edu/books/walker/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lobodon carcinophaga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGGCTATTTTCCACAAATCACAAAGATATTGGCACTCTCTACCTACTATTCGGTGCATGAGCCGGCATAGTAGGTACCGCCCTCAGTCTTTTAATTCGCGCAGAACTAGGACAACCTGGCGCTTTACTAGGAGAC---GACCAAATTTATAACGTGATCGTCACCGCCCACGCATTCGTAATAATCTTTTTTATAGTAATACCTATCATAATCGGAGGCTTCGGAAACTGATTAGTACCCTTAATAATTGGTGCTCCTGACATAGCATTTCCCCGAATAAATAATATGAGCTTCTGACTTCTACCACCATCCTTCTTATTACTACTAGCTTCCTCCATGGTAGAAGCAGGTGCAGGAACAGGATGAACCGTATATCCTCCCTTAGCTGGCAATCTAGCTCATGCAGGAGCATCTGTAGACTTAACAATTTTCTCTCTTCACCTGGCAGGTGTATCATCCATCCTTGGGGCTATTAATTTTATTACTACCATTATCAACATAAAACCTCCTGCAATATCTCAATACCAAATTCCCCTATTCGTGTGATCCGTACTGATCACAGCAGTACTCCTACTGCTATCACTACCAGTCCTAGCAGCTGGCATTACTATACTACTTACAGATCGAAATCTAAATACAACATTCTTCGATCCTGCTGGAGGAGGTGACCCTATTCTGTATCAACATCTATTTTGATTCTTTGGACACCCTGAAGTTTACATTCTAATCCTTCCAGGATTCGGAATGATTTCACATATCGTTACCTATTATTCAGGGAAAAAAGAACCTTTTGGTTATATAGGAATAGTCTGAGCAATAATATCTATCGGCTTCTTAGGCTTCATCGTATGAGCCCACCATATATTCACTGTAGGAATAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lobodon carcinophaga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Southwell, C. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to its widespread occurrence and very large population size, the Crabeater Seal should remain classified as Least Concern.

IUCN Evaluation of the Crabeater Seal, Lobodon carcinophaga
Prepared by the Pinniped Specialist Group



A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Age-structure data for crabeater seals are limited, so the generation time cannot be calculated precisely. Sexual maturity is thought to be attained at 2.5-4 years of age and a maximum longevity possibly up to 25-30 years, the average age of reproducing individuals should be at least 10 years. A population reduction of crabeater seals has not been observed, estimated, inferred, or suspected in the past 30 years. However, population abundance is not precisely known and has not been closely monitored.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of crabeater seals has not been observed, estimated, inferred, or suspected in the past 30 years.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of crabeater seals could occur some time in the future if sea ice habitats decline due to continued climate warming. However, while sea ice extent presently appears to be declining in western Antarctica, it may be increasing in eastern Antarctica, and overall there appears to be no change yet in the extent of Southern Ocean sea ice.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Crabeater Seals has not been observed, estimated, inferred, or suspected in the past 30 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Crabeater Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Crabeater Seals is > 2,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current abundance of Crabeater Seals is certainly > 10,000.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The current abundance of Crabeater Seals is certainly > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Crabeater Seals.

Listing recommendationPast and recent estimates of Crabeater Seal abundance indicate a total population size of several million within their circumpolar distribution. There is no indication of a declining trend in the population, although broad-scale estimates have considerable uncertainty around them, and consequently trend estimates are also uncertain. Crabeater Seals depend on sea ice for reproduction and could be adversely affected by a reduction in sea ice due to continued climate warming at some time in the future. However, presently there appears to be no consistent circumpolar trend in Southern Ocean sea ice habitat. The Crabeater Seal is a widespread and abundant species that does not qualify for any of the threatened categories in the near future, Crabeater Seals should be listed as Least Concern.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The crabeater seal is the most numerous species of pinniped in the world, with a population estimated at between 15 and 40 million. Since its habitat is remote, the only concerns for conservation are indirect. Trace amounts of chemicals such as DDT have been found in populations of the crabeater seal, and if the fishing industry decides to use the krill in the Antarctic seas, the major food source of these seals may be severly depleted (Kooyman 1981). Now, however, its numbers appear to be stable.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The crabeater seal is a widespread species and, and as is the case for other Antarctic seals inhabiting the pack ice, population assessments are very difficult and expensive to conduct and therefore infrequently undertaken. Published global population estimates range from 2 million (Scheffer 1958) up to 50-75 million animals (Erickson et al. 1971). However, early estimates were based on very limited sampling and were highly speculative. The most recent global estimate, from analysis of ship and aerial sighting surveys carried out around the continent between 1968 and 1983, provided a point estimate for global crabeater seal population size in the pelagic pack ice of the Southern Ocean of 7,000,000 animals (Erickson and Hanson 1990). But, the authors acknowledged this estimate was negatively biased due to inadequate correction for haulout and suggested a more reasonable estimate was likely to be in the order of 11-12 million. This estimate is likely to have considerable uncertainty associated with it. A recent regional survey in East Antarctica between 64-150°E indicated a 95% confidence interval of 700,000-1,400,000 around a point estimate of 950,000 animals (Southwell et al. in press). Given this uncertainty, only large changes in crabeater seal population size could be confidently detected from repeated surveys.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Crabeater seals are considered to be the most abundant seal species and one of the most numerous large mammals on earth.

A mass die-off was reported from an area near a base on the Antarctic Peninsula in 1955. About 3,000 animals were trapped in areas 5-25 km from open water and most died over a two to three month period. None of the animals examined appeared to be starving, and numerous abortions of foetuses were noted. A disease outbreak was suspected, but never identified. In the 1980s a study revealed antibodies to canine distemper virus (CDV) in crabeater seals from this area. Leopard seals have also tested positive for antibodies to CDV. Weddell seals have been tested, but thus far there has not been a positive result. Ross seals have not been tested. Outbreaks of a similar distemper virus in the North Atlantic led to mass die-offs of harbour seals in the 1980s (Bengtson and Boveng 1991).

Several brief episodes of commercial harvesting of crabeaters ended when they were determined to be economically unsuccessful. Commercial harvest of krill may pose a threat to crabeater seals, if it ever becomes established at a large scale. There are currently no direct threats from human activity throughout most of the species’ normal range (Bengtson 2002).

The effects of global climate change on Antarctic seals are unknown. However, Learmonth et al. (2006) suggest that crabeater seal numbers may decline with increasing temperatures if Antarctic sea ice is significantly reduced. Loss of sufficient areas of pack ice habitat used for pupping, resting, avoidance of predators (possible) and access to preferred foraging areas because of changes from warming could lead to population declines of crabeater seals. The effects of loss of large amounts of ice on the Antarctic continent, general climate warming, or sea level rise on Antarctic ocean circulation and productivity and on Antarctic marine resources such as seals are unknown.

Seasonal tourism in the Antarctic and sub-Antarctic has increased steadily in the last 30 plus years, and is currently at all-time high levels. The effects of increased vessel noise, disturbance from vessels passage, and close approach by people in small boats and on land on crabeater seal behaviour, distribution, and foraging are unknown. There is a small risk of injury to animals from collision with boats or crushing from large vessel passage through ice fields.

There are no reports on significant fisheries interactions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The crabeater seal is not listed as endangered or threatened. Crabeater seals are protected by the Antarctic Treaty and the Convention for the Conservation of Antarctic Seals and any future commercial harvest would have to be regulated through these international agreements (Reijnders et al. 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Commercial fisheries have expressed interest in exploiting Antarctica's krill resources. As this is the primary food of the crabeater seal, there are bound to be negative consequences associated with the crabeater seal in this budding industry (Nowak 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Since crabeater seals occupy a habitat that is fairly inaccessible to humans, there has been very little contact between the two species. There is a report, however, that a young crabeater seal found on the coast of South Africa was easily tamed and trained (Klages and Cockcroft 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Crabeater seal

The crabeater seal (Lobodon carcinophaga or carcinophagus) is a true seal with a circumpolar distribution around the coast of Antarctica. They are medium- to large-sized (over 2 m in length), relatively slender and pale-colored, found primarily on the free-floating pack ice that extends seasonally out from the Antarctic coast, which they use as a platform for resting, mating, social aggregation and accessing their prey. They are by far the most abundant seal species in the world. While population estimates are uncertain, there are at least 7 million and possibly as many as 75 million individuals.[2] This success of this species is due to its specialized predation on the abundant Antarctic krill of the Southern Ocean, for which it has uniquely adapted, sieve-like tooth structure. Indeed, its scientific name, translated as "lobe-toothed (lobodon) crab eater (carcinophagus)", refers specifically to the finely lobed teeth adapted to filtering their small crustacean prey.[3] As well as being an important krill predator, the crabeater seal is an important component of the diet of leopard seals (Hydrurga leptonyx), which consume about 80% of all crabeater pups.

Contents

Taxonomy and evolution

The crabeater seal shares a common recent ancestor with the other Antarctic seals, which are together known as the lobodontine seals. These include the Ross seal (Ommatophoca rossii), leopard seal (H. leptonyx) and Weddell seal (Leptonychotes weddelli).[4] These species, collectively belonging to the Lobodontini tribe of seals, share teeth adaptations including lobes and cusps useful for straining smaller prey items out of the water column. The ancestral Lobodontini likely diverged from their sister clade, the Mirounga (elephant seals) in the late Miocene to early Pliocene, when they migrated southward and diversified rapidly in relative isolation around Antarctica.[4]

Distribution and population

Crabeater seals have a continuous circumpolar distribution surrounding Antarctica, with only occasional sightings or strandings in the extreme southern coasts of South America, Africa, Australia and New Zealand.[3] They spend the entire year on the pack ice zone as it advances and retreats seasonally, primarily staying within the continental shelf area in waters less than 600 m deep.[5] They colonized Antarctica during the late Miocene or early Pliocene (15-25 million years ago), at a time when the region was much warmer than today. The population is connected and fairly well mixed (panmictic), and genetic evidence does not suggest any subspecies separations.[6]

Currently, no reliable estimates of the total crabeater seal population are available. Past estimates relied on minimal opportunistic sighting and much speculation, ranging from 2 million[7] to 50-75 million individuals.[8] The most recent point estimate is 7 million individuals,[9] but this, too, is considered a likely underestimate.[1] An international effort, the Antarctic Pack Ice Seal initiative, is currently underway to evaluate systematically collected survey data and obtain reliable estimates of all Antarctic seal abundances.[3]

Fossil leopard seals are known from the Pleistocene of South Africa.[10]

Physical description

Adult seals (over five years old) grow to an average length of 230 cm (7.6 ft) and an average weight of around 200 kg (440 lbs). Females are on average 6 cm (2.5 in) longer and around 8 kg heavier than males, though their weights fluctuate substantially according to season; females can lose up to 50% of their body weight during lactation, and males lose a significant proportion of weight as they attend to their mating partners and fight off rivals.[11] Large crabeater seals can weigh up to 300 kg (660 lb).[12] Pups are about 120 cm in length and 20 and 30 kg at birth. While nursing, pups grow at a rate of about 4.2 kg a day, and can weigh as much as 100 kg by the time they are weaned after only two to three weeks.[13]

Pups are born with a light brown, downy pelage (lanugo), until the first molt at weaning. Younger animals are marked by net-like, chocolate brown markings and flecks on the shoulders, sides and flanks, shading into the predominantly dark hind and fore flippers[14] and head, often due to scarring from leopard seals. After molting, their fur is a darker brown fading to blonde on their bellies. The fur lightens throughout the year, becoming completely blonde in summer. Older animals become progressively paler, even when freshly molted, and may appear almost white.[3]

Crabeaters have relatively slender bodies and long skulls and snouts compared to other phocids. Perhaps their most distinctive adaptation is the unique dentition that enables this species to sieve Antarctic krill. The postcanine teeth are finely divided with multiple cusps. Together with the tight fit of the upper and lower jaw, a bony protuberance near the back of the mouth completes a near-perfect sieve within which krill are trapped.[3]

Behavior

Crabeater seals have an atypical, serpentine gait when on ice or land, combining retractions of the foreflippers with undulations of the lumbar region.[2] This method of locomotion leaves a distinctive sinuous body track and can be extremely effective. When not subject to overheating (i.e. on cold days), speeds on land of 19–26 km/h (12-16 mph) have been recorded for short distances.[2] Satellite tracking data have resulted in conservative estimates of swimming speeds of 66 km/day and 12.7 km/h. While swimming, crabeaters have been known to engage in porpoising (leaping entirely out of the water) and spyhopping (raising the body vertically out of the water for visual inspection) behaviors.[2]

The most gregarious of the Antarctic seals, crabeaters have been observed on the ice in aggregations of up to 1,000 hauled out animals and in swimming groups of several hundred individuals, breathing and diving almost synchronously. These aggregations consist primarily of younger animals. Adults are more typically encountered alone or in small groups of up to three on the ice or in the water.[3]

Crabeater seals give birth during the Antarctic spring from September to December.[15] Rather than aggregate in reproductive rookeries, females haul out on ice to give birth singly. Adult males attend female-pup pairs until the female begins estrus one to two weeks after the pup is weaned before mating. Copulation has not been observed directly and presumably occurs in water. Pups are weaned in about three weeks,[16] at which time they are also beginning to molt into a subadult coat similar to the adult pelage.[2]

Curiously, crabeater seals have been known to wander further inland than any other pinniped. Carcasses have been found over 100 km from the water and over 1000 m above sea level, where they can be mummified in the dry, cold air and conserved for centuries.[17]

Ecology

Diet

Schematic of the skull, illustrating the unique krill-filtering cusps

Despite its name, the crabeater seal does not feed on crabs, which are not found in its Antarctic habitat. Rather, it is a specialist predator on Antarctic krill (Euphausia superba), which comprise over 90% of the diet.[2] Their high abundance is a testament to the extreme success of Antarctic krill, the single species with the greatest biomass on the planet.[18] There is little seasonality in their prey preference, but they may target adult and male krill.[2] Other prey items include cephalopods and diverse Antarctic fish species.[2] Although the crabeater seal is sympatric with the other Antarctic seal species (Weddell, Ross and leopard seals), the specialization on krill minimizes interspecific food competition. Among krill-feeding whales, only blue whales (Balaenoptera musculus) and minke whales (B. acutorostrata) extend their range as far south as the pack ice where the crabeater seals are most frequent.[2]

While no reliable historical population estimates have been done, population models suggest crabeater seal populations may have increased at rates up to 9% a year in the 20th century, due to the removal of large baleen whales (especially the blue whale) during the period of industrial whaling and the subsequent explosion in krill biomass and removal of important competitive forces.[19]

Predation

Crabeater seals experience significant predation by leopard seals. Indeed, first-year mortality is exceedingly high, possibly reaching 80%, and up to 78% of crabeaters that survive through their first year have injuries and scars from leopard seal attacks.[1] Long scars and sets of parallel scars, visible on the otherwise pale and relatively unmarked pelage of crabeaters, are present on nearly all young seals. The incidence of visible scars falls off significantly after the first year, suggesting leopard seals primarily target the young of the year.[20] The high predation pressure has clear impacts on the demography and life history of crabeater seals, and has likely had an important role in shaping social behaviors, including aggregation of subadults.[2]

Predation by killer whales (Orcinus orca) is poorly documented, though all ages are hunted.[21] While most predation occurs in the water, coordinated attacks by groups of killer whales creating a wave to wash the hauled-out seal off floating ice have been observed.[22]

Gallery

See also

Other Antarctic seal species include:

References

  1. ^ a b c Southwell, C. (2008). Lobodon carcinophaga. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 January 2009.
  2. ^ a b c d e f g h i j Adam, P.J. (2005) Lobodon carcinophaga Mammalian Species No. 772, pp. 1–14
  3. ^ a b c d e f Bengtson, J. A. (2002). Crabeater seal Lobodon carcinophaga. In: W. F. Perrin, B. Wursig, and J. G. M. Thiewissen. (eds), Encyclopedia of marine mammals, pp. 302-304. Academic Press, London, UK.
  4. ^ a b Fyler, C.A.; Reeder, T.W.; Berta, A.; Antonelis, G.; Aguilar, A.; Androukaki (2005), "Historical biogeography and phylogeny of monachine seals (Pinnipedia: Phocidae) based on mitochondrial and nuclear DNA data", Journal of Biogeography 32: 1267–1279 
  5. ^ Burns, J., Costa, D., Fedak, M., Hindell, M., Bradshaw, C., Gales, N., McDonald, B., Trumble, S. & Crocker, D. (2004). Winter habitat use and foraging behavior of crabeater seals along the Western Antarctic Peninsula. Deep Sea Research Part II: Topical Studies in Oceanography 51 (17-19), 2279-2303.
  6. ^ Davis C, Stirling I, Strobeck C (2000) Genetic diversity of Antarctic pack ice seals in relation to life history characteristics. In: Antarctic Ecosystems: Models for Wider Ecological Understanding (eds Davison W, Howard-Williams C, Broady P), pp. 56-62. The Caxton Press, Christchurch, New Zealand.
  7. ^ Scheffer, V. B. (1958). Seals, sea lions and walruses: A review of the Pinnipedia. Stanford University Press, Stanford, USA.
  8. ^ Erickson, A. W., Siniff, D. B., Cline, D. R. and Hofman, R. J. (1971). Distributional ecology of Antarctic seals. In: G. Deacon (ed.), Symposium on Antarctic Ice and Water Masses, pp. 55-76. Sci. Comm. Antarct Res., Cambridge, UK.
  9. ^ Erickson, A. W. and Hanson, M. B. (1990). Continental estimates and population trends of antarctic ice seals. In: K. R. Kerry and G. Hempel (eds), Antarctic Ecosystems. Ecological change and conservation, pp. 253-264. Springer-Verlag, Heidelberg, Germany.
  10. ^ Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  11. ^ Laws, R., Baird, A. & Bryden, M. (2003). Size and growth of the crabeater seal Lobodon carcinophagus (Mammalia: Carnivora). Journal of Zoology 259 (01), 103-108.
  12. ^ [1] (2011).
  13. ^ Shaughnessy, P. & Kerry, K. (2006). Crabeater seals Lobodon carcinophagus during the breeding season: observations on five groups near Enderby Land, Antarctica. Marine Mammal Science 5 (1), 68-77.
  14. ^ Peter Saundry. 2010. [2]. eds. C.Michael Hogan and Cutler Cleveland Encyclopedia of Earth. National Council for Science and the Environment. Washington DC
  15. ^ Southwell, C., Kerry, K., Ensor, P., Woehler, E. J. and Rogers, T. (2003). The timing of pupping by pack-ice seals in East Antarctica. Polar Biology 26: 648-652.
  16. ^ Southwell, C., Paxton C. G. M., Borchers, D., Boveng, P. and de la Mare, W. (2008). Taking account of dependent species in management of the Southern Ocean krill fishery: estimating crabeater seal abundance off east Antarctica. Journal of Applied Ecology 45: doi:10.1111/j.1365-2664.2007.01399.x.
  17. ^ Stirling, I. and Kooyman, G.L. (1971). The crabeater seal (Lobodon carcinophagus) in McMurdo Sound, Antarctica, and the origin of the mummified seals. Journal of Mammalogy. 52, 175-180.
  18. ^ Nicol, S., Endo, Y. (1997). Fisheries Technical Paper 367: Krill Fisheries of the World. FAO. 
  19. ^ Mori, M. & Butterworth, D. (2006). A first step towards modelling the krill-predator dynamics of the Antarctic ecosystem. CCAMLR Science 13, 217-277.
  20. ^ Siniff, D.B. and Bengston, J.L. (1977). Observations and hypotheses concerning the interactions about crabeater seals, leopard seals and killer whales. Journal of Mammalogy. 58,414-416.
  21. ^ Siniff, D. B. (1991). An overview of the ecology of Antarctic seals. American Zoologist 31:143–149.
  22. ^ Smith, T. G., D. B. Siniff, R. Reichle and S. Stone. (1981). Coordinated behavior of killer whales (Orcinus orca) hunting a crabeater seal, Lobodon carcinophagus. Canadian Journal of Zoology 59:1185–1189.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!