Overview

Brief Summary

Biology

A year in the life of the Baikal seal is heavily driven by the unique habitat in which it is found (1). During winter, when the lake is largely covered with ice, seals can be found throughout the lake, particularly in the deep water in the centre (1), utilizing holes in the ice to breathe (2). The Baikal seal uses its strong foreclaws, as well as its head, teeth and rear flippers, to keep these vital access holes open (2). Although the Baikal seal is a largely solitary animal, several individuals may share access holes, and at certain times of the year, large groups may gather in areas of favourable habitat, such as around April, when the ice begins to break up and the seals start to congregate at new openings in the ice to feed (2). The month of May marks the peak of the breeding season. Male Baikal seals are believed to be polygynous, meaning that they mate with more than one female (2). Mating is thought to take place underwater, and it is suspected that there is delayed implantation (2). In late winter and early spring, following a gestation period of nine months (2), pregnant females move onto the ice, where they build an ice den in which the pup is born (1). The home range of each female on the ice, which incorporates the den and breathing holes, does not overlap with other females (1). Baikal seals typically give birth to just one pup, although twins, whilst uncommon, are more frequent than in other pinnipeds (2). The newborn seals, camouflaged on the ice with their white, woolly coats, do not enter the water until two or three weeks old (1). At six weeks of age, the pup's white coat begins to be replaced with the darker, adult fur, and they are fed milk by their mother until up until 2.5 months. Male Baikal seals become sexually mature at seven years of age, while females reach sexual maturity about a year earlier (2). They can continue to reproduce until 43 to 45 years of age (1), and with a maximum recorded life span of 56 years (2), this species may have the greatest longevity of any pinniped (1). As the ice breaks up further in May and June, the Baikal seal undergoes its annual molt (1) (2), while summer sees the seals concentrating in the southeastern part of the lake, where they haul themselves onto the shore and rocky islands between feeding trips (1). The Baikal seal feeds primarily on fish species which have no commercial value to humans (2), and juvenile seals may also consume amphipods (1). It feeds mainly at twilight and during the night, diving down to typical depths of 10 to 50 metres for 2 to 4 minutes to hunt its prey (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The Baikal seal is remarkable for being the only pinniped that is restricted solely to a freshwater habitat (2). Like other pinniped species, it may look rather ungainly on land, but in water it transforms into a remarkably graceful and agile animal. This is aided by its torpedo-shaped, flexible body (3), and powerful hindquarters which move side-to-side to propel the seal through the water (4). Its long, broad, webbed feet act as efficient flippers, while the smaller forelimbs are used to steer (4). The dense fur of adult Baikal seals is dark silvery-grey on the upperparts, blending into lighter yellowish-grey on the underside (2) (5), while pups are born with long, white hair (6). Under the seal's fur and skin is a thick layer of blubber, which not only provides vital insulation in its icy habitat, but also aids buoyancy, protects the internal organs, and acts as an energy store (3). Other adaptations for its primarily underwater life include large eyes which enable good vision in deepwater, and ear passages and nostrils that can be closed underwater (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Baikal Seals are basically confined to Lake Baikal (31,570 sq. km), though they do travel short distances into rivers that flow into and out of the lake. An exception is one animal that was found 400 km downstream in the Angara River, the only river that flows out of the lake (Ivanov 1938, Pastukhov 1993, Rice 1998). Lake Baikal is located in southern Siberia, Russia, near the Mongolian border. The lake is 636 km long and at its maximum 79.5 km wide (Kutyrev et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Baikal seals are endemic to Lake Baikal in Siberia and are found only this lake and connecting rivers.

Biogeographic Regions: palearctic (Native )

  • Nowak, R. 1991. Walker's Mammals of the World: Fifth Edition Volume 2. Baltimore, Maryland: The John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Baikal seal is confined almost entirely to Lake Baikal in Russia, the deepest lake in the world. Occasionally, this seal may also be seen in the rivers that flow into and out of this expansive lake (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Baikal seals are one of the smallest seals. Adults grow to a length of about 1.3 m. The adult coat is dark, with a silvery gray back and lighter yellowish gray front. Some individuals also have a spotted coat, but these are rare. Their fur is dense. Males are slightly larger than females. Baikal seals have stronger and larger forelimbs than many other species of seals. The head is rounded and the body spindle-shaped. The dental formula is 2/3 1/1 5/5 = 34.

Range mass: 50 to 130 kg.

Average length: 1.3 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species arrived in Lake Baikal approximately 400,000 years ago and is probably more closely related to the ringed seal than the Caspian seal (Pastukhov 1969a, Koyama et al. 1997, Sasaki et al. 2003). Baikal Seals are among the smallest of the pinnipeds, with adults reaching 1.1-1.4 m and weights of 50-130 kg. Pups are born at 3-3.5 kg and approximately 70 cm (Pastukhov 1971, Thomas et al. 1982). Adult males are slightly larger than adult females of the same age at physical maturity, when growth stops. Final body size is reached at approximately 15 years of age(Amano et al. 2000). Males reach sexual maturity at 7-10 years of age (Pastukhov 1993). Female Baikal seals become sexually mature between 3-7 years of age and some have their first pup by age 4, most by 5-6 years, with some not pupping until they are 9 years old (Pastukhov 1969b, Thomas et al. 1982). Baikal Seals continue to produce pups until they are 43-45 years old and may have the greatest longevity of any pinniped species. Approximately 10% of the population is older than 20 years of age, with records of adult females reaching 56 years of age and adult males 52 years of age (Pastukhov 1993, 1990).

The annual cycle of the Baikal Seal is driven more by ice than food (Ivanov 1938). In mid-October, the seals begin to move towards bays, lagoons and river deltas, mostly along the eastern shore where ice forms and expands out into the lake. They spend January to May spread throughout the lake, usually singly, in deep water in the central basins. Adults stay primarily in the north while immature seals are more often found in the southern part of Lake Baikal. Pups are born from late February to early April, with peak numbers born in mid March (Pastukhov 1990). Pups are born on the ice in dens which females actively build and maintain. During the pupping season, females are widely spread out on the ice. Their surface home ranges, including the den and breathing holes, are a minimum of 0.26 km² and do not overlap with other females (Ivanov 1938, Elagin et al. 1990, Pastukhov 1993, Martinkova et al. 2001). Pups do not usually enter the water for their first 2 -3 weeks.

Most pups are weaned in 2-2.5 months, although some are believed to be nursed for 3-3.5 months (Pastukhov 1971). Females move pups and construct new dens if the dens become damaged; this may be necessary to protect small pups from predators. Mating is believed to take place in April, approximately one month after the female gives birth (Pastukhov 1993). Although births take place throughout the lake, more pups (51%) are born in the northern one third of the lake, as compared to the central third (31%) or the southern third (17%) (Pastukhov 1971, Thomas et al. 1982, Petrov 1997).

The ice breaks up in May and June, a time when Baikal Seals undergo their annual moult. More than half of the population moves to the remaining ice in the northern and northeastern parts of Lake Baikal, forming aggregations that can be as large as 1,000-3,000 animals. Moulting takes approximately during a month-long period, during which Baikal Seals feed very little (Pastukhov 1993). Many Baikal Seals congregate in the southeastern part of the lake in the ice-free season to haul-out on rocky islands and shorelines between feeding excursions (Ivanov 1938, Pastukhov 1993, Petrov 1997). The eastern side of the lake is preferred because it has less human disturbance and greater biological productivity (Pastukhov 1993). It is not known whether Baikal Seals have a regular annual migration pattern. Satellite-tagging of four juvenile seals revealed that they moved throughout the lake in the course of a year, traveling from 400 to 1,600 km between September through May. Although it may not be typical of adult seals, the pattern of frequent diving and movement demonstrates that juveniles move considerable distances and spend little time hauled-out during the fall and winter months. Two of the four seals tagged in autumn returned to their tagging sites the following spring after wandering widely throughout the lake (Stewart et al. 1996). Diving patterns are not well documented; tagged juvenile Baikal Seals dove mostly to between 10-50 m, with some dives exceeding 300 m. the mean depth in Lake Baikal is 758 m (Kutyrev et al. 2006). Dive depths were shallower at night, consistent with the vertical movements of their preferred prey fish, the two species of golomyankas (Comeophorus spp.) which ascend from depths of 100 m or more during the day to forage at 10-25 m at night. Dive durations were generally 2-4 minutes, with 14-30% of dives lasting 6-10 minutes. The longest recorded dives exceeded 40 minutes and occurred during the winter in areas of heavy ice cover (Stewart et al. 1996). Baikal Seals feed on fish and 29 species have been recorded in their diet. Along with the two species of golomyankas mentioned above, they also consume two species of sculpin (Cottocomephorus spp.) as primary prey. Diversity of fish species consumed is highest in the summer with 17 species eaten, declining to eight species in fall, and only four principle species eaten in winter. Juveniles may also consume amphipods during winter (Ivanov 1938, Pastikhov 1967, Gurova and Pastukhov 1974, Thomas et al. 1982).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Pusa sibirica is the only seal that lives primarily in freshwater. It is endemic to Lake Baikal, and occasionally is found in rivers connecting to the lake. Ice conditions in the lake determine the seasonal movements and activities of these seals. In winter the lake is covered by ice that is 80 to 90 cm thick.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Baikal seal is found only in freshwater, and is the only seal with this trait (2). Lake Baikal is a unique habitat, holding the record of being not only the deepest lake in the world, but also the oldest and the largest in volume (7). During the winter, the lake is almost completely covered with ice, measuring 80 to 90 centimetres thick (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Baikal seals eat mainly fish in the pelagic genera Comephorus and Cottocomephorus. They also eat non-commercially valuable fish, such as golomyanka. These fish move to depths of 20 to 180 meters at night. Baikal seals will also eat invertebrates found in the lake. Most foraging for food occurs at twilight and night. Young seals have been observed feeding up to 100 m in depth. They have also been observed doing some short duration dives, most of which last under 10 minutes. Maximum diving time is estimated to be around 20 to 25 minutes, although some seals that are frightened can stay under 2 to 3 times longer.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 56 years (captivity) Observations: Including a period of delayed implantation, the total gestation lasts just over 9 months (Ronald Nowak 2003). Females breed until they are about 30 years old. One wild specimen was estimated to be 56 years old based on teeth annuli (Thomas et al. 1982). Little is known about their longevity in captivity, but one specimen was still alive at 23.1 years of age (Richard Weigl 2005)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Baikal seals have a polygynous mating system.

Mating System: polygynous

Mating takes place in the water at around the time the last pup is weaned, usually in May. Females experience a short period of delayed implantation. Gestation lasts for about nine months and the pups are born on lake ice from mid-February to March. Usually only one pup is born, but twins are not uncommon. If there are twins, both of them usually survive to weaning and then stay together for some time. At birth, pups weigh around 3 to 4 kg and measure from 65 to 70 cm in length. They are covered with a long, white, woolly coat that lasts for the first 6 weeks and then is shed and replaced by an adult coat.

Females tend to reach sexual maturity at 3 to 6 years of age and males at 4 to 7 years of age. Females can breed until they are about 30 years of age. About 88% of sexually mature females have pups each year.

Breeding interval: Baikal seals breed at most once per year.

Breeding season: Breeding occurs in the spring, after pups are weaned. Usually mid-April to early June.

Range number of offspring: 1 to 2.

Average gestation period: 9 months.

Range weaning age: 2 to 2.5 months.

Range time to independence: 2 to 2.5 months.

Range age at sexual or reproductive maturity (female): 3 to 6 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Mothers nurse their pups for 2 to 2.5 months, except in the southern part of the lake where the ice breaks up earlier. Pups in the south are weaned prematurely and, as a result, are smaller.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phoca sibirica

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0700-06|NC_008432|Phoca sibirica| AATCGATGGTTATTTTCTACAAATCATAAGGATATTGGCACTCTTTATCTGCTGTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTT---AGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTTGTAATAATTTTCTTCATGGTAATGCCTATCATAATTGGCGGCTTTGGGAACTGACTAGTACCCCTAATA---ATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTCTTACCACCATCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGGACCGGGTGAACCGTTTATCCTCCCCTAGCTGGGAACCTGGCTCATGCAGGGGCATCTGTAGATCTA---ACGATTTTCTCCCTCCACTTGGCAGGTGTGTCATCTATTCTTGGGGCTATCAACTTCATCACCACCATCATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTGTGATCCGTATTAATCACGGCAGTGCTCCTACTATTGTCGCTACCAGTCCTAGCAGCT---GGCATCACCATGCTACTCACAGACCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCTATCCTGTATCAACATCTATTCTGATTCTTCGGACATCCCGAAGTATATATTCTAATCCTACCAGGATTCGGAATAATCTCACACATTGTTACCTACTATTCAGGGAAAAAA---GAACCTTTTGGTTATATAGGGATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCACATATTCACTGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phoca sibirica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Burkanov, V. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
The current population size of the Baikal Seal is thought to be at the level of the Lake Baikal ecosystem capacity (80,000 – 100,000 individuals). If global warming continues the quality of habitat of the species will decline dramatically which may induce population decline. However, this species has survived periods of quite extreme warming in the region in the past and it is currently well monitored – such that declines should be detected rapidly when they occur. Thus, currently the Baikal Seal should be listed as Least Concern.

IUCN Evaluation of the Baikal Seal, Pusa sibirica
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Population abundance estimates based on direct pup counts at the end of breeding season and analysis of age and sex structure obtained from harvest suggest that at present the population is fluctuating at carrying capacity level for the Lake Baikal ecosystem. No reduction in abundance has been observed during last 30 years. Females mature at approximately age 3+, males at age 7+. Maximum longevity recorded is 56 years. Females produce pups throughout their life. Population abundance estimates conducted quite regularly over last 30 years.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A decline in abundance for Baikal Seal has not been observed, estimated, inferred, or suspected in the past 30 years. Distemper virus killed about 6,500 Baikal seals in 1987-1988, but total abundance of the species did not change noticeably.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A population reduction of Baikal Seal is possible in the future due to heavy pollutant burdens and illegal harvesting. Nevertheless, based on current conditions these two threats are unlikely to significantly impact the population in near future. It is unlikely to be occurred during next 30 years if these two threats will be at current level or lower. A population reduction for this species is suspected in the future due to global warming. It is likely that within next 30-40 years ice conditions in the lake will change dramatically and the Baikal Seal could be reduced in number by more than 30% which makes the species Vulnerable under this criterion (A3c).

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

A population reduction of Baikal Seals has not been observed, estimated, inferred, or suspected in the past 50 years.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Baikal Seal is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Baikal Seal is > 2,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The abundance of Baikal seal is > 10,000.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The number of mature individuals of Baikal seal is > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There is no any analysis conducted on probability of extinction Baikal Seal. Based on current status of the species it is unlikely that in can occurs within next 100 years.

Listing recommendationThe current population size of the Baikal Seal is thought to be at the level of the Lake Baikal ecosystem capacity (80,000 – 100,000 individuals). If global warming continues the quality of habitat of the species will decline dramatically which may induce population decline. However, this species has survived periods of quite extreme warming in the region in the past and it is currently well monitored – such that declines should be detected rapidly when they occur. Thus, currently the Baikal Seal should be listed as Least Concern.

History
  • 1996
    Lower Risk/near threatened
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Hunters can legally take Baikal seals. However, populations of these seals are still on the decline. Human disturbance and destruction of habitat are some major causes of this decline. Pollution from the paper industry is another cause. In 1987-1988 about 5,000 Baikal seals died from an infection caused by a form of Canine Distemper Virus. It is thought this virus was transmitted from dogs or other land mammals.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population increased from the 1970s through to the early 1990s to over 100,000 individuals (Petrov et al. 1997, Petrov 2002, 2003). Subsequently, population abundance declined slightly, probably due to commercial harvesting and the occurrence of canine distemper virus. The current abundance is estimated to be between 80,000 and 100,000 individuals (Petrov 2002, 2003) but this estimate may be biased based on survey errors of about 30% (Petrov et al. 1997) and short term abundance trends based on count data may merely reflect survey error variations. Baikal Seals are considered to be at the carrying capacity level of the Baikal Lake ecosystem.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Subsistence hunting of Baikal Seal extends back to at least the Neolithic period (Khlobystin 1963, Weber et al. 1993). Commercial hunting began in the second half of the 18th century (Ivanov 1938, Pastukhov 1993), becoming a regular industry in the early in the 20th century. Annual harvests fluctuated between 2,000 and 9,000 seals in the early 20th century, then from under 1,000 to nearly 6,500 in the 1930s (Ivanov 1938). Harvests from 1977 to 1983 were consistently high. The official harvest quotas and catch level was about 6,000 plus an estimated “unofficial hunting” level of up to 3,600 seals (1984, Pastukhov 1993). In the late 1980s and early 1990s the official statistics were not reliable and did not reflect the actual harvest level. Estimates vary between 4,000 and 8,000 animals (Petrov et al. 1997) killed annually. Harvesting continues today. During 2004-2006 about 2,000 seals were reported killed in annual official statistics with estimations of an additional “uncounted” harvest of between 1,500 and 4,000 animals annually (Petrov 2007). The “uncounted” harvest includes wounded or drowned animals, incidental catch in fishing gear and poaching.

Baikal Seals are considered to be heavily contaminated with pollutants. Heavy organochlorine loads may make them vulnerable to its toxic effects (Nakata et al. 1997), such as possible suppression of the immune system (Tsydenova et al. 2003). Recent work shows that levels of some key organochlorines in Baikal Seals fell from 1992-2002. However, Baikal seal pups continue to carry higher DDT and PCB contaminant burdens than pups of other European and Arctic phocid species (Tsydenova et al. 2004). Adult Baikal seals are also known to carry high burdens of toxic PCB congeners. Chronic high levels of toxic PCB congeners at concentrations similar to those found in Baikal Seals have been linked to immunosuppression in harbor seals and may have contributed to the outbreak of morbillivirus epidemic that led to the mass mortality event in Europe in 1988. Extensive use and disposal of PCBs in the Baikal watershed is thought to be responsible for the current high levels of PCBs in Baikal seals (Nakata et al. 1997). Recent opening of Siberian oil fields and the completion of the Baikal-Amur railroad have spurred additional industrial development near Lake Baikal, posing unknown risks to the Baikal seal (Reijnders et al. 1993, Grachev 2002). An outbreak of a phocine distemper virus, a type of morbillivirus closely related to canine distemper virus (de Swart et al. 1995), killed approximately 6,500 Baikal Seals in 1987-1988 (Pronin and Kabanov 1992, Belykov et al. 1997). The virus in Baikal Seals differs from the strain of phocine distemper virus that killed Harbour Seals in European waters in 1988 and is believed to have been transmitted to seals from a terrestrial source, probably feral or domestic dogs (Barrett et al. 1992). Recent examination of Baikal Seals shows that the virus is still circulating in the population, although not as a highly infectious agent at this time (Mamaev et al. 1996). Natural predation does not appear to be a significant source of mortality for Baikal Seals, with only Brown Bears (Ursus arctos) mentioned as predators (Pastukhov 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

For a very long time, the Baikal seal has been the target of subsistence hunters, but it was not until the second half of the 18th century that it became the subject of a commercial hunt for pelts, oil and meat (1) (2), with excessive hunting, particularly in the 1930s, seriously reducing its numbers (2). Today, harvesting of the Baikal seal continues, although at levels that are not believed to threaten the survival of the species (1). Other potential impacts on the Baikal seal arise from pollution of the lake (1). Unfortunately, this 'pearl of Siberia' is adversely affected by factories and towns, situated on its shores, which taint the lake with sewage and industrial waste, and the use of fertilisers and pesticides on surrounding agricultural land (7). Baikal seals are considered to be heavily contaminated with pollutants, possibly at levels which may make them susceptible to their toxic effects (1). The recent opening of nearby oil fields and the Baikal-Amur railway line have further stimulated the development of industry near Lake Baikal, which may have unknown detrimental impacts on the lake habitat, and therefore the seal (1). Outbreaks of disease are another potential threat to this species; an outbreak of the phocine distemper virus killed an estimated 6,500 seals in 1987 and 1988, and the virus continues to circulate in the population (1). Finally, if the trend of global warming continues, the quality of the Baikal seal's habitat will deteriorate, possibly inducing a population decline (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Numerous measures, such as establishing commercial harvest quotas, changing methods and equipment used for harvesting seals and changing the timing of the hunt and the age class of seal that can be taken, have all been used during the history of the commercial harvest to regulate the catch (Svatosh 1923, 1925, Ivanov 1938, Pastukhov 1993, Petrov et al. 1997). Recent recommendations for the protection and conservation of the Baikal seal include several measures to reduce the impact of poaching by local residents (including increased penalties for illegal hunting) and mandatory reporting of incidental catch in fishing gear (Pastukhov 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Over the years, several measures have been implemented to regulate hunting of the Baikal seal. These include quotas, specifying the times of the year at which the seal can be hunted, and restricting the age of seal that can be taken (1). As the Baikal seal is currently a well-monitored species, any population declines that do occur should be detected, allowing appropriate conservation measures to be promptly implemented (1). Lake Baikal itself is a Natural World Heritage Site (8), and parts of the lake and its basin are designated Nature Reserves and National Parks (9). Many local laws and regulations are in place to protect the lake, but an integrated management plan and comprehensive monitoring of this biologically diverse lake is still needed (9). Environmental non-governmental organisations, such as Greenpeace, campaign to protect this incredibly important source of freshwater. Greenpeace is currently focusing its efforts on Baikalsk Pulp and Paper Mill, which is located on the shore of the lake and discharges chlorine, used in the paper bleaching process, directly into the lake (10). Any successes at reducing pollution of the lake will undoubtedly help safeguard the future of the unique Baikal seal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Baikal seals eat fish that are important to fishermen in Lake Baikal. Fish of the genus Comephorus make up a large part of their diet. These fish are commercially important and, as a result, these seals do some harm to the fishing industry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Baikal seals are often taken by hunters. About 2,000 to 3,000 pups are killed each year for their skins. Adult seals are also killed for their meat, pelt, and oil.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Baikal seal

The Baikal seal, Lake Baikal seal, or nerpa (Pusa sibirica, obsolete: Phoca sibirica), is a species of earless seal endemic to Lake Baikal in Siberia. Like the Caspian seal, it is related to the Arctic ringed seal. The Baikal Seal is the smallest of the true seals, and with the exception of a subpopulation of inland harbour seals living in the Hudson Bay region of Quebec, Canada (lac de loups marins harbour seals), they are the only exclusively freshwater pinniped species.[2]

It remains a scientific mystery how the seals originally came to Lake Baikal, hundreds of kilometers from any ocean. Some scientists speculate the seals arrived at Lake Baikal when a sea-passage linked the lake with the Arctic Ocean (see also West Siberian Glacial Lake and West Siberian Plain).

The total population is estimated to be over 60,000 animals, and hunting of the seals, once widespread, is now restricted.[citation needed]

The Baikal seal, Lake Baikal seal, or nerpa (Pusa sibirica, obsolete: Phoca sibirica), is a species of earless seal endemic to Lake Baikal in Siberia. (This is a young seal) Norwegian: Baikalsel. Photo: Per Harald Olsen

Contents

Statistics

  • Weight: 70 kg (150 lb) average, 150 kg (330 lb) maximum
  • Length: 1.3 m (4 ft 3 in) average
  • Food: mainly golomyanka and goby
  • Litter: usually one pup, sometimes two
  • Diving time: usually 20–25 minutes (45–60 minutes maximum)
A Baikal Seal costume at the nerpa festival in Irkutsk, Baikal region, Russia

Description

The Baikal seal is one of the smallest true seals. The adult grows to be around 1.3 m (4 ft 3 in) in length with a body mass from 63 to 70 kg (140 to 150 lb).[3] The animals show very little sexual dimorphism; the males are only slightly larger than the females.[3] They have a uniform, steely-grey coat on their backs and fur with a slightly more yellow tinge coating their abdomens. As the coat weathers, it becomes brownish.[4] When first born, pups are around 4.5 kg (9.9 lb) and have a coating of white, silky, natal fur. This fur is quickly shed and exchanged for a darker coat, much like that of the adult. Rare Baikal seals can be found with spotted coats.[3]

Distribution

The Baikal seal lives only in the waters of Lake Baikal.[5] It is something of a mystery how Baikal seals came to live there in the first place. It can be speculated they swam up rivers and streams or possibly Lake Baikal was linked to the ocean at one point as the result of a large body of water, such as the West Siberian Glacial Lake or West Siberian Plain, formed in a previous ice age. The seals are estimated to have inhabited Lake Baikal for some two million years. The Baikal seal, the Saimaa ringed seal (Pusa hispida saimensis), and the Ladoga seal (Pusa hispida ladogensis) are the only exclusively freshwater seals.

The areas of the lake in which the Baikal seals reside changes depending on the season, as well as some other environmental factors. Baikal seals are solitary animals for the majority of the year, sometimes living kilometers away from other Baikal seals. In general, there is a higher concentration of Baikal seals in the northern parts of the lake, because the longer winter keeps the ice frozen for longer, which is preferable for pupping.[4] However, in recent years, there have been migrations to the southern half of the lake, possibly to evade hunters.[3] In winter, when the lake is frozen over, seals maintain a few breathing holes over a given area and tend to remain nearby, not interfering with the food supplies of a nearby neighbour. When the ice begins to melt, the Baikal seals tend to keep to the shoreline.

Abundance and trends

As of 2007, the Baikal seal is listed as a “lower risk” species on conservation lists.[3] This means while they are not currently threatened or endangered, it is possible or even likely they will be in the near future. At last official count, by the Russian government in 1994, they numbered 104,000. In 2000, Greenpeace performed its own count and found an estimated 55,000 to 65,000 seals.[5] Excessive hunting, as well as less severe problems of poaching and pollution, may be reducing the population.

In the last century, the kill quota for hunting Baikal seals was raised several times, most notably after the fur industry boomed in the late 1970s and when official counts began indicating there were more Baikal seals than previously known.[4] The quota in 1999, 6,000, was lowered in 2000 to 3,500, which is still nearly 5% of the Baikal Seal population if the Greenpeace count is correct.[3] In addition, new techniques, such as netting breathing holes, and seal dens to catch pups have been introduced. In one area, 3,000 of 4,000 breathing holes had been netted, many probably illegally.[citation needed] One prime seal pelt will bring 1,000 rubles at market, more than a month’s salary.[5]

Lake Baikal has eight wildlife patrol officers, which amounts to one officer for roughly 2,500 square kilometers, making enforcement of regulations difficult. Even without poaching, hunting, even on a small quota, is a problem, because many of the seals that are shot or injured still escape, and die later. These do not fall under the kill quota and are tacked on after. It is unlikely poaching and hunting will slow considerably without government intervention.

The other problem at Lake Baikal is the introduction of pollutants into the ecosystem. Pesticides such as DDT and hexachlorocyclohexane, as well as industrial waste, mainly from the Baikalisk pulp and paper plant, have thought to have been the cause of several disease epidemics among the Baikal Seal. The chemicals are speculated to concentrate up the food chain, and weaken the Baikal seal's immune systems, making them susceptible to diseases such as canine distemper and the plague, which was the cause of a serious Baikal seal epidemic that resulted in the deaths of thousands of animals in 1997 and 1999.[3]

Reproduction

Female Baikal seals reach sexual maturity at 3–6 years of age, whereas males reach it around 4–7 years.[3] The males and females are not strongly sexually dimorphic. Baikal seals mate in the water towards the end of the pupping season. With a combination of delayed implantation and a nine-month gestation period, the Baikal seal’s overall pregnancy is around 11 months. Pregnant females are the only Baikal seals to haul out during the winter. The males tend to stay in the water, under the ice, all winter. Baikal seals usually give birth to one pup, but they are one of only two species of true seals with the ability to give birth to twins. The twins will often stick together for some time after being weaned. The females, after giving birth to their pups on the ice in late winter, will become immediately impregnated again, and will often be lactating while pregnant.

Baikal seals are slightly polygamous and slightly territorial, although not particularly defensive of this territory. Males will mate with around three females if given the chance. They then mark the female’s den with a strong, musky odor, which can be smelled by another male if he approaches. The female raises the pups on her own; she will dig them a fairly large den under the ice, up to 5 m (16 ft) in length, and more than 2 m (6 ft) wide. Pups as young as two days old will then further expand this den by digging a maze of tunnels around the den. Since the pup will avoid breaking the surface with these tunnels, this activity is thought to be mainly for exercise, to keep warm until they have built up an insulating layer of blubber.

The mother Baikal seal will feed her young for around 2.5 months, nearly twice as long as any other seal. During this time, the pups can increase their birth weight (around 4 kg {9 lb}) fivefold. After the pups are weaned, the mother will introduce them to solid food, bringing shrimp, fish, and other edibles into the den.

In spring, when the ice melts and the dens usually collapse, the pup is left to fend for itself. Growth continues until they are 20 to 25 years old.

Every year in the late winter and spring, both sexes will haul themselves out and begin to moult their coat of fur from the previous year, which will be replaced with a new one. While moulting, they do not eat and enter a lethargic state, during which time they often die of overheating, males especially, from lying on the ice too long in the sun.[4] During the spring and summer, groups as large as 500 can form on the ice floes and shores of Lake Baikal. Baikal seals can live to over 50 years old, exceptionally old for a seal, although they are presumed to be fertile only until they are around 40.[4]

Foraging

The Baikal seal’s main food source is the golomyanka, found only in Lake Baikal. Baikal seals eat more than half of the annual produced biomass of golomyanka, some 64,000 tons.[4] Baikal seals also eat some types of invertebrates,[4] and the occasional omul. They feed mainly at night, when the fish come within 100 m (330 ft) of the surface. They feed with 10-20 minute dives, although this is hardly the extent of their abilities. Baikal seals have two liters more blood than any other seal of their size and can stay underwater for up to 70 minutes if they are frightened or need to escape danger.

The Baikal seal is blamed for drops in omul numbers; however, this is not the case. The omul’s main competitor is the golomyanka and by eating tons of these fish a year, Baikal seals cut down on the omul’s competition for resources.[4]

Baikal seals do have one unusual foraging habit. In the early autumn, before the entire lake freezes, they migrate to bays and coves and hunt sculpin, a fish that lives in silty areas and as a result usually contains a lot of grit and silt in its stomach. This grit scours the seals' gastrointestinal tracts and gets rid of parasites.[4]

See also

Bibliography

References

  1. ^ Burkanov, V. (2008). Pusa sibirica. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 January 2009.
  2. ^ Randall R. Reeves, Brent S. Stewart, Phillip J. clapham, James A. Powell, "National Audubon Society Guide to the Marine Mammals of the World", Alfred A. Knopf publishing, New York, 2002
  3. ^ a b c d e f g h "Baikal Seal (Phoca Sibirica)". Seal Conservation Society. http://www.pinnipeds.org/species/baikal.htm. Retrieved 2007-09-27. 
  4. ^ a b c d e f g h i Pastukhov, Vladimir, D.. "The Face of Baikal - Nerpa". Baikal Web World. http://www.bww.irk.ru/baikalseals/baikalseals_01.html. Retrieved 2007-09-27. 
  5. ^ a b c Schofield, James (27 July 2001). "Lake Baikal’s Vanishing Nerpa Seal". The Moscow Times. http://www.themoscowtimes.com/stories/2001/07/27/106.html. Retrieved 2007-09-27. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!