Overview

Distribution

Pusa caspica, Caspian seals, are one of the most numerous and widespread of northern pinnipeds. They are only found in the world’s largest inland body of saltwater, the Caspian Sea, which is located in a small part of the Paleartic region, between the countries of Russia, Azerbaijan, Iran, Turkmenistan, and Kazakhastan. Caspian seals migrate to different parts of the Caspian Sea during different seasons, however they never leave the landlocked Caspian Sea. From May to September most Caspian seals live in the southern part of the Caspian Sea. In autumn, they migrate north to the ice sheets for the birth of their newborn pups and breeding season.

There are various ideas to explain how Caspian seals began inhabiting the Caspian Sea. One theory is that they are direct descendants of ringed seals (Pusa hispida). During the Quaternary period, when there were glacier ice sheets, ringed seals migrated south. When the ice retreated seals were left isolated in the Caspian Sea. Others argue that Caspian seals originally occupied an inland area of the Paratethys Sea during the Miocene and Pliocene epochs. Other researchers argue that ringed seals are derived from Caspian seals and eventually migrated north to the Arctic.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Caspian seals are confined to the Caspian Sea. They range throughout the sea with seasonal migration between the southern, middle and northern basins. Almost all breeding takes place on ice, which covers the shallow northern parts of the Caspian Sea in winter. Occasional observations of low numbers (tens) have been made at islets off Turkmenistan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

When Caspian seals are born, they have a coat called a lanugo, made up of long white to silver gray fur. The lanugo helps keep pups warm until they develop blubber. Newborn pups are between 64 to 79 cm in length and weigh about 5 kg when born. After 2 to 3 weeks, the lanugo begins to shed and is replaced by dark gray hair; this process takes 6 to 8 weeks. It's possible that, when pups are weaned at a younger age, they may become smaller adults.

Adult Caspian seals are one of the smallest pinnipeds in the “true seal” family (Phocidae). Adult Caspian seals vary in size and appearance. Males grow to 1.5 meters in length, which is slightly larger than females, who reach 1.4 meters. Both males and females have grayish-yellow to dark gray fur coats with a lighter underbelly. Males tend to be darker with dark spots over the entire body, whereas females are lighter in color with lighter spots on the back and not on the belly. The spots of Caspian seals can also be encircled by light colored rings. Both males and females have relatively short flippers with moderate sized claws on their fore flippers and shorter, narrower claws on their hind flippers. Adult Caspian seals have a dental formula of I 3/2, R 1/1, and PC 6/5.

The closest relatives of Caspian seals are ringed seals (Pusa hispida), the skulls of both are similar morphologically. However, unlike those of Caspian seals, the bodies of ringed seals are covered with light rings against a dark background. Both species are similar in size and have a relatively long narrow snout. These two species do not inhabit the same areas, being separated by 1600 km.

Range mass: 50 to 86 kg.

Average mass: 55 kg.

Range length: 1.4 to 1.8 m.

Average length: 1.45 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

  • 1984. Caspian Seal. Pp. 125 in D Macdonald, ed. The Encyclopedia of Mammals, Vol. 2, 2 Edition. New York: Equinox.Ltd.
  • 2002. "Science and Conservation of Ice loving Seals" (On-line). Caspian seal. Accessed March 10, 2006 at http://pagophilus.org/caspian.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Caspian seals live in the temperate region of the Caspian Sea on islands or fast ice sheets. This landlocked, saltwater sea is 100 ft (30.84 m) below sea level and at latitudes of 37 to 47 degrees north. Caspian seals can also be found in estuaries. The mouths of the Volga and Ural rivers are the most popular of these estuaries.

During winter months Caspian seals live in the north on ice caps. There, females give birth and nurse their young. A small portion of the population breeds farther south in the winter on islands such as Ogurchinsky, near the Turkmenistan coastline. These breeding areas tend to be in protected places like pressure ridges away from the wind and predators. Unlike their closest relatives, ringed seals (Pusa hispida), Caspian seals do not give birth in lairs (holes in snow drifts); this is said to maybe be an adaptation to ice that is not as stable as Arctic ice. During the spring and summer months, Caspian seals migrate south to live on sand banks or rocky areas, usually on islands and usually not on the main coastline. The southern part of the Caspian Sea has deeper water where seals may dive up to 50 meters.

Average elevation: -30.84 m.

Range depth: 50 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
During late spring, summer, and early autumn, Caspian seals are distributed throughout the Caspian Sea. They feed throughout the sea, exploiting both the shallow basin in the north and the deep middle and southern basins. After the ice melts, the seals use sandy islands and reefs as haulout sites, preferring the tips of peninsulas and sand bars in many areas, although large concentrations of seals in reed-bed areas of islands also occur. In late autumn the breeding adults gather in the northeast, hauling out on sandy islands and reefs in increasing numbers until sea ice begins to form (Krylov 1990). When the surface freezes over, females form aggregations on the ice to give birth to their pups, tending to gather along cracks in the ice giving them ready access to the water, although they also construct and maintain holes in the ice for water access (Heptner 1996, Härkönen et al. 2008).

Pups are generally born from mid-January to late February on the ice and nursed for 4-5 weeks. Females do not usually construct lairs (Frost and Lowry 1981), possibly because sufficient amounts of snow overlying the ice is normally lacking. Pupping on the ice has allowed direct counts of pups to be made in the recent aerial surveys (Härkönen et al. 2008). Pups do not enter the water until the ice melts in mid to late March.

The first documented observations of small numbers of seals breeding in other parts of the Caspian were made in 1982, with females reported pupping on small sand islands in the southern part of the Caspian Sea, although it is likely this behaviour was not new (Krylov 1990).

Large numbers of mostly nonbreeding seals spend the winter in the middle and southern Caspian, with one estimate of 15,000 seals along the Turkmenistan coast (Krylov 1990). A post-breeding moult occurs from April to May, during which the seals first use the ice and then islands and reefs for hauling out (Krylov 1990).

Both sexes become sexually mature at around 6 years of age, with most breeding females (74% in a 1974 sample) aged between 8 and 17 years (Popov 1982). The pregnancy rate for females older than 9 is reported to be as low as 0.2-0.33 (Watanabe et al. 1999, Miyazaki 2002), and Krylov (1990) reports a similar low rate of 0.34 for females aged 10-14 years. Härkönen et al. (2005), acknowledge that the reproductive rate is low in females >20 years old, but suggest that the reproductive rate is >0.5 for females <20 years old taken together as a group. Since females <20 make up approximately two thirds of the population of adult females, they probably drive the overall reproductive rate for the population up to about 0.5. Both Watanabe et al. (1999) and Härkönen et al. (2005) attribute the lower reproductive rates of older females to the effect of long term exposure to organochlorine contaminants in the older animals.

Caspian seals feed on a variety of fish species. During the summer and autumn, seals move to and congregate where prey are abundant, particularly Caspian kilka (Clupeonella sp.), Caspian silverside (Atherina mochon), and Caspian gobies (Gobidae) (Krylov 1990), with Clupeonella species historically making up a major proportion of their total annual diet (Kosarev and Yablonskaya 1994). A report on fish found in the stomachs of seals in the northern Caspian in 1986-1987 (Piletskii and Krylov 1990) suggested that fish eaten in order of frequency were roach (Rutilus rutilus), zander (Lucioperca lucioperca), gobies (Knipowitschia sp., Neogobius kessleri and Benthophilus sp.), and bream Blicca bjoerkna and Abramis brama), followed by Clupeonella deliculata and other species. A preliminary study from faecal samples on the Apsheron Peninsula in June 2001 and March 2002 suggested that gobies, silverside and shrimp were important constituents of the diet of seals hauled out at that time (Eybatov et al. 2002). New studies of diet in Caspian seals are urgently required in order to get an accurate picture of current prey in different areas of the Caspian in light of potential changes to the abundance of fish species due to recent ecological changes occurring in the Caspian Sea.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Caspian seals are primarily piscivorous. They eat a variety of foods depending on season and availability. Clupeonella (kilka) is the most abundant food source in the Caspian Sea, accounting for 70% of their diet. When Caspian seals inhabit shallow waters in the northern part of the sea (autumn and winter months), they prey mostly on sculpins, gobies, and crustaceans. While in the southern part of the Caspian Sea (deep waters), during the summer months, they eat herring, roach, carp, sprat, and smelt. When Caspian seals live in estuaries, they eat large amounts of the freshwater species Sander lucioperca. Other prey include shrimp, crab, silversides, and asp.

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Caspian seals are the only mammal found in the Caspian Sea, and they are near the top of the food chain. They eat many different types of fish and crustaceans. If seal populations decrease, the number of fish may increase. Seal population density may also affect the numbers of their two predators, wolves and eagles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Besides humans, the two other predators of Caspian seals are sea eagles and wolves. Sea eagles snatch up newborn pups soon after they are born, during lactation their mortality rate is around 22%. In the northern part of the Caspian Sea, wolves will kill seals lying out on islands.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little is known about communication in Caspian seals. They are solitary in winter months, in summer months they make aggressive snorts or use flipper waving to tell other seals to keep their distance.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In the wild, Caspian seals live to be on average about 35 years old; however, some have been recorded to live 50 years. Males have relatively short lives, around 26 years. Caspian seals are not usually found in captivity except for a few zoos in Russia. There is no evidence of their life span in captivity.

Range lifespan

Status: wild:
26 to 50 years.

Average lifespan

Status: wild:
35 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The gestation period probably includes several months of delayed implantation (Ronald Nowak 2003). In the wild, these animals have been estimated to live up to 50 years (David Macdonald 1985), which is possible but unconfirmed. Their longevity in captivity has not been studied in detail.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both male and female Caspian seals are monogamous. There seems to be no fighting for a mate among breeding seals.

Mating System: monogamous

In late autumn, Caspian seals migrate to the northern part of the Caspian Sea where the water is shallow and frozen. Caspian seals give birth in protected areas on ice sheets after a gestation period of about 11 months. There is no evidence to support this currently, but researchers believe that since there is a long gestation period, there is a delay in implantation of the egg.  Annual pregnancy rates are normally between 40 to 70 percent, but are currently at an all time low of 30 percent. This maybe due to pollution. In late January to early February, each female seal gives birth to one pup. Female pups become sexually mature after 5 to 7 years, male pups become sexually mature after 6 to 7 years. Newborn pups are not fully grown for 8 to 10 years after they are born. Breeding begins a few weeks after the birth of last years’ pup, in late February to mid March. Breeding occurs after weaning of newborn pups but can begin while pups are still nursing. After the breeding season and molting in late April, the weather in the north starts to warm and the ice begins to melt. Caspian seals then migrate back to the southern part of the Caspian Sea. The southern part has deeper, colder waters where seals spend the summer months.

Breeding interval: Caspian seals breed once a year.

Breeding season: Breeding occurs from late February to March.

Range number of offspring: 1 to 1.

Range gestation period: 10 to 11 months.

Range weaning age: 1 to 1 months.

Range age at sexual or reproductive maturity (female): 5 to 7 years.

Range age at sexual or reproductive maturity (male): 6 to 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation ; post-partum estrous

There is no available information about the parental care of Caspian seals, except that newborn pups are weaned after 4 to 5 weeks of lactation. Given that Caspian seals are asocial there may be no collaboration with other seals in raising newborn pups. In their closest relatives, ringed seals, as well as other seal species, males leave females soon after mating and do not help raise the newborn pups. Females will leave newborn pups to forage for short periods of time.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Ridgway, S., R. Harrison. 1981. Handbook of Marine Mammals. San Diego: Academic Press Limited.
  • Reeves, R., B. Stewart, P. Clapham, J. Powell. 2002. Guide to Marine Mammals of the World. New York: Chanticlear Press.
  • Nowak, R. 1964. Walkers Mammals of the World. London: John Hopkins University Press.
  • 1990. Phoca caspica. Pp. 220-238 in B Grimeks, ed. Grimeks Encyclopedia of Mammals, Vol. 5, 2 Edition. New Jersey: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pusa caspica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AATCGATGGTTATTTTCCACAAATCATAAGGATATTGGCACTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATGGTAGGCACCGCCCTT---AGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTTGTAATAATTTTCTTCATAGTAATGCCCATCATAATTGGCGGCTTTGGGAACTGACTAGTGCCCCTAATA---ATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTCTTACCACCATCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGGACCGGATGGACCGTTTATCCTCCCCTAGCTGGGAACCTGGCTCATGCAGGGGCATCTGTAGATCTA---ACGATTTTCTCCCTCCATTTGGCAGGTGTATCATCTATTCTTGGGGCTATCAACTTCATCACCACCATTATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTGTGATCCGTATTAATCACGGCAGTGCTCCTGCTATTGTCACTACCAGTCCTAGCAGCT---GGCATCACCATGTTACTTACAGACCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCTATCCTGTATCAACATCTATTCTGATTCTTCGGACATCCCGAAGTGTATATTCTAATCCTACCAGGATTCGGAATAATCTCACACATTGTCACCTACTATTCAGGGAAAAAA---GAACCTTTTGGTTATATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCATATATTCACTGTAGGGATGGACGTCGACACACGAGCATACTTCACTTCAGCCACTATAATTATTGCAATTCCGACAGGAGTTAAAGTATTCAGCTGACTA---GCTACCCTTCATGGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pusa caspica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phoca caspica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGGTTATTTTCCACAAATCATAAGGATATTGGCACTCTTTATTTGCTGTTTGGCGCATGAGCTGGAATGGTAGGCACCGCCCTTAGTCTCTTAATCCGCGCAGAACTAGGACAACCTGGCGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATTGTCACCGCCCATGCATTTGTAATAATTTTCTTCATAGTAATGCCCATCATAATTGGGGGCTTTGGGAACTGACTAGTGCCCCTAATAATTGGAGCTCCTGATATAGCATTCCCCCGAATAAACAACATAAGTTTCTGACTCTTACCACCATCCTTCCTACTACTACTGGCCTCCTCTATAGTAGAAGCAGGTGCCGGGACCGGGTGAACCGTTTATCCTCCCCTAGCTGGGAACCTGGCTCATGCAGGGGCATCTGTAGATCTAACGATTTTCTCCCTCCATTTGGCAGGTGTATCATCTATTCTTGGGGCTATCAACTTCATCACCACCATTATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTGTTCGTGTGATCCGTATTAATCACGGCAGTGCTCCTGCTATTGTCACTACCAGTCCTAGCAGCTGGCATCACCATGTTACTTACAGACCGAAACCTGAATACAACATTCTTCGACCCTGCCGGAGGAGGTGATCCTATCCTGTATCAACATCTATTCTGATTCTTCGGGCATCCCGAAGTGTATATTCTAATCCTACCAGGATTCGGAATAATCTCACACATTGTCACCTACTATTCAGGGAAAAAAGAACCTTTTGGTTATATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTCCTGGGCTTCATTGTATGAGCCCACCATATATTCACTGTAGGGATGGACGTCGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phoca caspica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

According to International Union for the Conservation of Nature (IUCN) Red list of Threatened Animals, Caspian seals are identified as vulnerable. This is for several reasons: loss of food by commercial fishing, toxic pollution, habitat destruction, human disturbance, disease, and commercial exploitation. In addition to a few regulations limiting the amount of Caspian seals caught each year, adult females are also protected during the breeding season.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2abd+3bd+4abd

Version
3.1

Year Assessed
2008

Assessor/s
Härkönen, T. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Contributor/s

Justification
Due to a decline exceeding 50% over the last three generations, reduction in the number of sites used (range reduction within the overall geographic range), current hunting levels that almost certainly exceed sustainable harvest levels and the multiple ongoing negative impacts on the habitat of the Caspian Seal, this species should be classified as Endangered (EN).

IUCN Evaluation of the Caspian Seal, Phoca caspica
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Modelling based on hunting statistics and surveys (2005-2007) suggests a population decline exceeding 70% over the past three generations. Age-structure data are not directly available for the Caspian seal population, but the maximum longevity is about 50 years. Generation time was inferred by modeling at 16.3 years when measured as the mean age of females giving birth to a cohort, and at 17.1-18.0 when measured as time for increase of R0. Three generations would then be 49-54 years. The minimum number of reproducing females in 1955 was estimated to be 117,000. Current pup production was estimated to be 20,000 in 2005, 16,500 in 2006, and 5,700 in 2007. The decline in the size of the adult female reproducing population over the past three generations is therefore inferred to be in the range in excess of 70%. Current hunting quotas exceed the annual pup production in many years, seal mortality in fishing operations is commonplace, CDV has caused mass mortality, and Caspian Seals are suggested to have impaired reproduction as a consequence of environmental pollution. This species meets the criterion for Endangered, except that the decline has not ceased.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

The inferred and observed decline may not have ceased. Pup production is thought to be in sharp decline.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

A further population reduction of Caspian Seals is suspected in the future because of predicted reduction in sea ice habitats due to continued climate warming, hunting, by-catch in fisheries, disease and pollution. The likely amount of population reduction has not been projected, but could exceed 50% within the next 30 years. This meets the criterion for classification as Endangered.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under Al.

A population reduction of Caspian Seals exceeding 50% has been observed, estimated and inferred, over the past 30 years, and causes for this reduction have not ceased. This meets the criterion for Endangered.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR < 100 km²; EN < 5,000 km²; VU < 20,000 km²

The EOO of Caspian Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR < 10 km²; EN < 500 km²; VU < 2,000 km²

The AOO of Caspian Seals is > 2,000 km².

AND at least 2 of the following:
(a) Severely fragmented, OR number of locations: CR = 1; EN < 5; VU < 10
(b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR < 250; EN < 2,500; VU < 10,000

The current abundance of Caspian Seals is certainly > 10,000, but the number of reproducing females has fallen to less than 10,000.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR < 50; EN < 250; VU < 1,000
or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR < 50; EN < 250; VU < 1,000 AND/OR restricted area of occupancy typically: AOO < 20 km² or number of locations < 5

The number of mature individuals is certainly > 1,000. AOO is > 20 km² and the number of locations is > 5.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

There has been no quantitative analysis of the probability of extinction for Caspian Seals.

Listing recommendationPopulation size exceeded one million in the 1930s, when more than 100,000 seals (of all age classes) were killed annually. Numbers of reproducing females have decreased from about 117,000 to between 20,000 and 8,000 over the past three generations, which indicates a decline of more than 70%. Recent surveys suggest that this decline has not ceased, but is ongoing. The distribution of the Caspian Seal in a completely closed ecosystem, from which individuals cannot disperse, makes it vulnerable to some or all of the many threats it currently faces. Major pan-Caspian changes such as reduction in stocks of prey fish (due to over-fishing and the jelly-fish Mnemiopsis) and reduction in the seal’s breeding habitat (i.e., ice reductions due to climate change and possibly oil extraction operations) and loss/degradation of other habitat features threaten the species’ viability. Current and future large-scale mortalities due to hunting, fisheries operations and disease (such as CDV) will likely continue to drive the current population decline. Caspian Seals qualify for listing as Endangered under IUCN criteria A2abd+3bd+4abd.

History
  • 1996
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Historically, the population of Caspian seals was estimated to have exceeded one million (Krylov 1990, Härkönen et al. 2005). However, the most recent abundance estimate of the total population is in the region of 111,000 in 2005. This estimate was based on an estimate of pup production that year of about 21,000 pups (95% confidence intervals 19 329 to 22 797), derived from counts made during aerial transects across the winter ice conducted in late February 2005 (Härkönen et al. 2005, 2008).

The population decline throughout the 20th century has been reconstructed by a demographic model using hunting statistics (Härkönen et al. 2005). By the 1950s–1960s, the population was estimated from this model to have been reduced to between 400,000-500,000 seals (Härkönen et al. 2005), while an estimate based on a harvest of 86,000 pups in 1966, believed to be most pups born that year, also produced an estimate of 500,000 seals for that year (Badamsin 1969, cited by Krylov 1990). Aerial surveys conducted in 1976 and 1980 suggested an estimate of 450 000 animals (Krylov 1984, cited by Krylov 1990), although the hind-casting analysis suggests a population of only about 200,000 seals remaining at that time (Härkönen et al. 2005). Surveys in 1987 and 1989 resulted in an estimate of approximately 360,000-400,000 (Krylov 1990), but again the hind-casting analysis suggests this might again have been an over-estimate, with perhaps only about 148,000 seals remaining by the late 1980s. The hind-casting analysis suggests an ongoing population reduction averaging about 3-4% per year since 1960 and an 83% reduction in the size of the breeding female population since 1955 (approximately 3 generations, with one generation being 16.5-20 years , Härkönen et al. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Caspian seals have been commercially exploited on an intensive basis since the early 1800s. Harvests averaged 119,000-174,000 per year throughout the 19th century, with peaks of 300,000 having been recorded. In the 20th century, harvest levels peaked in the 1930s with an average annual harvest of 164,000 and a maximum single year take of 227,600. The numbers of seals taken fell during World War II to an average of 60,800 per year, and subsequently ranged between a low of 41,400 and a high of 108,300 for the period 1951-1975 (Krylov 1990). Commercial harvesting was temporarily halted in 1996 after a much-reduced estimated take of 14,000 seals. Commercial and scientific hunting in the region of 3,000-4,000 seals a year – mainly pups - has continued at least since 2004, and is currently ongoing. The hunting quota, set by the Caspian Bioresources Commission for 2007, was 18,000 seals which exceeded the estimated annual pup production for that year (Harkonen et al. 2008).

Significant population declines have been attributed to the high harvest levels (Härkönen et al. 2005). Another contributory cause to high pup mortality is natural predation by wolves (Canis lupus) and sea eagles (Haliaeetus spp.). Krylov (1990) estimated that wolves killed 17-40% of Caspian seal pups on “some breeding grounds from 1974 to 1976”, while eagles took less than 1% of pups. The reverse was found during a systematic survey by Harkonen et al. (2008). Few wolves were observed during this survey, but about 2,000 eagles were seen on the ice preying on pups in 2005-2006; they likely took approximately 10% of the annual estimated births of 20 000 pups.

By-catch of seals in fisheries and killing of seals by fishermen are threats that have not been adequately investigated, but are thought to be a significant source of mortality, particularly for juvenile seals (Härkönen et al. 2005). The Iranian commercial fishery is of conservation concern; it is likely responsible for the deaths of an estimated 500 seals annually (Eybatov et al. 2002). But, by-catch in legal and illegal fishing activity in the northern Caspian is likely to exceed this number substantially. This by-catch may amount to several thousand animals per year, with local fishermen in the Mangistau region of Kazakhstan citing catches exceeding 200 seals per 5 km of nets set (Goodman, Wilson and Dmitrieva unpublished data based on interviews November 2007).

Mass mortality events in 1997 and 2000-01, killing several thousand seals each time, have been attributed to a morbillivirus, canine distemper virus (CDV). Presence of a hitherto unknown strain of this virus was confirmed in one dead seal in 1997 (Forsyth et al. 1998), and the same strain was confirmed as the primary cause of death in seals dying in 2000 in Kazakhstan and Azerbaijan (Kennedy 2000, Kuiken 2006). The cause of a further mass mortality in 2001 was less clear (Eybatov et al. 2002). Examination of archive stranding records in Azerbaijan since 1971, show an increased mortality every few years, suggesting the possibility of previous outbreaks of CDV. A serology study of archived samples indicated that CDV was present in Caspian seals in 1993, 1997 and 1998 (Ohashi et al. 2001).

Degradation of the Caspian Sea ecosystem and overexploitation of primary food resources are also threats to Caspian seals (Reijnders 1993). An invasive of comb jellyfish, Mnemiopsis leidyi, arrived in the Caspian Sea via ship ballast water in the Volga-Don Canal in1999 (Ivanov et al. 1999). Mnemiopsis consumes zooplankton rapidly, leading indirectly to a reduction in fish stocks and a substantial impact on local fisheries. A 70% reduction in commercial landings of three species of Kilka (Clupeonella spp.) was recorded within 3 years of the comb jellyfish invasion (Kideys et al. 2005). Kilka are thought to be important prey for Caspian seals in the central and southern parts of the sea, and the invasion of Mnemiopsis is considered a threat to the seals (Ivanov 1999, Eybatov et al. 2002).

The Caspian Sea has no outlet and receives most of its input from the Volga, Ural and other rivers. Contamination of the Volga with lead, copper, zinc, and cadmium has increased dramatically since the mid-1980s, but levels in seals appear not be elevated, with the exception of zinc in some diseased animals, which may have suffered homeostatic disturbance of trace metal levels (Anan et al. 2002). Organochlorine levels in Caspian seals dying in the 2000-01 epizootic were high when compared to other marine mammal species suffering from epizootic disease outbreaks. The most significant organochlorine contaminant in Caspian seals was found to be DDT (Hall et al. 1998, Kajiwara et al. 2002). Environmental contaminants, particularly organochlorines, may affect the overall Caspian seal population health by causing decreased reproductive rates, particularly in older females (Krylov 1990, Eybatov et al. 2002, Härkönen et al. 2005). Decreased immune function has also been suggested as a contributory cause of the CDV epizootic in 2000 (Kajiwara et al. 2002), and the deaths in 2001, although scrutiny of organochlorine levels in seals dying in this outbreak did not provide supporting evidence for this (Kuiken et al. 2006, Eybatov et al. 2002).

Total juvenile mortality from continued hunting, natural predation and fisheries by-catch is believed to be unsustainable. Overall mortality in the first year of life from all sources is likely to be in the region of 50% (Härkönen et al. 2008). The high rate of juvenile mortality has been singled out as the primary reason for the continuing decline in the Caspian seal, with lowered fertility due to organochlorine contamination being a relatively minor factor (Härkönen et al. 2005).

It seems likely that warmer winters occurring in the near future may contribute to the further decline of Caspian seals if there is reduced ice cover in the northern Caspian. In 2007 the ice cover was limited to a narrow strip along the coastline of the north-east Caspian, and breeding was therefore concentrated along this strip of ice. The number of pups alive at the end of February, estimated from the aerial survey, was fewer than 7,000, i.e. fewer by half compared to the number counted in the previous two years (Härkönen et al. 2008). It has also been suggested that poor ice conditions may play a role in the epidemiology of CDV outbreaks due to seal crowding on limited haulout space and poor condition of weaned pups (Kuiken et al. 2006). However, there is no evidence for this at present.

Further threats to the seals on shore and on ice now come from increasing disturbance due to offshore and shoreline developments. One of the largest oil fields in the world is currently being developed in the Caspian, with the construction of numerous offshore oil drilling islands, pipelines, shipping access to these, and onshore logistics facilities. A recent study found that breeding seals are using shipping channels as artificial leads into the ice and are giving birth close to the edge of these channels. A significant proportion of the breeding population and pups may therefore experience disturbance by shipping traffic depending on the ice conditions (Härkönen et al. 2008). More research is required to quantify the likely impacts of this intensive oil development. The coasts of Azerbaijan and Iran have also seen increased development for domestic and leisure use in recent years, with many previously undisturbed stretches of coast now being developed.

Disturbance of island and reef haulout sites by illegal fishing activities and opportunistic seal hunting are another ongoing problem. Recent surveys have found that the Caspian seal has effectively disappeared from Azerbaijan, with the once important haulout sites of the Apsheron Peninsula and Archipelago abandoned. These sites were used by many thousands of seals until the 1930s, when they were heavily hunted (Krylov 1990). However, between 1997 and 2002 a few hundred seals were still counted regularly at these sites (e.g. Allchin et al.1997, S. Wilson, unpublished observations). Few live seals have been seen in this area since 2004 (T. Eybatov, S. Goodman, S. Wilson, unpublished observations). The overall Caspian seal population decline between 2002 and 2004 is unlikely to account for this total disappearance, which is most probably due in part to severe disturbance by illegal fishing and other coastal activities (T. Eybatov unpublished data). Similar declines in the regularity of seal occupancy have also been noted recently at other sites, such as South West Island near the Ural Delta and Osushnoy Island (Kazakhstan) and in Turkmenbashi Bay (Turkmenistan). The number of seals at Ogurchinsky Island (Turkmenistan) has also declined from several thousand in the 1980s to a few hundred (P. Erokhin, unpublished observations). The only previously recorded haulout site in Iran, at Ashoora Island, is no longer used by seals (H. Asadi, pers. com.). There is an urgent need to develop an inventory of all haulout sites throughout the Caspian together with archived and current records of seal occupancy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Various prohibitions, quotas and protective measures have been taken to conserve the Caspian seal beginning in 1940 when seal nets were prohibited. The harvest of moulting seals in the spring was ended in 1946, and in 1952 the Apsheron Archipelago off Azerbaijan was closed to sealing. Female harvesting on the breeding grounds was stopped in 1966 and all take was prohibited on the “eastern islands of the northern Caspian in 1967.” These last two changes led to a complete change in the commercial harvest in 1966 resulting in a switch to newborn and moulted pups. Quotas on harvest of pups, supposedly based on biological data, began in 1970 (Krylov 1990), although clearly these quotas were unsustainable. The Russian Federation continues to consider the Caspian seal to be a ‘harvested’ species and unsustainable quotas are continuing to be set through the Caspian Bioresources Commission (Härkönen et al. 2008), e.g. 18,000 pups in 2007.

A Seal Conservation Action and Management plan has been approved by the nations bordering the Caspian Sea, pursuant to the 2003 Framework Convention for the Protection of the Marine Environment of the Caspian Sea (see Harkonen et al. 2005; Caspian Environment Programme 2007), but this has as yet no legally binding action points. The cessation of all types of hunting, measures to reduce by-catch in legal and illegal fisheries, and the strategic creation of protected areas of sea, ice and shore would appear to be the only way forward in the conservation of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Caspian seals do not negatively affect humans. They may take some fish, but these are not typically fish that are economically important.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

For the past 200 years, humans living around the Caspian Sea have killed seals for their blubber and for the lanugo fur of newborn pups. Currently around 60,000 Caspian seal pups are caught annually for their fur. Some ecotourism is increasingly focusing on these animals, which involves taking ferries out to view them.

Hunting Caspian seals in the past has been intense. For example, between 1933 and 1940 an average of 160,000 seals were caught each year. In 1940, when the hunting of Caspian seals was first regulated, there was still an average of 50,000 to 60,000 caught each year. In 1970 restrictions were increased on the northern ice allowing only 20,000-25,000 pups to be killed. However, when the Soviet Union collapsed, these regulations were not enforced. In addition, the weak Soviet Union contributed to a large increase in illegal killing and poaching of Caspian seals.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Caspian seal

The Caspian seal (Pusa caspica) is one of the smallest members of the earless seal family and unique in that it is found exclusively in the brackish Caspian Sea. They are found not only along the shorelines, but on the many rocky islands and floating blocks of ice that dot the Caspian Sea. In winter, and cooler parts of the spring and autumn season, these marine mammals populate the Northern Caspian. As the ice melts in the warmer season, they can be found on the mouths of the Volga and Ural Rivers, as well as the southern latitudes of the Caspian where cooler waters can be found due to greater depth.

It is so-far unclear as to how these seals became isolated in the landlocked Caspian Sea. One of the most widely known hypotheses argues that the seals reached the Caspian during the Quaternary period from the north when continental ice sheets melted, and are descended from the ringed seal.

Description[edit]

Adults are approximately 126–129 cm in length. Males are longer than females at an early age, however females experience more rapid growth until they reach ten years of age. Males can grow gradually until they reach an age of about 30 or 40 years.[2] Adults weigh around 86 kilograms (190 lb); males are generally larger and bulkier. Their dental formula is I 3/2, R 1/1, PC 6/5.

The skull structure of the caspian seal suggests that it is closely related to the baikal seal. In addition, the morphological structures in both species suggest they are descended from the ringed seal which migrated from larger bodies of water around two million years ago.[3]

Caspian seals are shallow divers, with diving depths typically reaching 50 meters and lasting about a minute, although deeper and longer depths have been recorded, with at least one individual seen at depths in excess of 165m.[4] They are gregarious, spending most of their time in large colonies.

Caspian Seals can be found not only along the shorelines, but also on the many rocky islands and floating blocks of ice that dot the Caspian Sea. As the ice melts in the warmer season, they can be found on the mouths of the Volga and Ural Rivers, as well as the southern latitudes of the Caspian where cooler waters can be found due to greater depth.

In winter, and cooler parts of the spring and autumn season, these marine mammals populate the Northern Caspian. In the first days of April, spring migration to the southern part of the Caspian Sea begins with mature female seals and their pups, during this migration hungry seals eat the fish in the nets. Male mature seals stay in the northern Caspian Sea longer and wait until the moulting is completed. In summer, seals find empty places in the western part of Apsheron for resting. In the eastern part, the most crowded place used to be the Ogurchinskiy Island, but by 2001 there were fewer than 10 pups recorded on Ogurchinsky, some of which were killed by people on the island.

Diet[edit]

Caspian seals are primarily piscivorous. They eat a variety of food depending on season and availability. A typical diet for Caspian seals found in the northern Caspian sea consists of crustaceans and various fish species, such as Clupeonella engrauliformis, C. grimmi, C. delicate caspia, Gobiidae, Rutilus rutilus caspicus, Atherina mochon pontica, and Lucioperca lucioperca. Caspian seal adults eat about 2-3kg of fish a day and almost 1 metric ton of fish per year.[5]

In autumn and winter months, Caspian seals prey mostly on sculpins, gobies, and crustaceans while inhabiting shallow waters in the northern part of the sea. During the summer months, in the southern part of the Caspian Sea, they eat herring, roach, carp, sprat, and smelt. When Caspian seals live in estuaries, they eat large amounts of the freshwater species, Sander lucioperca. Other prey include shrimp, crab, and silversides.[6]

Being one of the top predators in the ecosystem, Caspian seals had hazardous chemicals found inside their bodies such as heavy metals, organochlorine compounds, and radionuclides.[7]

Behavior[edit]

Caspian seals are shallow divers, typically diving 50 meters for about one minute, although scientists have recorded Caspian seals diving deeper and for longer periods of time. After foraging during a dive, they rest at the surface of the water. [8]

In the summer and winter months, during mating season, Caspian seals tend to live in large groups. At other times of the year, these seals are solitary. During the summer months, however, they make aggressive snorts or use flipper waving to tell other seals to keep their distance. Little else is known about their behavior.[9]

Reproduction[edit]

Male and female Caspian seals are monogamous. Among breeding seals, there tends to be a lack of fighting for a mate. In late autumn, Caspian seals travel to the northern part of the Caspian Sea where the water is shallow and frozen to give birth in secluded areas on ice sheets after a gestation period of 11 months. Normally, pregnancy rates are between 40 to 70 percent but are currently at an all time low of 30 percent. In late January to early February, female seals give birth to one pup each. Similar to other ringed seals, these pups are born with white pelage and weigh about 5 kilograms. Their white coat is molted at around three weeks to a month. Male pups become sexually mature after six to seven years whereas female pups sexually mature after five to seven years. Newborn pups aren't fully grown until 8 to 10 years after they're born. [10] Breeding begins slightly a few weeks after the birth of last year’s pup around late February to mid March. Breeding usually occurs after weaning of a newborn pup but can begin while the pup is still nursing. Caspian seals migrate back to the southern part of the Caspian Sea after the breeding season and molting in late April because the north begins to warm with constant ice melting. The southern region of the Caspian Sea has deep, colder waters where the seals spend the summer months.[11]

Threats[edit]

Sea eagles are known to hunt these seals, which results in a high number of fatalities for the juveniles. They are also hunted by humans for subsistence and commerce. As of 2006, commercial icebreaker routes have passed through areas with high Caspian seal pup concentrations, which may contribute to loss of habitat.[12]

In a three-week period in February 1978, wolves were responsible for the wanton killing of numerous seals near Astrakhan. Between 17 and 40% of the seals in the area were estimated to have been killed, but not eaten.[13]

For threats related to migration, high density seal aggregations were recorded in November 2009 and 2010 CISS helicopter surveys in Kenderli Bay. But the integrity of seal habitat in Kenderli Bay is currently threatened by an imminent large- scale coastal resort development. This resort development can be a serious disturbance for seals. The local authorities have been advised about the need to preserve the seal habitats in the bay, but it is not yet clear what steps are planned to achieve this. According to the present study, Kosa Kenderli plays an important role for the seasonal migration of the Caspian seals and is recommended to be a protection area.

Due to increased industrial production in the area, pollution has had an effect on the survival of the caspian seal. From 1998 to 2000, the concentration of zinc and iron increased dramatically in the tissue of dead, diseased seals. This suggests that these elements are causative agents in compromising the Caspian seal's immune system.[14]

A century ago there were an estimated 1.5 million seals; in 2005, there were an estimated 104,000, with an ongoing decline of 3-4% per year.[15]

Canine Distemper Virus[edit]

There have been several recent cases of large numbers of Caspian seals dying due to canine distemper virus, in 1997, 2000, and 2001.[2] In April 2000, a mass die-off of Caspian seals was first reported near the mouth of the Ural River in Kazakhstan. It spread south to the Mangistau region, and by the end of May, more than 10,000 seals had died along the Kazakhstan coast. High death rates were also recorded in May and June along the Apsheron peninsula of Azerbaijan and the Turkmenistan coast.[16]

Clinical signs of infected seals included debilitation, muscle spasms, ocular and nasal exudation, and sneezing. Necropsies performed in June 2000 on eight Azerbaijan seals revealed microscopic lesions, including bronchointerstitial pneumonia, encephalitis, pancreatitis, and lymphocytic depletion in lymphoid tissues. Similar lesions were also discovered on four seals from Kazakhstan. Morbillivirus antigen was also detected in multiple tissues, including lung, lymph nodes, spleen, brain pancreas, liver, and epithelial tissue of the reproductive, urinary, and gastrointestinal tracts. Such tissue lesions are characteristic of distemper in both terrestrial and aquatic mammals.[16]

Tissues from 12 carcasses found in Kazakhstan, Azerbaijan, and Turkmenistan were examined for morbillivirus nucleic acid. Sequences from the examination showed that canine distemper virus, which is part of the genus Morbillivirus, was the primary cause of death. The sequences also proved that seals from widely separated regions of the Caspian Sea were infected by the same virus. This finding established that there are spatial and temporal links between the seal deaths in these regions. The sequences were also identical to that of canine distemper virus found in the brain tissue of a seal that died in 1997 and showed no morbillivirus lesions. This suggests persistence of canine distemper virus in the Caspian seal population over a span of several years or repeated spillover from the same terrestrial reservoir.[16]

Another study in 2000 using 18 Caspian seal corpses found several concurrent bacterial infections that could have contributed to the illness of the affected seals. These include Bordetella bronchiseptica, Streptococcus phocae, Salmonella dublin, and S. choleraesuis. Corynebacterium caspium, a new bacterium, was identified in one of the seals, and poxvirus, Atopobacter phocae, Eimeria- and Sarcocystis-like organisms, and Halarachne sp. were identified in Caspian seals for the first time. The study also asserts that the “unusually mild” winter that preceded the die-off in 2000 could have contributed to its cause “through increased ambient air pressure and accelerated disappearance of ice cover at the breeding areas in the northern Caspian Sea.”[17]

References[edit]

  1. ^ Härkönen, T. (2008). Pusa caspica. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009.
  2. ^ a b Wilson, Susan; Eybatov, Tariel; Amano, Masao; Jepson, Paul; Goodman, Simon (2 July 2014). "The Role of Canine Distemper Virus and Persistent Organic Pollutants in Mortality Patterns of Caspian Seals(Pusa caspica)". PLoS ONE 9 (7). 
  3. ^ Endo, H.; Sakata, S.; Arai, T.; Miyazaki, N. (April 2001). "The Muscles of Mastication in the Caspian Seal (Phoca caspica)". Anatomia, Histologia, Embryologia: Journal of Veterinary Medicine 31 (5): p262–265. 
  4. ^ [URL=http://s641.photobucket.com/user/1972rainman/media/Other/image_zps2a610382.jpg.html][IMG]http://i641.photobucket.com/albums/uu131/1972rainman/Other/image_zps2a610382.jpg[/IMG][/URL "Seal@ 167m."]. 
  5. ^ Khuraskin, L; Pochotoyeva, N (November 1997). "Status of the Caspian Seal Population". Caspian Environment Program: 86–94. 
  6. ^ Grimeks, B (1990). Grimeks Encyclopedia of Mammals (Second ed.). New Jersey: McGraw-Hill. pp. 220–238. 
  7. ^ Ikemoto, T; Kunito, T; Watanabe, I; Yasunaga, G; Baba, N; Miyazaki, N; Petrov, E. A.; Tanabe, S (2004). "Comparison of trace element accumulation in Baikal seals (Pusa sibirica), Caspian seals (Pusa caspica) and northern fur seals (Callorhinus ursinus)". Environmental Pollution 127 (1): 83–97. PMID 14553998. 
  8. ^ Reeves, R; Stewart, B; Clapham, P; Powell, J (2002). Guide to Marine Mammals of the World. New York: Chanticlear Press. 
  9. ^ Reeves, R; Stewart, B; Clapham, P; Powell, J (2002). Guide to Marine Mammals of the World. New York: Chanticlear Press. 
  10. ^ Easley-Appleyard, Bonnie (2006). "Pusa Caspica Caspian Seal". Animal Diversity Web. Retrieved 23 October 2014. 
  11. ^ Hogan, Michael C, ed. (22 July 2010). "Caspian Seal". The Encyclopedia of Earth. Retrieved 24 October 2014. 
  12. ^ Harkonen, Tero; Jüssi, Mart; Baimukanov, Mirgaly; Bignert, Anders; Dmitrieva, Lilia; Kasimbekov, Yesbol; Verevkin, Mikhail; Wilson, Susan; Goodman, Simon J. (Jul 2008). "Pup Production and Breeding Distribution of the Caspian Seal (Phoca caspica) in Relation to Human Impacts". AMBIO: A Journal of the Human Environment 37 (5): 356–361. 
  13. ^ Rumyantsev, V. D.; Khuraskin, L. S. (1978). "New data on the mortality of the Caspian seal due to wolves". In P. A. Panteleev et al.,. Page 187 in Congress of the All-Union Theriological Society, 2nd. ZR 116 (19). Moscow: Nauka. p. 5669. 
  14. ^ Anan, Y.; Kunito, T.; Ikemoto, T.; Kubota, R.; Watanabe, I.; Tanabe, S.; Miyazaki, N.; Petrov, E.A. (March 2002). "Elevated Concentrations of Trace Elements in Caspian Seals (Phoca caspica) Found Stranded During the Mass Mortality Events in 2000". Archives of Environmental Contamination and Toxicology. Volume 42 (Issue 3): 354–362. 
  15. ^ Dmitrieva, Lilia; Kondakov, Andrey; Oleynikov, Eugeny; Kydyrmanov, Aidyn; Karamendin, Kobey; Kasimbekov, Yesbol; Baimunkanov, Mirgaliy; Wilson, Susan; Goodman, Simon (26 June 2013). "Assessment of Caspian Seal By-Catch in an Illegal Fishery Using an Interview-Based Approach". PLoS ONE 8 (6): 1–6. 
  16. ^ a b c Kennedy, Seamus; Kuiken, Thijs; Jepson, Paul; Deaville, Robert; Forsyth, Morag; Barrett, Tom; van de Bilt, Marco; Osterhaus, Albert; Eybatov, Tariel; Callan, Duck; Kydyrmanov, Aidyn; Mitrofanov, Igor; Wilson, Susan (1 November 2000). "Mass Die-Off of Caspian Seals by Canine Distemper Virus". Emerging Infectious Diseases 6 (6): 637–639. PMID 11076723. 
  17. ^ Kuiken, T.; Kennedy, S.; Barrett, T.; Van de Bilt, M.W.G.; Borgsteede, F.H.; Brew, S.D.; Codd, G.A.; Duck, C.; Deaville, R.; Eybatov, T.; Forsyth, M.A.; Foster, G.; Jepson, P.D.; Kydyrmanov, A.; Mitrofanov, I.; Ward, C.J.; Wilson, S.; Osterhaus, A.D.M.E. (1 May 2006). "The 2000 Canine Distemper Epidemic in Caspian Seals (Phoca Caspica): Pathology and Analysis of Contributory Factors". Veterinary Pathology 43 (3): 321–338. PMID 16672579. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!