Articles on this page are available in 2 other languages: Spanish (2), Dutch (1) (learn more)

Overview

Brief Summary

Harp seals are closely related to harbour seals, however they do not live in the North Sea. A lost seal is only occasionally spotted along the Dutch coast. Males have a harp shaped spot on their back while females and young harp seals have a less obvious pattern of black or brown spots. Both sexes can grow to 1.70 meters long and weigh up to 130 kilograms. They live up to 30-35 years old. Harp seals are hunted in abundance in Norway and Canada.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The relationship between people and harp seals is slowly changing. For years, newborn pups were killed in large numbers for their gorgeous white coats. That still happens, but tourists are visiting some of the haul-out sites where the seals give birth, inhibiting the slaughter and also providing an economic reason not to kill the pups. Harp seal pups grow at an astonishing rate on the fat-rich milk produced by their mothers. From a birth weight of about 10 kg, they bulk up to 35 kg in 10 days. This gets them ready quickly for an 11 month, 5,000 km swim to the far corners of their Arctic range and back again. Large groups swim together, leaping, rolling, and porpoising. Adults have a dark, harp-shaped pattern on their fur.

Links:
Mammal Species of the World
  • Original description: Erxleben, J.C.P., 1777.  Systema regni animalis per classes, ordines, genera, species, varietas, cum synonymia et historia animalium Classis I. Mammalia, 1:588.  Weygandianis, Lipsiae, 636 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The harp seal Phoca groenlandica is member of the 'true seal' family. Like all true seals, it has a tapering and pointed muzzle, small, clawed pectoral flippers, and small hind flippers that cannot rotate under the body. Like similar species, it has beaded whiskers on the muzzle.The harp seal is a moderately plump seal, with a small, slightly pointed head and a moderately thick neck. It can reach 1.9 m in length. It has a short muzzle and moderately large eyes. It is most easily recognised by the its colour pattern. It has a silvery white body, with a black head and a broad swath of black on either side meeting at the shoulders. Some harp seals may occasionally be more of a sooty grey or with scattered black blotches.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Harp Seal: A migratory ice seal of the Atlantic-Arctic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Light gray,; Black face and black saddle behind shoulders
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Harp seals are widespread in the North Atlantic and the adjacent Arctic Ocean and shelf seas. Their range extends from northern Hudson Bay and the Foxe Basin, Baffin Island, and the Davis Strait, Gulf of St Lawrence and Newfoundland in the western North Atlantic, east to somewhat south of Greenland, continuing east to Iceland and from there to Northern Norway, the White Sea and the Barents and Kara Seas. The northern limit in the eastern North Atlantic is at least to Franz Joseph Land and Svalbard and may continue to between 82-85 degrees north depending on ice conditions (Lavigne and Kovacs 1988, Rice 1998, Lavigne 2002).

The southern limit of the distribution off North America shifts southeast in some years, such as occurred in the early 1990s (Lacoste and Stenson 2000), leading to increased occurrences of harp seals south of their usual limits, reaching the Gulf of Maine and Sable Island where large numbers have been record since the mid-1990s (Harris et al. 2002, Lucas and Daoust 2002). Harp seals often occur as vagrants outside this range, south to Virginia in the United States (Scheffer 1958, Rice 1998). Similarly in Europe, harp seals reach the United Kingdom (Ronald and Healy 1981), the Faroe Islands, Denmark, Germany, France, and even Spain (Bree 1997, Bloch et al. 2000).

Prehistorically, harps seals bred in the Baltic Sea. Genetic drift, interspecific completion and over-hunting by humans are all factors likely to have contributed to their extinction in this region (Stora and Ericson 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Harp seals are found in the Arctic and northern Atlantic Oceans. Their range extends east from around Baffin Island and Hudson Bay to Cape Chelyuskin in northern Russia. Pagophilus groenlandicus is native to Canada, Greenland, Iceland, Norway, Russia, Svalbard ,Jan Mayen, and the United States. Stray harp seals have been found in Denmark, the Faroe Islands, Finland, France, Germany, Spain, and the United Kingdom. Of the pinnipeds (walruses, seals, fur seals and sea lions) in the northern hemisphere, harp seals are the most abundant.

There are three main populations of harp seals, each of which has its own migratory route. The northwest Atlantic population, which breeds and molts in the Gulf of St. Lawrence, Labrador, and Newfoundland, travels to Hudson Bay, off the coast of Baffin Island, northwestern Greenland and northern Labrador to feed in early summer. The group that breeds in Jan Mayen spends its summers between Svalbard and Greenland. The population which breeds in the White Sea travels north to the Cara and Barents Seas for the summer. In September, all three of the groups begin to travel south again toward their breeding grounds. They will arrive in their respective breeding grounds in January or February. Some of the juvenile and non-breeding harp seals may remain in the northern feeding areas year round.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native ); atlantic ocean (Native )

Other Geographic Terms: holarctic

  • Novak, R. 1999. Pagophilus groenlandicus. Pp. 887-888 in Walker’s Mammals of the World, Vol. Volume II, Sixth Edition. Baltimore: The Johns Hopkins University Press.
  • 2004. Harp Seals. Pp. 429-430 in D Kleiman, V Geist, M McDade, eds. Grzimek’s Animal Life Encyclopedia, Vol. Volume 14: Mammals III, Second Edition. Farmington Hills, MI: Gale Group, Inc.
  • 2008. "Pagophilus groenlandicus" (On-line). OBIS Seamap. Accessed April 09, 2009 at http://seamap.env.duke.edu/species/tsn/622022.
  • MarineBio.org. 2009. "Pagophilus groenlandicus: Harp Seal" (On-line). MarineBio. Accessed April 05, 2009 at http://marinebio.org/species.asp?id=302.
  • Kovacs, K. 2008. "Pagophilus groenlandicus" (On-line). The IUCN Red List of Threatened Species. Accessed April 05, 2009 at http://www.iucnredlist.org/.
  • Schliemann, H. 1990. Pagophilus groenlandicus. Pp. 221-224 in S Parker, ed. Grzimek’s Encyclopedia of Mammals, Vol. Volume 4, First Edition. New York: McGraw-Hill, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Scotian Shelf to Northern Greenland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic Ocean, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Gulf of St. Lawrence, North Atlantic, North West Atlantic, St. Lawrence Estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Occurs in three distinct breeding populations (stocks) in North Atlantic: White Sea (East Ice) stock, Jan Mayen (West Ice) stock, and northwest Atlantic (Newfoundland) stock; breeders in Gulf of St. Lawrence are included in the Newfoundland stock, but possibly they comprise a separate stock. Adults of northwest Atlantic stock summer mainly in High Arctic and around Greenland, winter and breed off Labrador, Newfoundland, and in the Gulf of St. Lawrence; most immatures overwinter at the Front off southern Labrador, though some remain at high latitudes. Occurrences in the northern Gulf of Maine region increased greatly during the 1990s (McAlpine et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Harp seals boast a wide range of pelages through their development. Harp seal pups are born with a white coat of embryonic fur or lanugo, which gives them the name “whitecoats.” Some pups’ fur may be dyed yellow at birth by amniotic fluid, but it fades to white after a few days. About 21 to 22 days later, pups begin to lose their white fur in tufts, creating a “jagged coat.” The lanugo is replaced by a silver-white coat with irregular black spots, which the juvenile seal or “beater” retains for a year. After 12 to 14 months the blacks spots grow larger and the seal is called a “bedlamer.” The seal remains a bedlamer until it reaches sexual maturity. When the seal reaches sexual maturity (around 5.5 years old), the blacks spots converge into a “harp” shaped design, which is composed of two black lines that run up the dorsal side of the seal’s flanks, starting at their pelvis and curving and converging between the shoulders. Also, adult harp seals develop a black head and may have black markings where the hind flippers meet the body of the seal. Some harp seals retain their spotted pelage (“spotted harps”). Of the seals that retain their spots, some have dark gray streaks, creating a completely gray pelage (“sooty harps”). The harp-shaped design on the backs of adults, along with the black head and sliver-white fur, helps Pagophilus groenlandicus stand out from the other members of Phocidae that share its habitat.

Harp seals are sexually dimorphic in size and pelage. Male harp seals weigh an average of 135 kg and are 171 to 190 cm long. Females weigh an average of 120 kg and are 168 to 183 cm long. Besides being larger than females, male harp seals tend to have a more-defined “harp” pattern and black head than females.

Adult harp seals have fairly small hind flippers and the fore flippers are pointed with short digit tips that boast large claws. Their heads are flat and wide and they tend to have a fairly long, but tapered snout.

The dental formula of Pagophilus groenlandicus is 3/2 incisors, 1/1 canines, and 5/5 post-canines.

Range mass: 120 to 135 kg.

Average mass: 130 kg.

Range length: 1.5 to 2.0 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; male more colorful

  • Jefferson, T., S. Leatherwood, M. Webber. 1994. Marine Mammals of the World. Rome: United Nations Environment Program and Food and Agriculture Organization of the United Nations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 200 cm

Weight: 181000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Average: 1.8 m
Range: 1.7-1.9 m

Weight:
Average: 130 kg
Range: 115-140 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: adult is white with dark "harp" on back, dark face. Pup is white "whitecoat", moults to grey coat with dark spots "beaters" within three weeks. Immatures (14 months+) called "bedlamers".
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Harp seals are medium-sized, monomorphic phocids. Adult males and females are approximately 1.8 m long and weight about 130 kg. Age at sexual maturity has varied quite dramatically over the last century, in part as a consequence of population size which has been largely determined by harvest levels and food availability. Females reach sexual maturity between 4-8 years of age (Frie et al. 2003). Males probably do not participate in breeding before they are somewhat older, though they reach sexual maturity around the same time as females.

Birthing takes place in vast herds, which are quite highly synchronized. Birthing occurs from late February to April, with some variation across the range in the precise timing (Lavigne and Kovacs 1988). Pups are born on the open free-floating pack ice and nursed for 12 days, during which time they gain weight at about 2.2. kg per day (Kovacs and Lavigne 1985, Kovacs 1987, Kovacs et al. 1991, Lydersen and Kovacs 1996). To minimize energy expenditure, most pups are sedentary for the first month; some so immobile that they melt into the ice beneath them, forming ice “cradles” (Kovacs 1987). Pups are referred to as “whitecoats” because they are born with an insulating coat of white lanugo. Lactating females spend up to 85% of their time in the water, depending on the weather (Lydersen and Kovacs 1993). Towards the end of lactation, females come into estrus and mate (Lavigne and Kovacs 1988). Weaned pups remain on the ice for up to 6 weeks, losing up to 50% of their weight before entering the water to feed. During this post-weaning fast they complete moulting of the lanugo. After this coat is shed the black and silver-gray pelage is exposed and the juveniles are known as “beaters” until they are about a year old.

Gestation lasts about 11.5 months, including a 3-4 month period of delayed implantation (Stewart et al. 1989). The maximum life span of a harp seal is approximately 30 years; most animals that reach sexual maturity live to over 20 years. Both males and females are sexually active until the ends of their lives, showing no reproductive senescence (Ronald and Healey 1981).

Harp seals (1+ years of age) undergo a moult in the post-breeding months, from early April to early May (Lavigne and Kovacs 1988). Harp seals are highly migratory and after breeding, Canadian seals follow the pack ice up the coast of Labrador, with small numbers going into Hudson Bay, around Baffin Island, and the rest travelling up both sides of the Davis Strait. The Jan Mayen and White Sea groups migrate northward and mix in the Barents Sea (ref). The Jan Mayen group reaches the High Arctic, up to 85ºN. The Canadian seals have a round-trip migration that is over 5,000 km long (Lavigne and Kovacs 1988). The Northwest Atlantic group begins the return trip to their breeding grounds in late autumn.

Harp seals consume a wide range of prey that varies along the migration route. Throughout their range, the harp seal diet includes 67 species of fish and 70 species of invertebrates (Lavigne 2002). The pups and juveniles take a lot of invertebrate prey, especially euphausiids (Thyanoessa spp.) and amphipods (Parathemisto spp.) (Haug et al. 2000, Nilssen et al. 2001). Adults in Greenland eat pelagic crustaceans, and fish such as capelin (Mallotus villosus), sandeel (Ammodytes sp.), polar cod (Boreogadus saida) and Arctic cod (Arctogadus glacialis). Commercial species such as Atlantic cod (Gaddus morhua) appear to be of minor importance in the diet (Kapel 2000). In the Barents Sea, harp seals eat amphipods, prawns, and small fish including polar cod, sculpin (Cottidae), snail fish (Liparidae), capelin (Nilssen 1995); but show a clear preference for large polar cod (Wathne et al. 2000). The seals off Newfoundland eat capelin and Arctic cod, and off Labrador they eat Arctic cod and Atlantic herring (Clupea herringus). In the Gulf of St. Lawrence, the seals have been known to consume capelin, herring, Atlantic cod, Arctic cod and redfish (Sebastes) (Lawson et al. 1995). Harp seals feed heavily in winter and summer and less in spring and autumn. They are a highly social species that travels and forages in groups, yet maintain a stratification of diet according to age class and depth of the feeding dives.

Harp seals are relatively shallow divers. Jan Mayen animals stay close to the edge of the pack ice during the spring moult, usually dive to less than 100 m, but by July, satellite-tagged seals in the Barents Sea dove to 400 m. Overall, the deepest dives occur during the day in winter (Folkow et al. 2004).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Harp seals spend the majority of their time in coastal ocean waters near pack ice. Harp seals forage for food at depths of 150 to 200 m. When harp seals are on land, they prefer rough ice that is at least 0.25 meters thick. Harp seals brave open ocean waters when they migrate.

Range depth: 150 to 200 m.

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

mostly in pack ice
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 74 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.347 - 21.498
  Nitrate (umol/L): 0.748 - 7.369
  Salinity (PPS): 30.653 - 34.699
  Oxygen (ml/l): 5.180 - 8.283
  Phosphate (umol/l): 0.241 - 0.731
  Silicate (umol/l): 1.823 - 6.440

Graphical representation

Temperature range (°C): -0.347 - 21.498

Nitrate (umol/L): 0.748 - 7.369

Salinity (PPS): 30.653 - 34.699

Oxygen (ml/l): 5.180 - 8.283

Phosphate (umol/l): 0.241 - 0.731

Silicate (umol/l): 1.823 - 6.440
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Edge of the arctic pack ice and subarctic waters. Rests on sea ice. Pups are born on ice.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The harp seal inhabits cold waters close to the shore.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic and Atlantic-Arctic shelves; Associated with pack ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates up to thousands of kilometers between northern summer range and southern (winter/spring) breeding range. Early migrants reach Labrador and northern Newfound by December; migrate northward in spring and early summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Harp seals are primarily piscivores that eat up to 67 species of fish and 70 species of marine invertebrates. Fish and invertebrates consumed by harp seals varies with their location and the season. Some of the main fish that make up their diet are capelin, Arctic cod, and polar cod. Pups tend to mainly feed on small invertebrates.

Harp seals may dive to extreme depths to capture food. The average diving depth for harp seals is 150 to 200 m and the dives typically last 4 to 13 minutes.

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults eat mainly small pelagic marine fishes, also pelagic and benthic crustaceans and some bottom fishes. In summer at high latitudes, arctic cod and polar cod are important prey. Weaned young first feed in surface waters on small pelagic crustaceans and small fishes (e.g., capelin). May feed at depths of up to 150-200 m (Ronald and Healey 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic and polar cod along ice edge; Capelin, herring and krill
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Harp seals are piscivores and consume large amounts of fish and crustaceans in their environment. Harp seals are also food for many predators in the Arctic region.

Harp seals are carriers of the Phocine distemper virus (PDV). PDV does not have any affect on harp seals, but they may have passed the virus onto harbor seals, ignighting a huge epidemic in Europe in 1988.

Commensal/Parasitic Species:

  • Phocine distemper virus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The main predators of harp seals are polar bears, killer whales, Greenland sharks, and walruses. Humans also kill harp seals for food, fur, and oil.

Though harp seals tend not to be very vocal on land, females may make a shrill call if a predator comes near her pup.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Phoca groenlandica (harp seal) preys on:
zooplankton
caplin

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Phoca groenlandica (harp seal) is prey of:
Orcinus orca
Somniosus microcephalus

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: East Ice stock: 800,000 in the mid-1980s. West Ice stock: 300,000, with 60,000 pups born annually in the late 1980s. Newfoundland stock: close to 2 million or more, with more than 500,000 pups born annually in the mid-1980s (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Minimum mortality rate 1.1-1.4% during first 2-3 weeks of life in Gulf of St. Lawrence (Kovacs et al. 1985). Gregarious when molting (mostly in April).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The main form of long and short distance communication for Pagophilus groenlandicus is underwater calling. Research suggests that harp seals actually listen to individual calls and respond with a specific response, rather than making random sounds. By actually listening to calls, seals can avoid masking other seals' calls. Harp seals may use underwater calling to attract mates and to coordinate herds.

Besides underwater calling, harp seals may use clicks, trills, and other chirp-like sounds on land, especially to attract mates or to respond to a predator getting too close to a pup. Terrestrial communication is quite uncommon.

Harp seals have acute vision and hearing, which is incredibly strong underwater, but a very poor sense of smell.

Communication Channels: visual ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Intermittently active both day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Size at birth 0.85m (3 ft), 11kg (25 lbs); Sexual maturity at 5 years; Females have pups every year; Longevity 30 years; Behavior; Very Vocal; Large breeding and molting aggregations; Seasonal migrations;
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Harp seals live 20 to 35 years in the wild. There is very little information on the lifespans of harp seals in captivity.

Range lifespan

Status: wild:
20 to 35 years.

Average lifespan

Status: wild:
30 years.

Typical lifespan

Status: wild:
20 to 35 years.

Average lifespan

Status: wild:
30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals are believed to live for more than 30 years (Ronald Nowak 2003). Their longevity in captivity has not been studied in detail, but one specimen was still alive at about 16.3 years of age (Richard Weigl 2005). Gestation does not include the 4-month delayed implantation period.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Harp seals gather together at their breeding grounds in the winter. At the breeding grounds, there may be up to 2,000 seals per square kilometer. The mating system of harp seals is much disputed and they been described as monogamous, polygynous, and polyandrous. To attract females, some male seals blow bubbles and make noises beneath the ice near where females have made entry holes into the water. Males also may chase females or making pawing gestures towards them. To compete for females, male harp seals may splash and bite other males. Research has suggested that female harp seals may also choose their mates based upon the size of their baculum.

Mating System: monogamous ; polygynous ; polygynandrous (promiscuous)

Both male and female harp seals reach sexual maturity at around 5.5 years old, though they both don’t tend to copulate regularly until a few years later. The average reproducing age for females is 10 years old. Males don't successfully compete for breeding opportunities until they are 8 years old. Harp seals remain sexually active for the rest of their lives.

Harp seals breed 10 to 12 days following the birth of their pups. Females enter estrus and breed near the end of lactation. The gestation period is divided into four months of delayed implantation and 7.5 months of active gestation. Birthing of harp seal pups occurs from late February to April. Females give birth on the ice near open water. Harp seals birth one pup at a time, they are nursed and cared for by their mother for 10 to 12 days. The mother’s milk is 48% fat and the pups gain an average of 33 kg while they nurse. Once the pup is weaned it is abandoned by its mother and remains alone on the ice as it waits for its silver-gray pelage to grow in so it can go into the water. While the pup waits, it loses up to 50% of its body fat. Pup mortality is 20 to 30%.

Breeding interval: Harp seals breed once yearly

Breeding season: Harp seals breed from February to April.

Average number of offspring: 1.

Average gestation period: 11.5 months.

Range birth mass: 10 to 11 kg.

Range weaning age: 10 to 12 days.

Range time to independence: 10 to 12 days.

Range age at sexual or reproductive maturity (female): 4 to 6 years.

Average age at sexual or reproductive maturity (female): 5.5 years.

Average age at sexual or reproductive maturity (male): 5.5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation ; post-partum estrous

Average gestation period: 228 days.

Average number of offspring: 1.25.

Average age at sexual or reproductive maturity (male)

Sex: male:
1826 days.

Female harp seals are the sole providers of care to their pup. Mothers nurse their pups for 10 to 12 days. While the pup is still nursing, the mother is very active and leaves the pup alone for extended periods of time. Pups remain near the area where the mother enters the water. Once the pup is weaned, it is left alone on the ice while it sheds its white coat and develops a silver-gray pelage. After about four weeks the pup will become fully independent and forage for its own food.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Novak, R. 1999. Pagophilus groenlandicus. Pp. 887-888 in Walker’s Mammals of the World, Vol. Volume II, Sixth Edition. Baltimore: The Johns Hopkins University Press.
  • Jefferson, T., S. Leatherwood, M. Webber. 1994. Marine Mammals of the World. Rome: United Nations Environment Program and Food and Agriculture Organization of the United Nations.
  • Kovacs, K. 1995. Harp and hooded seals - a case study in the determinants of mating systems in pinnipeds. International Symposium on the Biology of Marine Mammals in the North East Atlantic, Developments in Marine Biology 4: 329-335.
  • 2004. Harp Seals. Pp. 429-430 in D Kleiman, V Geist, M McDade, eds. Grzimek’s Animal Life Encyclopedia, Vol. Volume 14: Mammals III, Second Edition. Farmington Hills, MI: Gale Group, Inc.
  • 2008. "Pagophilus groenlandicus" (On-line). OBIS Seamap. Accessed April 09, 2009 at http://seamap.env.duke.edu/species/tsn/622022.
  • MarineBio.org. 2009. "Pagophilus groenlandicus: Harp Seal" (On-line). MarineBio. Accessed April 05, 2009 at http://marinebio.org/species.asp?id=302.
  • Kovacs, K. 2008. "Pagophilus groenlandicus" (On-line). The IUCN Red List of Threatened Species. Accessed April 05, 2009 at http://www.iucnredlist.org/.
  • Miller, E., L. Burton. 2000. "It's all relative: allometry and variation in the baculum (os penis) of the harp seal, Pagophilus groenlandicus (Carnivora: Phocidae)" (On-line pdf). Wiley Interscience. Accessed April 09, 2009 at http://www3.interscience.wiley.com.proxy.lib.umich.edu/cgi-bin/fulltext/118995635/PDFSTART.
  • Schliemann, H. 1990. Pagophilus groenlandicus. Pp. 221-224 in S Parker, ed. Grzimek’s Encyclopedia of Mammals, Vol. Volume 4, First Edition. New York: McGraw-Hill, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating and parturition begin in late February in the Gulf of St. Lawrence and in early March at the Front off Labrador. Gestation lasts about 1 year, including 2.5-month delayed implantation period. Lactation lasts an average of 12 days. Young enter water when ice breaks up. One pup per year. Sexually mature as early as 3 years and no later than 7-8 years; matures earlier in deleted populations than in dense populations. Vast majority of adult females breed annually. Pupping areas cover 20 to 200 sq km, with seal densities of up to 2000/sq km (Reeves et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pagophilus groenlandicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phoca groenlandica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGGTTATTTTCCACAAATCATAAAGATATCGGTACTCTTTATTTACTGTTCGGTGCATGGGCTGGCATGGTAGGCACCGCTCTTAGTCTCTTAATCCGCGCAGAATTAGGACAACCTGGTGCCCTACTAGGAGAT---GACCAAATTTACAATGTAATTGTCACCGCCCATGCATTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGCGGGTTTGGGAACTGATTAGTACCCCTGATAATCGGAGCCCCTGATATAGCATTTCCCCGAATAAATAATATAAGTTTCTGACTTTTACCACCATCCTTCCTATTACTACTGGCCTCCTCTATAGTAGAAGCGGGTGCCGGAACTGGATGAACCGTCTATCCTCCCTTAGCTGGTAATCTAGCTCATGCAGGAGCATCCGTAGATTTAACGATTTTCTCCCTTCATCTGGCAGGTGTATCATCTATTCTTGGGGCCATCAACTTCATCACTACTATCATTAATATAAAACCCCCTGCAATGTCTCAATACCAAACTCCACTATTTGTATGATCCGTGTTAATCACGGCAGTACTCCTACTATTGTCATTACCAGTCCTAGCAGCTGGCATTACCATGCTACTTACAGATCGGAATCTAAACACAACATTCTTCGATCCTGCCGGAGGAGGTGATCCTATCCTATATCAACATCTGTTCTGATTCTTCGGACACCCCGAAGTGTATATCCTGATCCTACCAGGATTCGGAATAATCTCACACATCGTCACCTACTATTCAGGGAAAAAAGAACCTTTTGGTTACATAGGAATAGTTTGAGCAATAATGTCCATCGGCTTTCTAGGCTTCATTGTATGAGCCCACCATATATTCACTGTAGGGATGGACGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phoca groenlandica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kovacs, K. (IUCN SSC Pinniped Specialist Group)

Reviewer/s
Kovacs, K. & Lowry, L. (Pinniped Red List Authority)

Justification
Due to its large population size, and increasing trends, the Harp Seal should continue to be classified as Least Concern. However, climate change poses a serious threat to this species and Harp Seals should be reassessed within a decade.

IUCN Evaluation of the Harp Seal, Pagophilus gronlandicus
Prepared by the Pinniped Specialist Group


A. Population reduction Declines measured over the longer of 10 years or 3 generations
A1 CR > 90%; EN > 70%; VU > 50%
Al. Population reduction observed, estimated, inferred, or suspected in the past where the causes of the reduction are clearly reversible AND understood AND have ceased, based on and specifying any of the following:
(a) direct observation
(b) an index of abundance appropriate to the taxon
(c) a decline in area of occupancy (AOO), extent of occurrence (EOO) and/or habitat quality
(d) actual or potential levels of exploitation
(e) effects of introduced taxa, hybridization, pathogens, pollutants, competitors or parasites.

Harp Seal females attain sexual maturity at 4-6 years of age and have a maximum longevity of 30-35 years. Thus, the average age of reproducing individuals should be at least 10 years.

A2, A3 & A4 CR > 80%; EN > 50%; VU > 30%
A2. Population reduction observed, estimated, inferred, or suspected in the past where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

All known stocks of Harp Seals are increasing in number.

A3. Population reduction projected or suspected to be met in the future (up to a maximum of 100 years) based on (b) to (e) under A1.

Climate change impacts are almost certainly going to be negative for Harp Seals in the future.

A4. An observed, estimated, inferred, projected or suspected population reduction (up to a maximum of 100 years) where the time period must include both the past and the future, and where the causes of reduction may not have ceased OR may not be understood OR may not be reversible, based on (a) to (e) under A1.

Rates of population reductions over the next 100 years are difficult to predict. Impacts of climate change will depend on the relative rates of ice declines across the range of Harp Seals and the degree to which they are flexible about shifting breeding locations – which is currently unknown.

B. Geographic range in the form of either B1 (extent of occurrence) AND/OR B2 (area of occupancy)
B1. Extent of occurrence (EOO): CR
The EOO of Harp Seals is > 20,000 km².

B2. Area of occupancy (AOO): CR
The AOO of Harp Seals is > 2,000 km².

AND at least 2 of the following:
(a)
Severely fragmented, OR number of locations: CR = 1; EN (b) Continuing decline in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) area, extent and/or quality of habitat; (iv) number of locations or subpopulations; (v) number of mature individuals.
(c) Extreme fluctuations in any of: (i) extent of occurrence; (ii) area of occupancy; (iii) number of locations or subpopulations; (iv) number of mature individuals.

C. Small population size and decline
Number of mature individuals: CR
The current abundance of Harp Seals is approximately 8 million, with pup production of approximately 1.4 million.

AND either C1 or C2:
C1. An estimated continuing decline of at least: CR = 25% in 3 years or 1 generation; EN = 20% in 5 years or 2 generations; VU = 10% in 10 years or 3 generations (up to a max. of 100 years in future)
C2. A continuing decline AND (a) and/or (b):
(a i) Number of mature individuals in each subpopulation: CR or
(a ii) % individuals in one subpopulation: CR = 90–100%; EN = 95–100%; VU = 100%
(b) Extreme fluctuations in the number of mature individuals.

D. Very small or restricted population
Number of mature individuals: CR AND/OR restricted area of occupancy typically: AOO
The total population of Harp Seals is approximately 8 million.

E. Quantitative analysis
Indicating the probability of extinction in the wild to be: Indicating the probability of extinction in the wild to be: CR > 50% in 10 years or 3 generations (100 years max.); EN > 20% in 20 years or 5 generations (100 years max.); VU > 10% in 100 years

Harp Seals are almost certainly going to be negatively impacted by climate change. But, they are currently abundant and increasing.

Listing recommendationBecause of their current high population size and increasing trends, the Harp Seal should be listed as Least Concern. However, they should be assessed again within the next decade, because of the risk of climate change induced habitat degradation.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Due to limitations on slaughter and the involvement of conservation groups, harp seals not a threatened species and their numbers have actually begun to increase over the last few years. They are listed as "least concern" on the IUCN Red List.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The harp seal is the most abundant pinniped species in the Northern Hemisphere. Globally this species numbers close to 8 million animals. Pup production at all breeding sites combined is at least 1.4 million pups per year currently (Stenson et al. 2003, Potelov et al. 2003, Haug et al. 2006). The Northwest Atlantic stock of harp seal is estimated to number 5.9 million animals (DFO 2005). This latest estimate for Canadian waters is significantly higher than the previous estimate produced in 2000, when the Gulf and Front herds combined were estimated to number 5.5 million. This is a marked recovery from an estimated low of around 1.8 million in the early 1970s (Sergeant 1976). Catch levels have been increased repeatedly for this population during the last decade and likely now exceed potential biological removal levels by 1.5 – 5.9 times. Given this level of removal the population is likely to now be in decline (Johnston et al. 2000). The breeding group in the West Ice near Jan Mayen was estimated at 296,000 in 1994; this population increased to approximately 348 000 by 2003. The White Sea breeding group was estimated to be 1.8 million animals when last surveyed in 2000 (Potelov et al. 2003).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Harp seals have been harvested for thousands of years by native peoples of the Atlantic Arctic, including coastal Northern Europeans (Lavigne and Kovacs 1988). Basque whalers began taking harp seals in the 1500s. By the mid-1600s, French settlers developed land-based netting techniques on the St. Lawrence River in the 1700s. French-Canadians exported 500 tons of oil per year by the mid-1700s, based on an estimated take of 6,000 seals per year. In Newfoundland, English settlers hunted harp seals on a larger scale that accounted for an estimated average take of 7,000-12,800 seals per year for most of the 1700s. By the 1800s, schooner-based sealing developed and the number of seals harvested rose dramatically; from 1803-1816 the average annual take was 117,000. The peak of sealing in the Northwest Atlantic occurred between 1818 and 1862, when 500,000 seals were harvested in many years, with maxima between 640 000-740 000 in individual years. During that time, it is estimated that 18.3 million harp seals, mostly whitecoats, were killed for oil. The records show somewhat lower figures for the Northeast Atlantic. At Jan Mayen, the catch began falling in the late 1850s; the drop in catch is likely attributable to over-harvesting. From 1860 to 1900, an estimated 12.8 million seals were harvested from the West Ice.

During the 20th century harp seals became more valued for their pelts than their oil. In 1917 143,000 seals were taken. The catch dropped for a time, then escalated in the 1950s, when it averaged 312,000 seals per year. In 1960, Canada became concerned about the large numbers of adults being killed, so it placed limits on the length of the hunting season. During the 1960s, an average of 284,000 seals were taken per year in the Northwest Atlantic stock. In the mid 1960s adult females became protected on the breeding grounds, and Norway was excluded from sealing in Canadian waters. In 1971 a quota management program was established; from 1970 to 1987 quotas varied from 127,000 per year to 245,000 per year, but the actual harvest was often much lower than the quota (Lavigne and Kovacs 1988).

In 1983, the European Economic Community imposed an import ban on all whitecoat products and the average annual harvest in Canadian waters fell to 52,000 seals from 1983-1995. By 1987, Canada banned the killing of whitecoats and the focus of the hunt switched to beaters (post-weaning to 13 months of age) (DFO 2006a). From 1999-2003, the estimated annual mortality of harp seals in the Northwest Atlantic was 453,962, broken down into an average of 232,915 taken in the commercial harvest by Canada, 83,000 taken from 1999-2002 in Greenland and approximately 5,000 taken in the Canadian High Arctic, plus a by-catch of close to 20,000 in the Newfoundland lumpfish fishery, with an average annual struck and loss rate of 119,430 from all harvests (Waring et al. 2005).

The Canadian harvest has recently increased with the combined three-year 2003-2005 quota (“Total Allowable Catch”) set at 975,000 (DFO 2005a). Given the age structure of the current hunt, this quota is not sustainable (see Johnston et al. 2000). In addition to Canada’s commercial harvest, some harp seals are still taken in subsistence hunts in Labrador, Newfoundland, northern Quebec and in Nunavut. Aboriginal peoples and non-Aboriginal coastal residents who reside north of latitude 53 degrees can hunt seals for subsistence purposes without a permit (DFO 2006b).

In the Northeast Atlantic, Norway established a commercial hunt in 1846, which peaked in the 1870s-1880s when annual catches ranged between 50,000-120,000 animals. In the 20th century, annual harvests increased to an average above 100,000 per year, with the maximum in the 1920s and 1930s, when the catches were 200,000-300,000 seals per year. In 1989, Norway banned the killing of whitecoats (N-RFC 2006). For 2005, the harvest of the West Ice stock was approximately 20,000. In the White Sea, Russia hunters took 14,277 harp seals in 2005 (DFO 2005). The numbers of harp seals struck-and-lost in the both the current commercial hunts (which is focused largely on 1+ animals) and in subsistent hunting is high, and most harvest estimates do not account for this additional mortality (Lavigne 1999). The struck and loss rate for harp seals in Greenland could be as high as 50% (Sjare and Stenson 2002).

Another threat to harp seals is over-harvesting of their prey, including capelin and herring. Several harp seal “invasions” have taken place in recent decades along the north coast of Norway. By-catch mortality in nets during these events was estimated to be as high as 100,000 animals in 1987 and 21,474 in 1988 (Haug et al. 1991). These reasons for these emigrations out of their normal range within the Barents and Greenland Seas seems to have been a collapse of the herring and capelin stocks due to a combination of over-fishing and shifting oceanographic conditions (low temperatures and salinity, and extensive ice cover) (Haug et al. 1991, Woodley and Lavigne 1991).

A small tourist industry that visits the whelping patches in the Gulf of St Lawrence is not thought to pose any risk to the seals under its current rotational mode of operation (Kovacs and Innes 1990).

Global climate warming is currently already causing major reductions in the extent and seasonal duration of sea ice cover in the Northern Hemisphere, creating a threat to many species of ice-associated marine mammals (Tynan and DeMaster 1997, Learmonth et al. 2006, Kovacs and Lydersen 2008, Laidre et al. 2008). Pinnipeds, such as the harp seal that are dependant on sea ice for pupping, moulting and resting are likely to be heavily impacted by such changes in the future (Johnston et al. 2005, Friedlaender et al. 2007).

Oil spills in the Northwest Atlantic off the east coast of Canada remain a threat to seals. There is a concern about the impacts of tanker traffic, particularly in places like Lancaster Sound in the eastern Canadian Arctic, which is an important harp seal summering area (Reijinders et al. 1993). The discharge from a ruptured tank on the shore of New Brunswick, Canada in March–April 1969 led to 10,000 to 15,000 seals being heavily coated with oil. The high number of dead seal pups washing ashore after this event was evidence of the lethal effects of the oil (St Aubin, 1990). Oil development in the Barents Sea is on-going and poses a future threat to harp seals in the White Sea and West Ice stocks.

Harp seals have been found to carry significant loads of contaminants including metals, DDT and PCBs (Ronald et al. 1984a,b). Organochlorines are still present in their blood, despite DDT levels (and PCBs to a lesser extent) declining from the early 1970s to the 1980s (Addison et al. 1984) and further in the 1990s.

Phocine distemper virus (PDV) was first found in harp seals from the West Ice off Jan Mayen in 1987 and 1989. It is widespread in harp seals, but only shows up in terms of antibodies; it is not known if there are significant health effects or mortality from PDV infection in this species (Daoust et al. 1993, Duignan et al. 1997). Harp seals might have been the carriers responsible for the harbour seals PDV epidemic in Europe in 1988 (Markussen and Have 1992). PDV also appeared in the Gulf of St Lawrence in 1991, but not in epidemic proportions (Daoust et al. 1993).

Natural predators of harp seals include polar bears, killer whales, and Greenland shark (Lavigne and Kovacs 1988). In Svalbard, 13% of polar bears prey is comprised of harp seals (Derocher et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Periodically, 10,000s have died annually after being entangled in fishing gear. See Beck et al. (1994, Can. J. Zool. 72:174-182) for information on organochlorine residues in seals in the Gulf of St. Lawrence and Hudson Strait. In the northwestern Atlantic, total removals (harvest plus individuals killed but not landed) increased from about 179,000-209,000 in 1994 to 417,000-533,000 in 1998 (Lavigne 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Canada has in place sealing regulations pursuant to the 1993 Marine Mammal Regulations that require annual quotas, referred to as “Total Allowable Catches,” hunting licenses, and official observers of the commercial hunt (DFO 2005). In the northeast Atlantic, quotas for sealing are based on recommendations made by the International Council for Exploration of the Sea (ICES) and the Northwest Atlantic Fisheries Organisation (NAFO). Russia is responsible for managing seals in the southeast part of the Barents Sea, while Norway is responsible for managing stocks in the Greenland Sea by Jan Mayen (NMFCA 2006, N-RFC 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Harp seals have been blamed for the decline of certain fish populations, which has an affect on the fishing industry. To try to control the decline of certain fish populations, the fishing industry continues to fight to increase the amount of seals allowed to be slaughtered each year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Harp seals provide meat for some native Arctic peoples. Historically, harp seal fur, oil, and meat were incredibly important to humans. Currently, demand for harp seal products has dropped off considerably due to import regulations.

Harp seals have also become an important part of the tourist industry in Canada, where tourists can visit harp seal whelping sites.

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long exploited for subsistence use, and long subjected to an extensive commercial harvest (100,000+ annually in recent years). There is some controversy regarding the impact of this species on commercial fisheries in the Northwest Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Harp seal

The harp seal or saddleback seal is a species of earless seal native to the northernmost Atlantic Ocean and parts of the Arctic Ocean. It now belongs to the monotypic genus Pagophilus. Its scientific name, Pagophilus groenlandicus, means "ice-lover from Greenland", and its synonym, Phoca groenlandica means "Greenland seal".[2] Originally in the genus Phoca with a number of other species, it has since been reclassified into its own genus Pagophilus.

Contents

Description [edit]

The harp seal has a silvery-gray body. Its eyes are pure black. It has black harp or wishbone-shaped markings on the back.[2] The baby harp seal (pup) has a yellow-white coat at birth, but after three days, the coat turns white and stays white for about 12 days. Adult harp seals grow up to be 1.7 to 2.0 m (5 to 6 feet) long and weigh from 140 to 190 kg (300 to 400 pounds).

Physiology [edit]

Thermoregulation [edit]

Harp seals combine anatomical and behavioral approaches to managing their body temperatures, instead of elevating their metabolic rate and energy requirements.[2] A thick coat of blubber insulates its body and provides energy when food is scarce or during fasting. Blubber also streamlines its body for more efficient swimming. Brown fat warms blood as it returns from the body surface as well as providing energy, most importantly for just-weaned pups.[2]

Flippers act as heat exchangers, warming or cooling the blood as needed. On ice, the seal can press its fore-flippers to its body and its hind-flippers together to reduce heat loss.[2]

Senses [edit]

Vision is its critical sense. Its eyes are proportionally large and contain a large spherical lens, improving its focusing ability. Its pupil is mobile to help it adapt to the intense glare of the Arctic ice. Its retina is rod-dominated and backed by a cat-like and reflective tapetum lucidum, enhancing its low light sensitivity. Its rods best sense blue-green, while its cones help with bright light and may provide some color discrimination. Its cornea is constantly tear-covered, to protect it from salt. Lacking tear ducts, it "cries" to remove its tears.[2] On ice, the mother identifies her offspring by smell. This sense may also warn of an approaching predator. Underwater, this seal closes its nostrils and smells nothing.[2] Its whiskers, called vibrissae, lie in horizontal rows on either side of its snout. They may provide a touch sense, and underwater, also respond to low-frequency vibrations, such as movement.

Life history [edit]

Harp seals prefer to swim in the ocean, spending relatively little time on land.[3] These are extremely social animals and they can be very noisy, as well. They will form large colonies where they spend a great deal of time. Within that loose structure, smaller groups with their own hierarchy are believed to form. Sometimes, these large groups will have to go their separate ways there. Many harp seals are able to live up to 30 years in the wild. After 12 days the mothers abandons her babies.

On the ice, pups call their mothers by "bawling" and "mumble" while playing with others. Adults "growl" and "warble" to warn off others. Underwater, adults express themselves with more than 19 call types during courting and mating.[2]

Reproduction [edit]

Females mature sexually at age five to six. Annually thereafter, they bear one pup, usually in late February. The fertilized egg grows into a spherical embryo that implants in the uterus only after three or so months, to allow birth to take place while sufficient pack ice is available.[2]

Newborn pups weigh around 11 kilograms (24 lb) and are 80–85 centimetres (31–33 in) long. After birth, the mother only feeds that pup. During the 12 day nursing period, the mother does not eat, losing up to 3 kilograms (7 lb) per day. Harp seal milk contains up to 48% fat, so pups gain over 2.2 kilograms (4.9 lb) per day. During this time, the juvenile's "greycoat" grows in beneath the white neonatal coat, and it weighs 80 pounds (36 kg). Weaning is abrupt; the mother turns from nursing to promiscuous mating, leaving the pup behind on the ice. While courtship starts on the ice, mating usually takes place in the water.[2]

The stranded pup cries at first, and then becomes sedentary to conserve body fat. Within a few days, it sheds its white coat, reaching the "beater" stage.[2]

Pups are unable to swim or find food until seven to eight weeks old or until the ice melts, leaving them vulnerable to polar bears and other predators. This fast costs them up to 50% of their weight. As many as 30% of pups die during their first year, due in part to their early immobility because they learn to swim only slowly.

At about 13–14 months old, the pup molts again, becoming a "bedlamer". Juveniles molt several times, producing a "spotted harp", before the adult's harp-marked pelt fully emerges after several years (or not all in females).[2]

Seals congregate annually on the ice to molt before migrating to summer feeding grounds. Their lifespan extends for about 20 years.[4][5]

There are two recognised subspecies:[6]

Migration and vagrancy [edit]

Harp seals are strongly migratory. The northwest population regularly moves up to 4000 miles northeast outside of the breeding season;[7] one individual was located off the north Norwegian coast, 4,640 kilometers (2,880 mi) east northeast of its tagging location.[8] Their navigational accuracy is high, with good eyesight an important factor.[7][9] They are occasionally found as vagrants, south of their normal range. In Great Britain, a total of 31 vagrants were recorded between 1800 and 1988,[10]

More recently, they reached Lindisfarne in Northumberland in September 1995,[11] and the Shetland Islands in 1987. The latter was linked to a mass movement of harp seals into Norwegian waters; by mid-February 1987, 24,000 were reported drowned in fishing nets and perhaps 300,000 (about 10% of the world population) had invaded fjords as far south as Oslo. The animals were emaciated, likely due to humans competing for their prey.[12]


Seal hunting [edit]

All three populations are hunted commercially, mainly by Canada, Norway, Russia and Greenland.[2]

In Canada, commercial hunting season is from November 15 to May 15. Most sealing occurs in late March in the Gulf of St. Lawrence, and during the first or second week of April off Newfoundland, in an area known as "the Front". This peak spring period is generally what is referred to as the "Canadian seal hunt". Hunting Canadian whitecoats has been banned since 1987. In 2006, the St. Lawrence hunt officially started on March 25 due to thin ice caused by the year's milder temperatures. Inuit people living in the region hunt mainly for food and, to a lesser extent, commerce.[2]

In 2003, the three-year quota granted by the Department of Fisheries and Oceans was increased to 975,000, with a maximum of 350,000 in any two consecutive years. In 2006, 325,000 harp seals, as well as 10,000 hooded seals and 10,400 grey seals were killed. An additional 10,000 animals are allocated to First Nations hunters.

The Canadian seal hunt is monitored by the Canadian government. Although approximately 70% of the hunt occurs on "the Front", most private monitors focus on the St. Lawrence hunt, due to its more convenient location.

About 70-90,000 animals are taken from the population off the coast of Greenland.[2]

The 2004 West Ice TAC was 15,000 "1+" animals (2 pups = 1+), almost double the sustainable catch of 8,200. Actual catches were 9,895 in 2004 and 5,808 in 2005.[2]

The 2004 White Sea TAC was 45,000 1+ (2.5 pups = 1+). The catch was 22,474.[2]

References [edit]

  1. ^ Kovacs, K. (2008). Pagophilus groenlandicus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 January 2009.
  2. ^ a b c d e f g h i j k l m n o p q Lavigne, David M. (2009). In Perrin, William F.; Wursig, Bernd; Thewissen, J. G. M. Encyclopedia of Marine Mammals (2 ed.). 30 Corporate Drive, Burlington Ma. 01803: Academic Press. ISBN 978-0-12-373553-9. 
  3. ^ "Nationalgeographic.com". Animals.nationalgeographic.com. Retrieved 2012-09-07. 
  4. ^ "Harp Seal (Pagophilus groenlandicus) - Office of Protected Resources - NOAA Fisheries". Nmfs.noaa.gov. 2009-09-01. Retrieved 2012-09-07. 
  5. ^ "Seamap Duke.edu". Seamap.env.duke.edu. Retrieved 2012-09-07. 
  6. ^ Berta, A. & Churchill, M. (2012). "Pinniped Taxonomy: evidence for species and subspecies". Mammal Review 42 (3): 207–234. doi:10.1111/j.1365-2907.2011.00193.x. 
  7. ^ a b Ronald, K., & Healey, P. J. (1981). Harp Seal. Chapter 3 in Ridgeway, S. H., & Harrison, R. J., eds. Handbook of Marine Mammals, vol. 2 Seals. Academic Press, London.
  8. ^ Sergeant, D. E. (1973). Transatlantic migration of a Harp Seal, Pagophilus groenlandicus. J. Fish. Res. Board Canada 30: 124-125.
  9. ^ King, J. E. (1993). Seals of the World, 2nd. ed. British Museum, London.
  10. ^ Corbet, G. B., & Harris, S., eds. (1991). The Handbook of British Mammals, 3rd. ed. Blackwell, Oxford.
  11. ^ Frankis, M. P., Davey, P. R., & Anderson, G. Q. A. (1997). Harp Seal: a new mammal for the Northumberland fauna. Trans. Nat. Hist. Soc. Northumbria 57 (4) 239-241.
  12. ^ Anon (1987). Harp Seals, Brunnich's Guillemots and White-billed Divers Twitching 1 (3): 58.

Further reading [edit]

The Northwest population:

The White Sea and West Ice populations:

  • Hamre, J.(1994). Biodiversity and exploitation of the main fish stocks in the Norwegian- Barents Sea ecosystem. Biodiversity and Conservation 3:473-492
  • Haug, T., Kroeyer, A.B., Nilssen, K.T., Ugland, K.I. and Aspholm, P.E., (1991). Harp seal (Phoca groenlandica ) invasions in Norwegian coastal waters: Age composition and feeding habits. ICES journal of marine science. Vol. 48, no. 3:363-371
  • ICES 2001. Report of the Joint ICES/NAFO Working Group on Harp and Hooded Seals, ICES Headquarters, 2–6 October 2000. ICES CM, 2001, ACFM:8, 40 pp.
  • Nilssen, K.T., Pedersen, O.-P., Folkow, L.P., & Haug. T. 2000. Food consumption estimates of Barents Sea harp seals. NAMMCO Sci. Publ. 2:9-28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Placed in the genus Pagophilus by Muizon (1982), Rice (1998), Baker et al. (2003), and some other authors, but regarded (with the nominal genera Histriophoca and Pusa) as a member of the genus Phoca in other recent literature (e.g., King 1983; Riedman 1990; Nowak 1991; Reeves et al. 1992; Wozencraft, in Wilson and Reeder 1993).

A cladistic analysis of mtDNA data yielded three clades among northern seals: Phoca-Pusa-Halichoerus, Cystophora-Pagophilus, and Erignathus (Perry et al. 1995). Each clade may be regarded as a tribe of the subfamily Phocinae. The magnitude of the differences among Phoca, Pusa, and Halichoerus was on the same order as that between species and subspecies within the genus Odocoileus. Because Cystophora is the closest relative of Pagophilus, the latter cannot be regarded as congeneric with Phoca; the differences between the two are great enough to justify placing them in separate genera (Perry et al. 1995). However, Mouchaty et al. (1995) examined the mitochondrial cytochrome b gene and found a close relationship between P. groenlandicus and Histriophoca fasciata, which, they noted, merits further study.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!