Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alcippe poioicephala

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTCTGTACCTGATTTTCGGCGCATGAGCTGGAATAGTAGGTACCGCCCTCAGCCTCCTTATTCGAGCAGAACTAGGACAACCAGGCGCTCTCCTAGGAGACGACCAAATCTACAATGTAATTGTCACAGCCCATGCCTTTGTAATAATCTTCTTTATAGTTATACCAATTATGATCGGAGGTTTCGGAAACTGACTAGTCCCACTAATAATCGGAGCCCCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTCCTAGCTTCCTCCACAGTAGAAGCCGGAGCAGGAACTGGATGAACCGTATACCCCCCACTAGCTGGCAACCTAGCTCACGCCGGAGCCTCAGTCGACCTGGCCATTTTCTCCCTGCACCTAGCAGGAATCTCATCAATTCTAGGAGCTATCAACTTCATTACAACAGCAATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCACTATTCGTATGATCAGTACTAATCACCGCAGTACTACTACTTCTATCTCTCCCAGTCCTTGCCGCAGGTATTACAATACTACTAACAGACCGTAACCTAAACACTACTTTCTTTGACCCAGCGGGAGGAGGAGACCCAGTACTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alcippe poioicephala

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as locally very common to uncommon in India, locally common in Bangladesh and china and generally common in its South-East Asian range (del Hoyo et al. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown-cheeked Fulvetta

The Brown-cheeked Fulvetta (Alcippe poioicephala) (or Brown-cheeked Alcippe as the fulvettas proper are not closely related to this bird), is included in the Pellorneidae family. It was earlier also known as the Quaker Babbler.

This species is one of those retained in the genus Alcippe after the true fulvettas and some others were removed; the group had turned out to unite quite unrelated birds. Its closest relatives are probably the Brown Fulvetta, and the Black-browed Fulvetta which was only recently recognized as a distinct species again. The Javan Fulvetta and the Nepal Fulvetta might also belong into this group.(Pasquet et al. 2006)

The Brown-cheeked Fulvetta is a resident breeding bird in India and Southeast Asia. Its habitat is undergrowth in moist forests and scrub jungle. This species, like most babblers, is not migratory, and has short rounded wings and a weak flight.

This babbler builds its nest in a tree, concealed in dense masses of foliage. The normal clutch is two or three eggs.

Brown-cheeked Fulvetta measures 15 cm including its longish tail. It is brown above and buff, with no patterning on the body or wings. The crown is grey, and the cheeks are dark.

Brown-cheeked Fulvettas have short dark bills. Their food is mainly insects and nectar. They can be difficult to observe in the dense vegetation they prefer, but these are vocal birds, and their characteristic calls are often the best indication that these birds are present.

Call of Brown-cheeked Fulvetta recorded in Nagerhole

Problems playing this file? See media help.

Nesting[edit]

The Brown-cheeked Fulvetta nests from January to June with a peak in January–February. In a study by Anoop Das and Vijayan, a total of 38 nests were found in 50,000 square metres. The nest is a cup, built with green moss, rootlets, lichen, leaves and grass lined with rootlets and placed in a fork or suspended from the twigs at a mean height of 68.21 cm from ground. Mean nest width was 91.8 mm and depth 48.7 mm.

Clutch size was two to three eggs and the incubation period is 10 +/-2 days and the nestling period is 12+/- 2 days. Hatching success was 55% while the nestling success was 32%. The most preferred plants for nesting were shrubs of the species Lasianthus ciliatus (36%) followed by the Saprosma fragrans (27%) and Thottea siliquosa (23%).

They tended to locate their nests at central position just near the main stem. A principal component analysis of the nest site variables showed nest height, concealment, plant height and canopy cover as the major parameters in nest site selection, explaining 73% cumulative variance. Of these the crucial deciding factors were plant height and canopy cover when the nest sites were compared with the random sites (discriminant function analysis).

Nest success was directly correlated with concealment as it reduces the chance for predation. Nest site selection of this bird thus shows the choice of a particular location for successful nesting, which is a dense evergreen forest with dense shrub cover and without much disturbance.

Gallery[edit]

References[edit]

  • Anoop Das[verification needed] K.S. & Vijayan, L. (2004): The nest site and breeding biology of an under storey bird, Brown-cheeked Fulvetta in Silent Valley National park, Southern India. Presented at: International conference on bird and Environment, Haridwar, India.
  • Grimmett, Richard; Inskipp, Carol, Inskipp, Tim & Byers, Clive (1999): Birds of India, Pakistan, Nepal, Bangladesh, Bhutan, Sri Lanka, and the Maldives. Princeton University Press, Princeton, N.J.. ISBN 0-691-04910-6
  • Kazmierczak, Krys & van Perlo, Ber (2000): A Field Guide to the Birds of the Indian Subcontinent. Pica Press, Sussex. ISBN 978-1-873403-79-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!