Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abroscopus albogularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTAATCTTCGGCGCATGAGCCGGGATGGTAGGGACTGCCCTGAGCCTCCTCATCCGAGCAGAGCTGGGTCAACCTGGTGCCCTTCTAGGGGACGATCAAGTGTACAATGTGATCGTCACAGCCCATGCTTTCGTGATGATCTTCTTTATAGTTATACCTATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGGATAAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTACTACTAGCATCTTCTACGGTAGAAGCAGGCGTCGGAACAGGATGAACAGTCTACCCACCCCTGGCCGGCAACCTGGCCCACGCCGGAGCATCAGTGGACCTAGCCATCTTCTCCCTACACCTGGCAGGAATTTCCTCAATCCTAGGGGCAATCAACTTCATTACAACAGCAATCAACATAAAACCTCCTGCCCTTTCACAATATCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTCCTACTCCTACTGTCCCTTCCAGTCCTAGCTGCCGGTATTACCATGCTACTTACCGACCGCAACCTTAACACCACTTTCTTCGATCCGGCCGGAGGCGGAGACCCAGTACTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Abroscopus albogularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is reported to be scarce to locally common (Baker 1997), while national population sizes have been estimated at c.10,000-100,000 breeding pairs in China, c.10,000-100,000 breeding pairs in Taiwan (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rufous-faced warbler

The rufous-faced warbler (Abroscopus albogularis) is a species of bush warbler (family Cettiidae). It was formerly included in the "Old World warbler" assemblage.

It is found in Bangladesh, Bhutan, China, India, Laos, Myanmar, Nepal, Taiwan, Thailand, and Vietnam. Its natural habitat is subtropical or tropical moist lowland forests.

References[edit]

  1. ^ BirdLife International (2012). "Abroscopus albogularis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 



Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!