Overview

Distribution

Range

West and central Europe; winters to sahel of n Africa.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phylloscopus bonelli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTGCTTATCCGAGCAGAACTAGGCCAACCCGGCGCACTCCTAGGCGAC---GACCAAGTCTACAACGTAGTTGTCACAGCTCACGCCTTCGTAATAATCTTCTTCATGGTCATACCCATCATGATCGGAGGCTTCGGAAACTGACTAGTTCCTCTAATA---ATCGGAGCCCCAGACATGGCATTCCCCCGAATAAACAACATAAGCTTTTGACTACTCCCCCCATCCTTCCTCCTACTGTTAGCCTCCTCCACAGTAGAGGCAGGGGTAGGAACAGGCTGAACAGTATACCCCCCTCTAGCTGGCAACCTGGCACACGCCGGAGCTTCCGTCGACCTG---GCTATCTTCTCCCTCCACCTAGCAGGTATCTCCTCTATCTTAGGAGCTATCAACTTCATCACAACCGCAATCAACATAAAACCGCCTGCCCTATCACAATACCAAACCCCTCTGTTCGTCTGATCCGTACTAATCACCGCAGTACTACTACTACTCTCCCTCCCAGTCCTAGCCGCT---GGAATTACTATGCTACTCACAGACCGCAACCTTAACACCACCTTCTTTGACCCAGCAGGCGGAGGAGACCCAGTCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phylloscopus bonelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 1,400,000-3,500,000 breeding pairs, equating to 4,200,000-10,500,000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 4,470,000-14,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western Bonelli's Warbler

Western Bonelli's Warbler is a "warbler" in the leaf warbler genus Phylloscopus. It was formerly regarded as the western subspecies of a wider "Bonelli's Warbler" species, but as a result of modern taxonomic developments, this species is now usually considered to be two species:[2][3]

The breeding ranges of the two species do not overlap; while their appearance and songs are very similar, the calls are completely different (see below). They also show marked difference in mtDNA sequence.[4]

The species is migratory, wintering in sub-Saharan Africa. It is a rare vagrant in Northern Europe.

This bird is named after the Italian ornithologist Franco Andrea Bonelli.[5]

Description[edit]

Western Bonelli's Warbler is a small passerine bird, found in forest and woodland. 4-6 eggs are laid in a nest on the ground. Like most warblers, Western Bonelli's is insectivorous.

The adult has a plain grey-green back, green-toned rump and wings and whitish underparts. The bill is small and pointed and the legs brown. The sexes are identical, as with most warblers.

The Western Bonelli's Warbler has a browner tinge to the upperparts than Eastern Bonelli's Warbler; the latter sometimes has a greenish tinge instead. The song is a fast monotone trill, only slightly different from Eastern Bonelli's, and also some similarity to Wood Warbler. The call of the Western Bonelli's Warbler is a disyllabic hu-it, differing from that of Eastern which is a completely different hard chup, reminiscent of a Crossbill or a House Sparrow.[6]

References[edit]

  1. ^ BirdLife International (2012). "Phylloscopus bonelli". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Parkin, David T. (2003): Birding and DNA: species for the new millennium. Bird Study 50(3): 223–242. HTML abstract
  3. ^ Sangster, George; Knox, Alan G.; Helbig, Andreas J. & Parkin, David T. (2002): Taxonomic recommendations for European birds. Ibis 144(1): 153–159. PDF fulltext
  4. ^ Helbig, A. J.; Seibold, I.; Martens, J. & Wink, M. (1995): Genetic differentiation and phylogenetic relationships of Bonelli's Warbler Phylloscopus bonelli and Green Warbler P. nitidus. J. Avian Biol. 26: 139–153.
  5. ^ Beolens, Bo; Watkins, Michael (2003). Whose Bird? Men and Women Commemorated in the Common Names of Birds. London: Christopher Helm. p. 59. 
  6. ^ Helb, H.-W.; Bergmann, H.-H. & Martens, J. (1982): Acoustic differences between populations of western and eastern Bonelli's Warblers (Phylloscopus bonelli, Sylviidae). Cellular and Molecular Life Sciences 38(3): 356–357.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!