Overview

Distribution

Range

West and central Europe; winters to sahel of n Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phylloscopus bonelli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTGCTTATCCGAGCAGAACTAGGCCAACCCGGCGCACTCCTAGGCGAC---GACCAAGTCTACAACGTAGTTGTCACAGCTCACGCCTTCGTAATAATCTTCTTCATGGTCATACCCATCATGATCGGAGGCTTCGGAAACTGACTAGTTCCTCTAATA---ATCGGAGCCCCAGACATGGCATTCCCCCGAATAAACAACATAAGCTTTTGACTACTCCCCCCATCCTTCCTCCTACTGTTAGCCTCCTCCACAGTAGAGGCAGGGGTAGGAACAGGCTGAACAGTATACCCCCCTCTAGCTGGCAACCTGGCACACGCCGGAGCTTCCGTCGACCTG---GCTATCTTCTCCCTCCACCTAGCAGGTATCTCCTCTATCTTAGGAGCTATCAACTTCATCACAACCGCAATCAACATAAAACCGCCTGCCCTATCACAATACCAAACCCCTCTGTTCGTCTGATCCGTACTAATCACCGCAGTACTACTACTACTCTCCCTCCCAGTCCTAGCCGCT---GGAATTACTATGCTACTCACAGACCGCAACCTTAACACCACCTTCTTTGACCCAGCAGGCGGAGGAGACCCAGTCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phylloscopus bonelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2005
    Least Concern
  • 2004
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 1400000-3500000 breeding pairs, equating to 4200000-10500000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 4470000-14000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western Bonelli's Warbler

Western Bonelli's Warbler is a "warbler" in the leaf warbler genus Phylloscopus. It was formerly regarded as the western subspecies of a wider "Bonelli's Warbler" species, but as a result of modern taxonomic developments, this species is now usually considered to be two species (Sangster et al. 2002, Parkin 2003):

The breeding ranges of the two species do not overlap; while their appearance and songs are very similar, the calls are completely different (see below). They also show marked difference in mtDNA sequence (Helbig et al. 1995).

The species is migratory, wintering in sub-Saharan Africa. It is a rare vagrant in Northern Europe.

Western Bonelli's Warbler is a small passerine bird, found in forest and woodland. 4-6 eggs are laid in a nest on the ground. Like most warblers, Western Bonelli's is insectivorous.

It is a small warbler. The adult has a plain grey-green back, green-toned rump and wings and whitish underparts. The bill is small and pointed and the legs brown. The sexes are identical, as with most warblers.

The Western Bonelli's Warbler has a browner tinge to the upperparts than Eastern Bonelli's Warbler; the latter sometimes has a greenish tinge instead. The song is a fast monotone trill, only slightly different from Eastern Bonelli's, and also some similarity to Wood Warbler. The call of the Western Bonelli's Warbler is a disyllabic hu-it, differing from that of Eastern which is a completely different hard chup, reminiscent of a Crossbill or a House Sparrow.(Helb et al. 1982)

This bird is named after the Italian ornithologist Franco Andrea Bonelli.

References

  • Helb, H.-W.; Bergmann, H.-H. & Martens, J. (1982): Acoustic differences between populations of western and eastern Bonelli's Warblers (Phylloscopus bonelli, Sylviidae). Cellular and Molecular Life Sciences 38(3): 356–357. (HTML abstract)
  • Parkin, David T. (2003): Birding and DNA: species for the new millennium. Bird Study 50(3): 223–242. HTML abstract
  • Sangster, George; Knox, Alan G.; Helbig, Andreas J. & Parkin, David T. (2002): Taxonomic recommendations for European birds. Ibis 144(1): 153–159. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!