Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Overview

Distribution

Range

E Siberia to n China and n Manchuria; winters to s Asia.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acrocephalus bistrigiceps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGCACATGAGCCGGAATAGTAGGTACCGCCCTCAGCCTCCTTATTCGAGCAGAACTAGGCCAGCCAGGTGCCCTTCTTGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCACGCGTTCGTAATAATCTTCTTTATAGTCATACCAATCATAATCGGAGGATTCGGAAATTGACTAGTACCCCTAATGATCGGAGCCCCAGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGACTCCTCCCACCTTCCTTCCTACTACTACTAGCCTCATCAACAGTCGAAGCAGGAGCAGGCACAGGTTGAACCGTATACCCCCCTCTAGCCGGCAACCTAGCCCACGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACCTAGCGGGAATCTCATCAATCCTAGGAGCAATCAACTTCATCACAACAGCCATCAACATAAAACCACCCGCCCTGTCCCAATACCAAACCCCCCTGTTCGTCTGATCTGTCCTAATCACCGCCGTACTACTCCTCCTATCCCTCCCAGTACTAGCCGCTGGCATCACAATACTACTCACCGACCGTAACCTCAACACTACCTTCTTTGACCCCGCAGGCGGAGGAGACCCTGTACTCTACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acrocephalus bistrigiceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as locally numerous (del Hoyo et al. 2006), while national population estimates include: c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in China; < c.50 individuals on migration and < c.1,000 wintering individuals in Taiwan; < c.100,000 breeding pairs and < c.1,000 individuals on migration in Korea; c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black-browed reed warbler

The black-browed reed warbler (Acrocephalus bistrigiceps) is a species of marsh-warbler (family Acrocephalidae). It was formerly included in the "Old World warbler" assemblage. It is found in Cambodia, China, Hong Kong, India, Indonesia, Japan, North Korea, South Korea, Laos, Malaysia, Mongolia, Myanmar, Nepal, Philippines, Russia, Singapore, Taiwan, Thailand, and Vietnam.

The black-browed reed warbler is similar and closely related to the more common and widespread Eurasian reed warbler. The bird spends its time foraging close to the ground inside undisturbed reed beds. Like many other wetland birds, it is of conservation concern owing to habitat loss-destruction of native marsh vegetation and its replacement by rice paddies and fishponds.[2]

Footnotes[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!