Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Overview

Distribution

Geographic Range

Great reed warblers are migratory. Beginning in April and through the summer months, great reed warblers are found in northern Europe, especially the southern central region of Sweden. During the rest of the year, they migrate to the tropical regions of western Africa.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Gale Group. 2002. Great Reed Warbler. Pp. 17 in M Hutchins, J Jackson, W Bock, D Olendorf, eds. Grizmek's Animal Life Encyclopedia, Vol. 11/4, 2 Edition. Farmington Hills, MI: Gale Group.
  • Hansson, B., S. Bensch, D. Hasselquist. 2004. Lifetime fitnes of short- and long-distance dispersing great reed warblers. Evolution, 58/11: 2546-2557. Accessed May 07, 2009 at http://www.bioone.org/doi/full/10.1554/04-083.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Physical Description

Morphology

Physical Description

Great reed warblers are one of the larger warblers with masses of 21 to 51 grams and a typical length of 20 centimeters. The wings are long and rather pointed at the end. They have a brown color above and a whiter shade on the underbelly.

Range mass: 21 to 51 g.

Range length: 19 to 20 cm.

Average wingspan: 26 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great reed warblers are typically found near water, swamps and streams, in reed beds and other vegetation.

Range elevation: 200 to 700 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds

Wetlands: marsh ; swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Great reed warblers have a varied, mainly carnivorous diet. They usually eat insects and spiders. Some fruits are eaten in the non-breeding season. They have also been observed eating snails, small fish, and frogs. Male warblers bring food to nesting females.

Animal Foods: amphibians; fish; insects; terrestrial non-insect arthropods; mollusks

Plant Foods: fruit

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Great reed warblers impact their ecosystem by dispersing seeds and eating insects. Their nests are sometimes parasitized by common cuckoos (Cuculus canorus). They are susceptible to plasmodium infection.

Ecosystem Impact: disperses seeds; creates habitat

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Great reed warblers emit alarm calls when they detect predators, such as marsh harriers. Bitterns and water rails are predators of eggs and nestlings. Other predators are not known. Great reed warblers are vigilant against predators and their cryptic coloration may help avoid predation.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Males sing songs of two varieties, one for attraction of females and the other for defending their territory. The mate attraction song lasts around four seconds. The territorial defense call is about one second in length. With these short territorial defense calls they are able to warn off other males without interrupting their other calls.

Communication Channels: acoustic

  • Price, T. 2008. Speciation in Birds. Greenwood Village, CO: Roberts & Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little information is available on the lifespan of great reed warblers. They may live an average of 2.4 years in the wild.

Average lifespan

Status: wild:
2.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Many male great reed warblers are monogamous and polygynous. Females choose their mate partially on the quality of their territory, males with high quality territories tend to be polygynous. Females tend to choose territories in accordance with food abundance and based on nest site quality. Attractive territories also have less risk of nest predation. Males with lower quality nesting territories are monogamous or fail to mate. Polygynous males provide less parental care. Males also warn females by giving alarm calls when predators approach.Females also choose mates based on their song repertoire, which predicts reproductive success. Hasselquist et al. (1996) noted that females copulate with males other than their first mate only when that male has a greater song repertoire, resulting in extra-pair copulations. By engaging in extra-pair copulation, females are seeking benefits for their offspring since the fledgling survival is positively related to the father's song repertoire size.

Mating System: monogamous ; polygynous

Great reed warblers breed from early April through August in northern Europe and during the winter in parts of Africa. An average of three to six eggs per season are laid. Nestlings hatch after 14 days of incubation. Great reed warblers mate in reed beds of marshes and lakes.

Breeding interval: Great reed warblers breed seasonally, number of clutches attempted per breeding season is not reported.

Breeding season: Breeding occurs from April to early August in Europe and in the winter in parts of Africa.

Range eggs per season: 3 to 6.

Average time to hatching: 14 days.

Average fledging age: 9 days.

Average time to independence: 2 weeks.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females are responsible for building the nest and provide most of the parental care. The main contribution from the males is in protection of the nesting area from predators. Polygynous males help provide food for the offspring only for his first mate. Secondary mates must provide for their offspring on their own. Monogamous males provide food for the offspring.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acrocephalus arundinaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTAATCTTTGGCGCATGAGCCGGAATAGTAGGTACCGCCCTTAGCCTTCTCATTCGAGCAGAACTAGGCCAACCCGGCGCTCTCTTAGGAGACGACCAGGTGTACAATGTGGTCGTTACAGCCCACGCATTCGTAATAATCTTCTTTATAGTCATACCAATCATAATCGGAGGATTCGGAAACTGACTGGTGCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCACCCTCATTCCTACTACTATTAGCCTCATCAACAGTTGAAGCAGGGGCAGGAACCGGTTGGACCGTGTACCCCCCACTGGCCGGTAACTTAGCCCACGCTGGAGCTTCCGTCGACCTAGCCATCTTCTCCCTCCACCTAGCAGGGATCTCATCAATCCTAGGGGCAATTAACTTCATCACAACAGCCATCAACATAAAACCACCTGCTCTGTCTCAGTACCAAACCCCCCTATTCGTCTGATCAGTCCTGATCACCGCAGTACTACTTCTCCTATCCCTTCCAGTTCTAGCCGCTGGAATCACAATACTACTAACCGATCGCAACCTCAACACCACCTTCTTCGACCCTGCAGGAGGAGGAGATCCTGTACTCTATCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acrocephalus arundinaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Assessed in 2008, IUCN classifies great reed warblers as "least concern." The IUCN estimates a population size of 2,900,000 to 5,700,000 individuals.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 1500000-2900000 breeding pairs, equating to 4500000-8700000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 9180000-34800000 individuals, although further validation of this estimate is needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of great reed warblers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Great reed warblers are appreciated by bird enthusiasts for their songs and mimicry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great Reed Warbler

The Great Reed Warbler (Acrocephalus arundinaceus) is a Eurasian passerine in the genus Acrocephalus. It used to be placed in the "Old World Warbler" assemblage, but is now recognized as part of the marsh and tree-warbler family (Acrocephalidae). A. arundinaceus are medium-sized birds and are the largest of the European warblers. They breed throughout mainland Europe and Asia and migrate to sub-Saharan Africa in the winter. Great reed warblers favor reed beds as their habitat during breeding months, while living in reed beds, bush thickets, rice fields, and forest clearings during the winter. Great reed warblers exhibit relatively low sexual dimorphism, and both genders of the species are similar in appearance. This species mates both polygynously and monogamously.

Description[edit]

The thrush-sized warbler is one of the largest species of Old World Warbler. It measures 16–21 cm (6.3–8.3 in) in length, 25 to 30 cm (9.8 to 11.8 in) in wingspan and weighs 22 to 38 g (0.78 to 1.34 oz).[2][3][4] The adult has unstreaked brown upperparts and dull buffish-white chin and underparts. The forehead is flattened, and the bill is strong and pointed. It looks very much like a giant Eurasian Reed Warbler (A. scirpaceus), but with a stronger supercilium.

The sexes are identical, as with most old world warblers, but young birds are richer buff below.

The warbler's song is very loud and far-carrying. The song's main phrase is a chattering and creaking carr-carr-cree-cree-cree-jet-jet, to which the whistles and vocal mimicry typical of marsh warblers are added.

Distribution and ecology[edit]

Nest with clutch of eggs

A. arundinaceus breeds in Europe and westernmost temperate Asia. It does not breed in Great Britain, but is a regular visitor. Its population has in recent decades increased around the eastern Baltic Sea, while it has become rarer at the western end of its range. It is a migratory bird, wintering in tropical Africa. This bird migrates north at a rather late date, and some birds remain in their winter quarters until the end of April.[1][5][6]

While there are no subspecies of this bird, mtDNA haplotype data indicate that during the last glacial period there were two allopatric populations of A. arundinaceus. The Great Reed Warblers in southwestern and southeastern Europe were at that time apparently separated by the Vistulian-Würm ice sheets and the surrounding barren lands. Though the data are insufficient to robustly infer a date for this separation, it suggests the populations became separated around 80,000 years ago – coincident with the first major advance of the ice sheets. The populations must have expanded their range again at the start of the Holocene about 13,000 years ago, but even today the western birds winter in the west and the eastern birds in the east of tropical Africa.[6]

Male warbler declaring his territory

This passerine bird is found in large reed beds, often with some bushes. On their breeding grounds, they are territorial. In their winter quarters, they are frequently found in large groups, and may occupy a reed bed to the exclusion of other birds.[5] Like most warblers, it is insectivorous, but it will take other prey items of small size, including vertebrates such as tadpoles.

The Great Reed Warbler undergoes marked long-term population fluctuations, and it is able to expand its range quickly when new habitat becomes available. This common and widespread bird is considered a Species of Least Concern by the IUCN.[1][6]

Behavior[edit]

Diet[edit]

A. arundinacius has a primarily carnivorous diet. Observation of prey collection specifically during breeding season has shown the retrieval of insect larvae, moths, dragonflies, damselflies, beetles, spiders, small fish, and frogs.[7] A. arundinacius has also been reported to eat fruit during non-breeding seasons.[8] Nestlings typically feed on diptera and arachnids, though this may not be their preferred food.[9]

Communication and courtship[edit]

Song, recorded at Diaccia Botrona marsh (Italy)

Male great reed warblers have been observed to communicate via two basic song types: short songs about one second in length with few syllables, and long songs of about four seconds that have more syllables and are louder than the short variety. It has been observed that long songs are primarily used by males to attract females; long songs are only given spontaneously by unpaired males, and cease with the arrival of a female. Short songs, however, are primarily used in territorial encounters with rival males.[10]

During experimental observation, male great reed warblers showed reluctance to approach recordings of short songs, and when lured in by long songs, would retreat when playback was switched to short songs.[10]

Traditionally, monogamous species of genus Acrocephalus use long, variable, and complex songs to attract mates, whereas polygynous varieties use short, simple, stereotypical songs for territorial defense. There is evidence that long songs have been evolved through intersexual selection, whereas short songs have been evolved through intrasexual selection. “A. arundinaceus” is a notable example of these selective pressures, as it is a partial polygynist and has evolved variable song structure (both long and short) through evolutionary compromise.[10]

In addition to communication, the great reed warbler’s song size has been implicated in organism fitness and reproductive success. Though no direct relationship has been found between song size and either territory size or beneficial male qualities, such as wing length, weight, or age, strong correlation has been observed between repertoire size and territory quality. Furthermore, partial correlation analysis has shown that territory quality has significant effect on number of females obtained, while repertoire length is linked to the number of young produced.[11]

Mating system and sexual behavior[edit]

Great Reed Warbler eggs

A. arundinaceus females lay 3–6 eggs in a basket nest in reeds. Some pairs of warblers are monogamous, but others are not, and unpaired, territory-less males still father some young.[12]

A long-term study of the factors that contribute to male fitness examined the characteristics of males and territories in relation to annual and lifetime breeding success. It showed that the arrival order of the male was the most significant factor for predicting pairing success, fledgling success, and number of offspring that survive. It also found that arrival order was closely correlated with territory attractiveness rank. Females seem to prefer early arriving males that occupy more attractive territories. These females also tend to gain direct benefits through the increased production of fledglings and offspring that become adults. In addition, male song repertoire length is positively correlated to annual harem size and overall lifetime production of offspring that survive. Song repertoire size alone is able to predict male lifetime number of surviving offspring. Females tend to be attracted to males with longer song repertoires since they tend to sire offspring with improved viability. In doing so, they gain indirect benefits for their own young.[13][14]

Great Reed Warblers have a short, polygynous breeding cycle in which the male contributes little to parental care. They defend large territories in reed beds where there is reduced visibility, which may allow males to practice deception by moving and attracting a second female. This second female may not realize that the male has already mated. Polygyny of the Great Reed Warbler was assessed in another study that showed the importance of female choice. The differences in territory characteristics seemed to be more important. However, there is also a strong correlation between male and their territory characteristics. Models based on the polygyny threshold and sexy son hypotheses predict that females should gain evolutionary advantage in either short-term or long-term in this mating system, yet the study did not support this. The data showed that secondary females had greatly reduced breeding success.[15][16]

References[edit]

  1. ^ a b c BirdLife International (2012). "Acrocephalus arundinaceus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Acrocephalus arundinaceus (Linnaeus, 1758)". 
  3. ^ Josep del Hoyo, Andrew Elliott, Jordi Sargatal, ed. (1996). Handbook of the Birds of the World (3 ed.). Barcelona: Lynx Edicions. ISBN 84-87334-20-2. 
  4. ^ Stevenson, Terry; John Fanshawe (2001). Field Guide to the Birds of East Africa: Kenya, Tanzania, Uganda, Rwanda, Burundi. Princeton University Press. ISBN 978-0856610790. 
  5. ^ a b Traylor, Marvin; Daniel Parelius (13 November 1967). "A Collection of Birds from the Ivory Coast". Fieldiana Zoology 51 (7): 91–117. 
  6. ^ a b c Bensch, Staffan; Dennis Hasselquist (1 February 1999). "Phylogeographic population structure of great reed warblers: an analysis of mtDNA control region sequences". Biological Journal of the Linnean Society 66 (2): 171–185. doi:10.1111/j.1095-8312.1999.tb01882.x. 
  7. ^ Ezaki, Yasuo (1 April 1992). "Importance of communal foraging grounds outside the reed marsh for breeding great reed warblers". Ecological Research 7 (1): 63–70. doi:10.1007/BF02348598. 
  8. ^ Grzimek, Bernhard (2002). Hutchins, Jackson, Bock, Olendorf, ed. Grzimek's Animal Life Encyclopedia, Vol. 11.4 (2 ed.). Farmington Hills, MI: Gale Group. p. 17. 
  9. ^ Dyrcz, Andrzej; Flinks, Heiner (1 July 2000). "Potential food resources and nestling food in the Great Reed Warbler (Acrocephalus arundinaceus arundinaceus) and Eastern Great Reed Warbler (Acrocephalus arundinaceus orientalis)". Journal für Ornithology 141 (3): 351–360. doi:10.1007/BF02462245. 
  10. ^ a b c Catchpole, Clive K. (1 November 1983). "Variation in the song of the great reed warbler Acrocephalus arundinaceus in relation to mate attraction and territorial defence". Animal Behaviour 31 (4): 1217–1225. doi:10.1016/S0003-3472(83)80028-1. 
  11. ^ Catchpole, Clive K. (1 December 1986). "Song repertoires and reproductive success in the great reed warbler Acrocephalus arundinaceus". Behavioral Ecology and Sociobiology 19 (6): 439–445. doi:10.1007/BF00300547. 
  12. ^ Leisler, B.; M. Wink (1 July 2000). "Frequencies of multiple paternity in three Acrocephalus species (Aves Sylviidae) with different mating systems (A. palustris, A. arundinaceus, A. paludicola)". Ethology Ecology & Evolution 12 (3): 237–249. doi:10.1080/08927014.2000.9522798. 
  13. ^ Catchpole, Clive; Bernd Leisler; Hans Winkler (1 March 1985). "Polygyny in the great reed warbler, Acrocephalus arundinaceus: a possible case of deception". Behavioral Ecology and Sociobiology 16 (3): 285–291. doi:10.1007/BF00310992. 
  14. ^ Hasselquist, Dennis (1 October 1998). "Polygyny in Great Reed Warblers: a long-term study of factors contributing to male fitness". Ecology 79 (7): 2376–2390. doi:10.1890/0012-9658(1998)079[2376:PIGRWA]2.0.CO;2. 
  15. ^ Bensch, Staffan; Dennis Hasselquist (October 1991). "Territory Infidelity in the Polygynous Great Reed Warbler Acrocephalus arundinaceus: The Effect of Variation in Territory Attractiveness". Journal of Animal Ecology 60 (3): 857–871. 
  16. ^ Hasselquist, Dennis; Staffan Bensch, Torbjörn von Schantz (1 January 1995). "Low frequency of extrapair paternity in the polygynous great reed warbler, Acrocephalus arundinaceus". Behavioral Ecology 6 (1): 27–38. doi:10.1093/beheco/6.1.27. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!