Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Overview

Distribution

Great reed warblers are migratory. Beginning in April and through the summer months, great reed warblers are found in northern Europe, especially the southern central region of Sweden. During the rest of the year, they migrate to the tropical regions of western Africa.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Gale Group. 2002. Great Reed Warbler. Pp. 17 in M Hutchins, J Jackson, W Bock, D Olendorf, eds. Grizmek's Animal Life Encyclopedia, Vol. 11/4, 2 Edition. Farmington Hills, MI: Gale Group.
  • Hansson, B., S. Bensch, D. Hasselquist. 2004. Lifetime fitnes of short- and long-distance dispersing great reed warblers. Evolution, 58/11: 2546-2557. Accessed May 07, 2009 at http://www.bioone.org/doi/full/10.1554/04-083.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Physical Description

Morphology

Great reed warblers are one of the larger warblers with masses of 21 to 51 grams and a typical length of 20 centimeters. The wings are long and rather pointed at the end. They have a brown color above and a whiter shade on the underbelly.

Range mass: 21 to 51 g.

Range length: 19 to 20 cm.

Average wingspan: 26 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great reed warblers are typically found near water, swamps and streams, in reed beds and other vegetation.

Range elevation: 200 to 700 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds

Wetlands: marsh ; swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Great reed warblers have a varied, mainly carnivorous diet. They usually eat insects and spiders. Some fruits are eaten in the non-breeding season. They have also been observed eating snails, small fish, and frogs. Male warblers bring food to nesting females.

Animal Foods: amphibians; fish; insects; terrestrial non-insect arthropods; mollusks

Plant Foods: fruit

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Great reed warblers impact their ecosystem by dispersing seeds and eating insects. Their nests are sometimes parasitized by common cuckoos (Cuculus canorus). They are susceptible to plasmodium infection.

Ecosystem Impact: disperses seeds; creates habitat

Commensal/Parasitic Species:

  • Plasmodium ashfordi
  • common cuckoos (Cuculus canorus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great reed warblers emit alarm calls when they detect predators, such as marsh harriers. Bitterns and water rails are predators of eggs and nestlings. Other predators are not known. Great reed warblers are vigilant against predators and their cryptic coloration may help avoid predation.

Known Predators:

  • western marsh harriers (Circus aeruginosus)
  • water rails (Rallus aquaticus)
  • bitterns (Botaurinae)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males sing songs of two varieties, one for attraction of females and the other for defending their territory. The mate attraction song lasts around four seconds. The territorial defense call is about one second in length. With these short territorial defense calls they are able to warn off other males without interrupting their other calls.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Price, T. 2008. Speciation in Birds. Greenwood Village, CO: Roberts & Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little information is available on the lifespan of great reed warblers. They may live an average of 2.4 years in the wild.

Average lifespan

Status: wild:
2.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Many male great reed warblers are monogamous and polygynous. Females choose their mate partially on the quality of their territory, males with high quality territories tend to be polygynous. Females tend to choose territories in accordance with food abundance and based on nest site quality. Attractive territories also have less risk of nest predation. Males with lower quality nesting territories are monogamous or fail to mate. Polygynous males provide less parental care. Males also warn females by giving alarm calls when predators approach.Females also choose mates based on their song repertoire, which predicts reproductive success. Hasselquist et al. (1996) noted that females copulate with males other than their first mate only when that male has a greater song repertoire, resulting in extra-pair copulations. By engaging in extra-pair copulation, females are seeking benefits for their offspring since the fledgling survival is positively related to the father's song repertoire size.

Mating System: monogamous ; polygynous

Great reed warblers breed from early April through August in northern Europe and during the winter in parts of Africa. An average of three to six eggs per season are laid. Nestlings hatch after 14 days of incubation. Great reed warblers mate in reed beds of marshes and lakes.

Breeding interval: Great reed warblers breed seasonally, number of clutches attempted per breeding season is not reported.

Breeding season: Breeding occurs from April to early August in Europe and in the winter in parts of Africa.

Range eggs per season: 3 to 6.

Average time to hatching: 14 days.

Average fledging age: 9 days.

Average time to independence: 2 weeks.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Females are responsible for building the nest and provide most of the parental care. The main contribution from the males is in protection of the nesting area from predators. Polygynous males help provide food for the offspring only for his first mate. Secondary mates must provide for their offspring on their own. Monogamous males provide food for the offspring.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acrocephalus arundinaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTAATCTTTGGCGCATGAGCCGGAATAGTAGGTACCGCCCTTAGCCTTCTCATTCGAGCAGAACTAGGCCAACCCGGCGCTCTCTTAGGAGACGACCAGGTGTACAATGTGGTCGTTACAGCCCACGCATTCGTAATAATCTTCTTTATAGTCATACCAATCATAATCGGAGGATTCGGAAACTGACTGGTGCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCACCCTCATTCCTACTACTATTAGCCTCATCAACAGTTGAAGCAGGGGCAGGAACCGGTTGGACCGTGTACCCCCCACTGGCCGGTAACTTAGCCCACGCTGGAGCTTCCGTCGACCTAGCCATCTTCTCCCTCCACCTAGCAGGGATCTCATCAATCCTAGGGGCAATTAACTTCATCACAACAGCCATCAACATAAAACCACCTGCTCTGTCTCAGTACCAAACCCCCCTATTCGTCTGATCAGTCCTGATCACCGCAGTACTACTTCTCCTATCCCTTCCAGTTCTAGCCGCTGGAATCACAATACTACTAACCGATCGCAACCTCAACACCACCTTCTTCGACCCTGCAGGAGGAGGAGATCCTGTACTCTATCAACACCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acrocephalus arundinaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5