Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acrocephalus aedon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCTTAAGCCTTCTCATCCGAGCAGAACTAGGACAACCCGGCGCTCTCCTAGGAGACGACCAAGTATACAACGTGATCGTCACCGCCCACGCATTCGTTATAATTTTCTTTATAGTGATACCAATTATGATTGGAGGGTTCGGAAACTGACTAGTTCCACTTATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGTTTTTGACTACTCCCACCCTCATTCCTACTACTACTAGCCTCATCAACAGTAGAAGCAGGAGCAGGAACAGGCTGAACCGTATACCCACCCTTAGCCGGCAACCTAGCCCACGCTGGGGCCTCAGTCGACCTGGCCATCTTCTCCCTACACCTAGCAGGCATCTCATCAATCCTAGGAGCAATCAACTTCATTACAACAGCCATCAACATAAAACCACCCGCCCTATCCCAATACCAAACCCCTCTATTCGTTTGATCAGTCCTAATCACCGCAGTGCTCCTCCTCCTATCTCTACCCGTTCTCGCTGCCGGCATTACAATACTACTCACTGATCGCAACCTCAACACCACCTTCTTCGACCCTGCAGGAGGAGGCGACCCAGTACTCTATCAACAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acrocephalus aedon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as generally uncommon, although common in the Amur and Ussuri river valleys and common during its non-breeding season in South-East Asia and the Indian Subcontinent (del Hoyo et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thick-billed Warbler

The Thick-billed Warbler (Iduna aedon) is an Old World warbler that breeds in temperate east Asia. It is migratory, wintering in tropical south east Asia. It is a very rare vagrant to western Europe.

This passerine bird is a species found in dense vegetation such as reeds, bushes and thick undergrowth. 5-6 eggs are laid in a nest in a low tree.

This is a large warbler, at 16-17.5 cm long nearly as big as Great Reed Warbler. The adult has an unstreaked brown back and buff underparts, with few obvious distinctive plumage features. The forehead is rounded, and the bill is short and pointed. The sexes are identical, as with most warblers, but young birds are richer buff below. Like most warblers, it is insectivorous, but will take other small prey items.

The song is fast and loud, and similar to Marsh Warbler, with much mimicry and typically acrocephaline whistles added.

It was sometimes placed in the monotypic genus Phragmaticola (or Phragamaticola) and for a long time as Acrocephalus and in 2009 found to belong to the Iduna clade.[2]

References

  1. ^ BirdLife International (2004). Acrocephalus aedon. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006.
  2. ^ Silke Fregin, Martin Haase,Urban Olsson,Per Alström (2009). "Multi-locus phylogeny of the family Acrocephalidae (Aves: Passeriformes) – The traditional taxonomy overthrown". Molecular Phylogenetics and Evolution 52 (3): 866–878. doi:10.1016/j.ympev.2009.04.006. PMID 19393746. 
  • Fregin, S., M. Haase, U. Olsson, and P. Alström. 2009. Multi-locus phylogeny of the family Acrocephalidae (Aves: Passeriformes) - the traditional taxonomy overthrown. Molecular Phylogenetics and Evolution 52: 866-878.
  • Sangster, G., J.M. Collinson, P.-A. Crochet, A.G. Knox, D.T. Parkin, L. Svensson, and S.C. Votier. 2011. Taxonomic recommendations for British birds: seventh report. Ibis 153: 883-892.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!