Articles on this page are available in 1 other language: Chinese (Simplified) (8) (learn more)

Overview

Distribution

Range

Breeds e Palearctic; winters to India and Sri Lanka.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippolais caligata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTGTACCTAATTTTCGGCGCATGAGCAGGAATAGTAGGCACCGCCCTAAGCCTCCTCATTCGAGCAGAGCTAGGTCAACCCGGTGCCCTTTTAGGAGATGACCAAGTATACAACGTAGTCGTCACAGCCCATGCATTTGTGATAATCTTCTTTATAGTTATGCCAATCATGATCGGGGGATTCGGAAACTGACTGGTCCCTCTAATAATTGGAGCCCCAGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCACCCTCTTTCCTACTGCTACTAGCTTCATCAACAGTTGAAGCAGGGGCGGGGACAGGTTGAACTGTATACCCTCCCCTAGCTGGCAATCTAGCCCATGCCGGAGCTTCAGTAGACCTGGCCATCTTCTCTCTTCACCTAGCAGGTATTTCATCAATCCTAGGTGCAATCAACTTCATCACAACAGCCATCAACATAAAACCACCTGCCCTATCCCAATACCAAACCCCCCTGTTCGTCTGATCCGTCCTAATCACTGCGGTATTACTACTTCTATCCCTACCAGTACTCGCTGCCGGCATCACAATGCTGCTCACCGACCGCAATCTCAACACCACCTTCTTTGACCCCGCAGGTGGCGGAGACCCAGTCCTCTACCAGCACCTCTTCTGATTCTTCGGTCATCCAGAAGTATATATCCTAATCCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippolais caligata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 30,000-80,000 breeding pairs, equating to 90,000-240,000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Booted warbler

Eggs of Iduna caligata MHNT

The booted warbler (Iduna caligata) is an Old World warbler in the tree warbler group. It was formerly considered to be conspecific with Sykes's warbler, but the two are now usually both afforded species status.[1] Booted warbler itself breeds from central Russia to western China, and migrates to winter in the Indian subcontinent as far south as Sri Lanka. It is a small passerine bird, found in open country with bushes and other tall vegetation. 3-4 eggs are laid in a nest in a bush or vegetation. Like most warblers they are insectivorous.

These are small warblers, especially compared to others in their genus. They are pale brown (weak tea colour) above and whitish below with buff flanks. The outer tail feathers have pale edges. They have a short pale supercilium, and the bill is strong and pointed. Sykes's is larger and greyer than booted, and most resembles an eastern olivaceous warbler.

References[edit]

  1. ^ Silke Fregin, Martin Haase,Urban Olsson,Per Alström (2009). "Multi-locus phylogeny of the family Acrocephalidae (Aves: Passeriformes) – The traditional taxonomy overthrown". Molecular Phylogenetics and Evolution 52 (3): 866–878. doi:10.1016/j.ympev.2009.04.006. PMID 19393746. 
  • Fregin, S., M. Haase, U. Olsson, and P. Alström. 2009. Multi-locus phylogeny of the family Acrocephalidae (Aves: Passeriformes) - the traditional taxonomy overthrown" Molecular Phylogenetics and Evolution 52: 866-878.
  • Sangster, G., J.M. Collinson, P.-A. Crochet, A.G. Knox, D.T. Parkin, L. Svensson, and S.C. Votier. 2011. Taxonomic recommendations for British birds: seventh report. Ibis 153: 883-892.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!