Articles on this page are available in 1 other language: Chinese (Simplified) (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippolais caligata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTGTACCTAATTTTCGGCGCATGAGCAGGAATAGTAGGCACCGCCCTAAGCCTCCTCATTCGAGCAGAGCTAGGTCAACCCGGTGCCCTTTTAGGAGATGACCAAGTATACAACGTAGTCGTCACAGCCCATGCATTTGTGATAATCTTCTTTATAGTTATGCCAATCATGATCGGGGGATTCGGAAACTGACTGGTCCCTCTAATAATTGGAGCCCCAGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCACCCTCTTTCCTACTGCTACTAGCTTCATCAACAGTTGAAGCAGGGGCGGGGACAGGTTGAACTGTATACCCTCCCCTAGCTGGCAATCTAGCCCATGCCGGAGCTTCAGTAGACCTGGCCATCTTCTCTCTTCACCTAGCAGGTATTTCATCAATCCTAGGTGCAATCAACTTCATCACAACAGCCATCAACATAAAACCACCTGCCCTATCCCAATACCAAACCCCCCTGTTCGTCTGATCCGTCCTAATCACTGCGGTATTACTACTTCTATCCCTACCAGTACTCGCTGCCGGCATCACAATGCTGCTCACCGACCGCAATCTCAACACCACCTTCTTTGACCCCGCAGGTGGCGGAGACCCAGTCCTCTACCAGCACCTCTTCTGATTCTTCGGTCATCCAGAAGTATATATCCTAATCCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippolais caligata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 30,000-80,000 breeding pairs, equating to 90,000-240,000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!