Molecular Biology and Genetics

Molecular Biology

Barcode data: Triatoma brasiliensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTAGATGATTAATTCGAATTGAACTAGGACAACCCGGATCCTTTATTGGAGAT---GATCAAATCTATAACGTTGTTGTCACAGCCCATGCTTTCATTATAATTTTCTTCATAGTTATACCAATCATAATCGGAGGATTCGGAAACTGATTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGTATAAATAACATAAGATTCTGACTATTACCCCCAGCCTTAACCTTACTCCTTATAAGAAGTTTGGTAGAAAGCGGAGCAGGGACAGGATGAACAGTATACCCGCCCTTATCAAGTAATATCGCCCACAGAGGAGCATCTGTTGACCTAGCAATCTTTTCTCTTCACTTAGCAGGTGTATCCTCCATCCTCGGGGCTGTAAACTTCATTTCAACTATCATTAATATACGACCTGAAGGAATGCGGCCAGACCGAATCCCCTTATTCGTATGATCAGTTGGCATTACTGCCTTACTCCTGCTTTTAAGACTCCCAGTTCTTGCTGGAGCAATTACCATATTACTTACTGACCGAAACTTCAATACTTCATTCTTCGACCCAGCTGGGGGAGGAGATCCTATTCTTTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTCTACATTCTAATTCTCCCAGGCTTTGGACTAATTTCCCATATTATTGCTATAGAAACAGGAAAAAATGAAGCATTTGGATCCCTAGGAATAATTTATGCTATACTAGCAATTGGCTTACTAGGGTTTATTGTCTGAGCTCATCATATATTCACAGTAGGAATAGACGTAGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Triatoma brasiliensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Triatoma brasiliensis

Triatoma brasiliensis Neiva, 1911 is now considered the most important Chagas disease vector in the semiarid areas of northeastern Brazil.[1] T. brasiliensis occurs in 12 Brazilian states, including Maranhão, Piauí, Ceará, Rio Grande do Norte, and Paraíba.

T. brasiliensis is native to this part of Brazil, and thus persists in the natural environment. This makes control problematic (see below).

Control[edit source | edit]

The control strategies against this vector are very complex due to its capacity to infest natural and artificial environments presenting high levels of population density.



References[edit source | edit]

  1. ^ Costa J, Peterson AT, Beard CB (2002) Ecologic niche modeling and differentiation of populations of Triatoma brasiliensis Neiva, 1911, the most important Chagas' disease vector in northeastern Brazil (hemiptera, reduviidae, triatominae). Am J Trop Med Hyg 67:516-20
  • Costa J, Almeida CE, Dotson EM, Lins A, Vinhaes M, Silveira AC, Beard CB 2003a. The epidemiologic importance of Triatoma brasiliensis as a Chagas disease vector in Brazil: a revision of domiciliary captures during 1993-1999. Mem Inst Oswaldo Cruz 98: 443-449.
  • Costa J, Almeida CE, Dujardin JP, Beard CB 2003b. Crossing experiments detect genetic incompatibility among populations of Triatoma brasiliensis Neiva, 1911 (Heteroptera, Reduviidae, Triatominae). Mem Inst Oswaldo Cruz 98: 637-639.
  • Lent H, Wygodzinsky P (1979) Revision of the Triatominae (Hemiptera, Reduviidae), and their significance as vectors of Chagas disease. Bull Am Mus Nat Hist 163:123–520.
  • Diotaiuti L, Faria-Filho OF, Carneiro FC, Dias JC, Pires HH, Schofield CJ 2000. Aspectos operacionais do controle de Triatoma brasiliensis. Cad Saúde Pública 16 (Supl. 2): 61-67.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!