Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Passer hispaniolensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNATCTTCGGCGCATGAGCCGGAATAGTAGGTACCGCTCTAAGCTTACTTATCCGAGCAGAGCTTGGACAACCAGGGGCTCTCCTAGGAGATGACCAAGTTTATAACGTAGTTGTCACAGCCCATGCTTTCGTGATAATCTTCTTCATAGTCATGCCAATTATAATTGGGGGATTCGGAAACTGACTAGTCCCACTAATAATTGGAGCACCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCCTCCTGCTACTAGCATCCTCCACTGTAGAAGCGGGGGCCGGCACCGGATGAACAGTATACCCCCCTCTAGCCGGCAACCTGGCCCACGCCGGAGCCTCAGTAGACCTAGCAATCTTCTCCCTGCACTTGGCAGGTATTTCTTCAATCTTAGGAGCAATCAACTTCATTACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACACCCCTATTCGTATGATCAGTCCTAATCACCGCAGTACTACTGCTCCTGTCGCTACCAGTTCTTGCTGCAGGAATTACAATACTACTCACCGACCGCAACCTCAACACCACATTCTTCGACCCCGCAGGAGGAGGAGATCCAGTCCTATACCAACATCTCTTCTGATTCTTCGGCCATCCAGAAGTCTACATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Passer hispaniolensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 2800000-6200000 breeding pairs, equating to 8400000-18600000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 17100000-74400000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spanish Sparrow

The Spanish Sparrow or Willow Sparrow (Passer hispaniolensis) is a passerine bird of the sparrow family Passeridae. It is found in the Mediterranean region and southwest and central Asia. It is very similar to the closely related House Sparrow, and the two species show their close relation in a "biological mix-up" of hybridisation in the Mediterranean region, which complicates the taxonomy of this species.

Contents

Description [edit]

Female in the Canary Islands

The Spanish Sparrow is a rather large sparrow, at 15–16 cm (5.9–6.3 in) in length, and 22–36 g (0.8–1.3 oz) in weight. It is slightly larger and heavier than House Sparrows, and also has a slightly longer and stouter bill.[2] The male is similar to the House Sparrow in plumage, but differs in its underparts heavily streaked with black, a chestnut rather than grey crown, and white rather than grey cheeks.[3][4][5][6] The female is effectively inseparable from House Sparrow in its plumage, which is grey-brown overall but more boldly marked. The female has light streaking on its sides, a pale cream supercilium, and broad cream streaks on its back.[7][8]

The two subspecies differ little in worn breeding plumage, but both sexes are quite distinct in fresh winter plumage, with the eastern subspecies P. h. transcaspicus paler with less chestnut.[7]

Voice [edit]

Sonogram of a male Spanish Sparrow's song

The Spanish Sparrow's vocalisations are similar to those of the House Sparrow. The male gives a call somewhat different from that of the House Sparrow when displaying at its nest. This call is a pair of strident, disyllabic chirps, similar to those of the House Sparrow, but louder and high-pitched, transcribed as chweeng-chweeng, cheela-cheeli. A similar call, softer and more like the House Sparrow's tschilp, is used by birds arriving or departing at roosting sites. The Spanish Sparrow's other calls are almost the same as those of the House Sparrow. A soft quer quer quer is given at the nest by mated pairs, a quer-it flight call is given by flocking birds, and a chur-chur-it call is given as a threat.[9]

Taxonomy and systematics [edit]

An illustration by John Gould of a male Spanish Sparrow (above) and an Italian Sparrow pair

The Spanish Sparrow is a close relative of the House Sparrow in the genus Passer and the sparrow family Passeridae.[10] Its taxonomy is greatly complicated by the "biological mix-up" it forms with the House Sparrow in the Mediterranean. In most of the Mediterranean, one or both of the two species occurs, with only a limited degree of hybridisation. On the Italian Peninsula and Corsica, the two species are replaced by the Italian Sparrow, a puzzling type of sparrow apparently intermediate between the Spanish Sparrow and the House Sparrow.[2][11]

The Italian Sparrow has been classified as a hybrid with the House Sparrow, the same species as the Spanish Sparrow, the same species as the House Sparrow, and as a separate species. The Spanish Sparrow also hybridises freely with House Sparrow in parts of northern Africa (northeastern Algeria, Tunisia, and northwestern Libya), forming highly variable mixed populations with a full range of characters from pure House Sparrow to pure Spanish Sparrow.[2][11] On the Mediterranean islands of Malta, Gozo, Crete, Rhodes, and Karpathos, there are more apparently intermediate birds of unknown status.[12]

Phylogenetic studies of nuclear mitochondrial DNA pseudogenes show that the House Sparrow is closely related genetically to the Italian Sparrow but not the Spanish Sparrow.[10][13]

The Spanish Sparrow was first described by the Dutch zoologist Coenraad Jacob Temminck as Fringilla hispaniolensis, from a specimen collected at Algeciras, in southern Spain. The usual English name refers to the description of the species from Spain. The name "Willow Sparrow", referring to the moist habitat of this bird, is sometimes used, especially when the Italian Sparrow is considered the same species.[11][14]

Two subspecies of Spanish Sparrow are usually recognised, the western nominate subspecies hispaniolensis, and the eastern transcaspicus, described by Austrian ornithologist Viktor von Tschusi zu Schmidhoffen in 1902 from Ýolöten, Turkmenistan.[14] Birds in Anatolia and Cyprus are usually considered to belong to P. h. transcaspicus, but birds as far east as Ceylanpınar have been noted as intermediates, and the difference between the two subspecies may be clinal.[15]

Distribution and habitat [edit]

The Spanish Sparrow has a highly complex distribution in the Mediterranean region, Macaronesia, and southwest to central Asia. It breeds mostly in a band of latitude about fifteen degrees wide, from the Danube valley and the Aral Sea in the north to Libya and central Iran in the south.[16] Its range has expanded greatly by natural colonisation over the last two centuries, in the Balkans, where it reached Romania, Serbia, and Moldova from 1950 onwards;[2][17] and in Macaronesia, where its range expansion has been attributed to introductions and travel by ship, but was more likely natural colonisation by migrating birds.[18] Vagrants occur widely, as far north as Scotland and Norway.[2][16]

Distribution of the Spanish and Italian Sparrows

Subspecies hispaniolensis [edit]

A male in Sardinia

The western subspecies hispaniolensis breeds in parts of Iberia and North Africa, some islands, and the Balkans. In Iberia it is uncommon, occurring in the Tagus valley and sporadically in the northern meseta, the eastern coast, and in the Guadalquivir and Guadiana valleys.[16][19] While the House Sparrow and the Spanish Sparrow form a "hybrid swarm" in the eastern half of the Maghreb, they coexist with little hybridisation in the western half.[16][20] In northern Italy and Corsica the Spanish Sparrow is replaced by the Italian Sparrow, and the two intergrade in southern Italy, as well as Malta, Crete, and nearby islands such as Rhodes.[16] The Spanish Sparrow is not known to breed in the Balearic Islands, the Aegean Islands, Corfu, or the Peloponnese, but it occurs on Sardinia, Pantelleria, and smaller islands near the coast. In the Balkans, it occurs patchily from Montenegro across into the Danube valley of Romania and northern Serbia. It is found in mainland Greece and Bulgaria, where it is also uncommon.[16][21][22]

The Spanish Sparrow is likely to have been established on the western Canary Islands for some time, as it was found on Lanzarote when a naturalist first visited the island in 1828. In the 1830s, it was recorded on Fuerteventura, Gran Canaria, and Tenerife and since the 1940s it has reached all the other islands.[16][18] It reached Madeira in May 1935, when numbers of sparrows were found across the island after nine days of strong, continuous easterly winds.[2][18] It seems to have reached Cape Verde around the same time it reached the Canaries, and it was first recorded there on Santiago by Charles Darwin in 1832. From then onwards it reached all the other larger islands, in a poorly recorded extension of its range.[16][18][23]

Subspecies transcaspicus [edit]

A male and a female of the subspecies P. h. transcaspicus, in southeast Turkey

The eastern subspecies transcaspicus breeds from Anatolia and Cyprus through the Middle East and Central Asia to far western China. In the Middle East it breeds through Syria and Lebanon to about as far south as Jerusalem. It breeds in eastern Turkey, but is a very rare breeder in Iraq and Kuwait.[15] It breeds sporadically in Azerbaijan and Dagestan, north to the Terek River valley. In Iran, it breeds in most of the country except the Persian Gulf region, also breeding in central and northern Afghanistan. In Central Asia, it breeds from the regions of the Turkmenistan-Iran and Tajikistan-Afghanistan borders north to parts of the Syr Darya basin in Kazakhstan, and westwards to Lake Alakol, the Karatal River, and a corner of China.[15] Here it has also expanded its range, in the area around Lake Alakol in Kazakhstan, where agriculture was not developed until the 1950s.[24] It winters in the plains of the Indian subcontinent and the Persian Gulf.[15]

Habitat [edit]

A nest in an acacia hedge in Es Sénia, Algeria

In most of its range, the Spanish Sparrow occurs alongside the House Sparrow. In such areas, both species breed in farmland and open woodland, with the Spanish Sparrow preferring moister habitats. In areas where House Sparrows are absent, the Spanish Sparrow may live in urban habitats, as in the Canary Islands, Madeira, and some Mediterranean islands. In a few urban areas, such as those in eastern Sardinia, the primary sparrow species is the Eurasian Tree Sparrow.[25] Before the Spanish Sparrow arrived in the Canary Islands and Madeira, the Rock Sparrow was the sole native sparrow. In the Canaries, the Spanish Sparrow occurs in most habitats, having ousted the Rock Sparrow from all but the driest localities. In Madeira the Spanish Sparrow is common in cultivated areas, but it has not fully adapted to nesting in buildings or breeding in the drier north of the island.[16][18][26] The Spanish Sparrow is not common on most of the Cape Verde islands, due to the presence of the endemic Iago Sparrow, and the House Sparrow on São Vicente. On Fogo, where it is the sole species of sparrow, it is common in all habitats, breeding both in the houses of São Filipe and on the cliff walls of the volcano Pico do Fogo.[16][18]

Behaviour and ecology [edit]

Males displaying in an acacia hedge in Es Sénia, Algeria
A male in a nest in Lesbos, Greece

The Spanish Sparrow is strongly gregarious, flocking and breeding in groups. In the winter, it mostly wanders nomadically or makes regular migrations.[2][27]

Little is known of the Spanish Sparrow's survival, and the maximum age recorded is eleven years.[9][28][29]

Feeding [edit]

Like other sparrows, it feeds principally on the seeds of grains and other grasses, also eating leaves, fruits, and other plant materials. Young birds are fed mostly on insects, and adults also feed on insects and other animals during and before the breeding season.[30][31][32] Nestlings are fed almost exclusively on insects for their first few days, and are gradually fed larger amounts of grains.[33] The portion of insects in nestling diets is recorded at a range from 75 to over 90 percent.[34] In preying on insects, the Spanish Sparrow is opportunistic, feeding on whichever insects are most common.[35] In Central Asia, these are caterpillars, ants, grasshoppers, and crickets.[30] While migrating through Central Asia in the spring, the Spanish Sparrow feeds mostly on crops in cultivated areas, and while breeding it feeds mostly on insects, wild plants, and seeds from the previous year.[33]

Breeding [edit]

Eggs from the collection of the Muséum de Toulouse

The Spanish Sparrow nests in large colonies of closely spaced or even multiple shared nests. Nests are usually placed in trees or bushes, amongst branches or underneath the nests of larger birds such as White Storks. Colonies may hold from ten pairs to hundreds of thousands of pairs.[36] Each pair lays 3–8 eggs, which hatch in 12 days, with the chicks fledging when about 14 days old.[2][37] Males spend more time constructing nests than females.[38]

Status [edit]

The European population of the Spanish Sparrow comprises between 2,800,000 and 6,200,000 breeding pairs or 8,400,000–18,600,000 individuals. Partly from the European population, the global population is estimated to be between 17 and 74 million individuals.[1][39] There have been population decreases in some parts of Europe, but in other areas the population has increased[39][40] and the species is not seriously threatened, so it is assessed as Least Concern on the IUCN Red List.[1]

References [edit]

  1. ^ a b c BirdLife International (2012). "Passer hispaniolensis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f g h Snow & Perrins 1998, pp. 1506–1509
  3. ^ Clement, Harris & Davis 1993, pp. 446–447
  4. ^ Shelley 1902, pp. 235–237
  5. ^ Dresser 1902, p. 291
  6. ^ Metzmacher, M. (1986). "Moineaux domestiques et Moineaux espagnols, Passer domesticus et P. hispaniolensis, dans une région de l'ouest algérien : analyse comparative de leur morphologie externe". Le Gerfaut (in French, English abstract) 76: 317–334. 
  7. ^ a b Summers-Smith 1988, pp. 164–165
  8. ^ Oates 1890, p. 239
  9. ^ a b Summers-Smith 1988, p. 177
  10. ^ a b Allende, Luis M.; Rubio, Isabel; Ruíz-del-Valle, Valentin; Guillén, Jesus; Martínez-Laso, Jorge; Lowy, Ernesto; Varela, Pilar; Zamora, Jorge; Arnaiz-Villena, Antonio (2001). "The Old World sparrows (genus Passer) phylogeography and their relative abundance of nuclear mtDNA pseudogenes" (PDF). Journal of Molecular Evolution 53 (2): 144–154. PMID 11479685. Archived from the original on 21 July 2011. 
  11. ^ a b c Töpfer, Till (2006). "The taxonomic status of the Italian Sparrow – Passer italiae (Vieillot 1817): Speciation by stabilised hybridisation? A critical analysis". Zootaxa 1325: 117–145. ISSN 1175-5334. 
  12. ^ Summers-Smith 1988, pp. 169–170
  13. ^ Arnaiz-Villena, A; Gómez-Prieto P, Ruiz-de-Valle V (2009). "Phylogeography of finches and sparrows". Nova Science Publishers. ISBN 978-1-60741-844--3. 
  14. ^ a b Summers-Smith 1988, pp. 162–163
  15. ^ a b c d Summers-Smith 1988, pp. 170–171
  16. ^ a b c d e f g h i j Summers-Smith 1988, pp. 165–169
  17. ^ Obratil, S. (1985). "The range of the Spanish sparrow, Passer hispaniolensis (Temminck) in Bosnia and Herzegovina". Larus. 36–37: 49–57. 
  18. ^ a b c d e f Summers-Smith 1992, pp. 42–47
  19. ^ Roman, J.; Onrubia, A.; Roviralta, F.; Balmori, A.; Fernandez, J.; Sanz-Zuasti, J.; Gutierrez, C.; Jubete, F.; Roman, F.; Garcia, J.; Olea, P. P. (1997). "Sobre el status del gorrion moruno, Passer hispaniolensis (Temminck, 1820), en la submeseta norte" (PDF). Ecologia (in Spanish) (Madrid) 11: 453–456. Archived from the original on 11 November 2010. 
  20. ^ Metzmacher, M. (1986). "La distribution des Moineaux, Passer, en Algérie : observations complémentaires" (PDF). Le Gerfaut (in French, English and Dutch summaries) 76: 131–138. Archived from the original on 25 July 2011. 
  21. ^ Sladen, Alexander B. (1918). "Further Notes on the Birds of Macedonia". The Ibis. 10 6. 
  22. ^ Chasen, F. N. (1921). "Field Notes on the Birds of Macedonia. With special reference to the Struma Plain". The Ibis. 11 3 (2). 
  23. ^ Gould 1838, p. 95
  24. ^ Summers-Smith, J. D. (1990). "Changes in distribution and habitat utilisation by members of the genus Passer". In Pinowski, J.; and Summers-Smith, J. D. Granivorous birds in the agricultural landscape. Warszawa: Pánstwowe Wydawnictom Naukowe. pp. 11–29. ISBN 83-01-08460-X. 
  25. ^ Summers-Smith 1988, pp. 171–172
  26. ^ Lack, David (1969). "The numbers of bird species on islands". Bird Study 16 (4): 193–209. doi:10.1080/00063656909476244. 
  27. ^ Metzmacher, M. (1986). "Organisation spatio-temporelle de la reproduction chez le Moineau espagnol Passer hispaniolensis en zone semi-aride". L'Oiseau et la Revue française d'Ornithologie (in French, English abstract) 56: 229–262. 
  28. ^ "AnAge entry for Passer hispaniolensis". AnAge: the Animal Ageing and Longevity Database. Retrieved 25 June 2010. 
  29. ^ Cramp & Perrins 1994, p. 311
  30. ^ a b Summers-Smith 1988, pp. 178–179
  31. ^ El-Sehhar, A.; and Fraval, A. (1984). "Diet of the Spanish sparrow, Passer hispaniolensis (Temm.), in Morocco; seasonal and geographic variations". Actes de l'Institut Agronomique et Vétérinaire Hassan II, Morocco 4 (1): 53–61. 
  32. ^ Ali, Sálim (1963). "A Note on the Eastern Spanish Sparrow, Passer hispaniolensis transcaspicus Tschusi, in India". Journal of the Bombay Natural History Society 60 (2): 318–321. 
  33. ^ a b Gavrilov, E. I. "The Biology of the Eastern Spanish Sparrow, Passer hispaniolensis transcaspicus in Kazakhstan". Journal of the Bombay Natural History Society 60 (2). 
  34. ^ Marques, Paulo M.; Boieiro, Mário; Canário, Filipe; Vicente, Luís (2003). "Variation of Nestling Diet Across the Breeding Season in Spanish Sparrow Passer hispaniolensis in Southern Portugal". Ardeola 50 (1): 71–75. Archived from the original on 2 August 2011. 
  35. ^ Metzmacher, M. (1983). "Le menu des jeunes Moineaux domestiques, Passer domesticus L., et espagnols, Passer hispaniolensis Temm., en Oranie (Algérie)" (PDF, French abstract only). Cahiers d'Ethologie appliquée (in French, English summary) 3 (2): 191–294. Archived from the original on 25 July 2011. 
  36. ^ Summers-Smith 1988, pp. 173–177
  37. ^ Gavrilov, E. I. (1962). "A Contribution to the Biology of the Spanish Sparrow Passer hispaniolensis transcaspicus". The Ibis 104: 416–417. doi:10.1111/j.1474-919X.1962.tb08669.x. 
  38. ^ Metzmacher, Maxime (1990). "Climatic factors, activity budgets and breeding success of the Spanish Sparrow [Passer hispaniolensis (Temm.)]" (PDF). In Pinowski, J.; and Summers-Smith, J. D. Granivorous birds in the agricultural landscape. Warszawa: Pánstwowe Wydawnictom Naukowe. pp. 11–29. ISBN 83-01-08460-X. Archived from the original on 25 July 2011. 
  39. ^ a b BirdLife International (2004). "Passer hispaniolensis, Spanish Sparrow". Birds in Europe: population estimates, trends and conservation status. Conservation Series No. 12. Cambridge, England: BirdLife International. p. 263. 
  40. ^ Dinetti, Marco (2008). "I passeri Passer spp.: da "problematici" a specie di interesse conservazionistico" [The Sparrows Passer spp.: from "pest species" to species of conservation concern]. Avocetta 32: 61–68. Retrieved 20 April 2010. 
Works cited
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!