Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Passerina cyanea

A small (5 ½ inches) bunting, the male Indigo Bunting is most easily identified by its bright blue body, dark wings and tail, and small conical bill. The female Indigo Bunting is brownish gray on top and pale brown below. Male Indigo Buntings resemble females during their autumn molt, taking on brown feathers in place of the bright blue plumage they wore during the breeding season. The Indigo Bunting breeds across much of the eastern United States and southern Canada south to central Florida and Texas. This species also breeds locally west of the plains as far as California and the southwest. In winter, Indigo Buntings may be found in south Florida, southern Mexico, Central America, and the West Indies. Indigo Buntings breed in forest edges and clearings of open deciduous woodlands. During the winter, this species may be found in tropical grassland and scrubland. Indigo Buntings primarily eat insects during the summer, adding seeds and berries to their diet in the winter. In appropriate habitat, Indigo Buntings may be seen foraging for food in shrubs and low tree branches. Birdwatchers may also listen for this species’ song, a series of paired notes vaguely recalling that of a finch. Indigo Buntings are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Canada and US; > to Gr. Antilles, Colombia and Venezuela.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Indigo buntings (Passerina_cyanea) breed throughout eastern North America from the Great Plains eastward, south of the coniferous forest region. There are also some breeding populations in the western United States, including Utah, Arizona and California. Indigo buntings winter in the coastal regions of Mexico, Central America, northern South America and the Caribbean.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Indigo buntings (Passerina cyanea) breed throughout eastern North America from the Great Plains eastward, south of the coniferous forest region. There are also some breeding populations in the western United States, including Utah, Arizona and California. Indigo buntings winter in the coastal regions of Mexico, Central America, northern South America and the Caribbean.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDING: southeastern British Columbia and southeastern Saskatchewan across southern Canada to southern Maine, southern New Brunswick, and Nova Scotia, south to southern New Mexico, southern Texas, Gulf Coast, and central Florida; sporadic breeding southwest to southern California, southeastern Arizona, and southwestern Utah (Payne 1992, AOU 1998). NON-BREEDING: Nayarit, San Luis Potosi, and Bermuda south to Panama and northwestern Colombia; Bahamas, Greater Antilles (including the Virgin Islands), Cayman Islands; rarely from southern Texas, Gulf Coast, and Florida south (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult male indigo buntings are brilliant blue during the breeding season, with a darker almost purple crown. Females and young are brown with buff wingbars. They have only a tinge of blue on their tail and shoulders. Indigo buntings are small birds, from 11.5 cm to13 cm long. They weigh 12 to 18 g. They have short, conical beaks and their legs and feet are black or gray. (Payne 1992, Robbins, Bruun and Zim 1983)

Range mass: 12 to 18 g.

Range length: 11.5 to 13 cm.

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Adult male indigo buntings are brilliant blue during the breeding season, with a darker almost purple crown. Females and young are brown with buff wingbars and only a tinge of blue on their tail and shoulders. Indigo buntings are small birds, from 11.5 cm to13 cm long and weighing 12 to 18 g. They have short, conical beaks and black or gray legs and feet. (Payne 1992, Robbins, Bruun and Zim 1983)

Range mass: 12 to 18 g.

Range length: 11.5 to 13 cm.

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 14 cm

Weight: 15 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

See Kaufman (1989) for information on identification.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Indigo buntings breed in brushy and weedy areas at the edge of openings. For example, the like the brush along the edges of farm fields, or along rivers, roads or railroad tracks. They also like to breed in weedy open areas, such as old farm fields, or in swamps. In the winter, indigo buntings choose open habitats, such as weedy fields, citrus orchards, savannas, and young forests (Payne 1992).

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: swamp

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indigo buntings breed in brushy and weedy habitats along the edges of farmed land, woods, road, power lines, railways and riparian habitats. They also breed in clearings in open deciduous woodlands, in weedy or abandoned agricultural fields, and in swamps. During migration they look for open grasslands and leafy trees similar to those in their winter habitat. In winter, indigo buntings choose open habitats, such as weedy fields, citrus orchards, savannas, weedy croplands and low second growth (Payne 1992).

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: swamp

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Deciduous forest edge and clearings, open woodland, second growth, shrubby areas, scrub, cultivated lands, weedy fields, orchards, hedgerows, overgrown fencerows; avoids mature forests. Nests in crotch of saplings, small bushes, weeds, thickets, vine patch, canebrakes, sometimes in trees, to about four meters above ground in dense cover. Most settle and breed more than two kilometers from their natal site; locally hatched birds comprised 1.6% and 13% of the breeding population in areas of 10 and 4 sq km (Payne 1991). Commonly returns to territory used in previous year (Payne and Payne 1993). NON-BREEDING: In migration, open grasslands, bushes, and leafy trees (Payne 1992). In winter, weedy fields, cropland, and orchards; savanna; and low second growth (Payne 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Males generally appear in nesting range in May (Terres 1980). Arrives in Costa Rica early to mid-October, departs by late April (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

During the breeding season, indigo buntings eat small spiders and insects, seeds and berries. Common food items include caterpillars, grasshoppers, bugs, beetles, seeds and berries. In winter, indigo buntings eat small seeds, buds, and some insects. Their main food in winter is small seeds of grasses. They also commonly rice in fields where it is grown. Indigo buntings do not seem to drink very often. They probably get enough water from their food. (Payne 1992)

Indigo buntings feed alone during the breeding season. In winter, they feed in flocks. They do not store food to eat later.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

During the breeding season, indigo buntings eat small spiders and insects, seeds of grasses and herbs, and berries. Major food items taken include caterpillars, grasshoppers, bugs, beetles, seeds and berries. In winter, indigo buntings eat small seeds, buds, and some insects. Their main food in winter is small seeds of grasses. They also frequent feeders, and eat the seeds of rice in rice fields. Indigo buntings do not appear to drink frequently, and may obtain sufficient water from their diet. (Payne 1992)

Indigo buntings feed alone during the breeding season and in flocks during the winter. They do not appear to store food for later consumption. (Payne 1992)

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats insects, weed seeds, small grains, small fruits; forages in trees, shrubbery, on ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Indigo buntings affect the populations of the insects they eat. They also help distribute seeds of the plants whose berries they eat. They host at least one parasite, called hippoboscid flies (Payne 1992).

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Incubating females, eggs and young are eaten by climbing predators. These predators include Procyon lotor, Didelphis virginianus, Vulpes vulpes, feral cats, Cyanocitta cristata and Constrictor colubris. Though adults are surely eaten too, we do not know who the predators of adults are.

Adult buntings may pretend to be injured to distract predators from their nest.

Known Predators:

  • Virginia opossums (Didelphis_virginiana)
  • red foxes (Vulpes_vulpes)
  • feral cats (Felis_silvestris)
  • blue jays (Cyanocitta_cristata)
  • blue racers (Coluber_constrictor)
  • raccoons (Procyon_lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Perching birds (order Passeriformes) as a group play an important role in the earth's ecosystems. They consume many varieties and amounts of food and serve as food for others and hosts for parasites (Britannica, 1986). Indigo buntings affect the populations of the insects they eat, and help distribute seeds of the plants whose berries they eat. They also host at least one parasite; hippoboscid flies (Payne 1992).

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Although predation of adult indigo buntings surely occurs, specific predators have not been identified. Brooding females, eggs and young are vulnerable to predation from climbing predators, including raccoons, opossum, red fox, feral cats, blue jays and blue racers.

When a predator approaches a nest, adult buntings may feign injury and make a chip-chip-chip call to distract the predator and lure them away from the nest. They do not mob predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Passerina cyanea (indigo bunting) preys on:
Diptera
Coleoptera

Based on studies in:
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Passerina cyanea (indigo bunting) is prey of:
Felidae
Strix varia

Based on studies in:
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Costa Rica and Mexico, sometimes alone or in small groups, more often in flocks of 20 or more that move to areas with seeding grasses (Stiles and Skutch 1989, Rappole and Warner 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Indigo buntings use songs, calls and physical displays to communicate. Only male indigo buntings sing. Each male has one complex song that it sings during the breeding season. Males sing to defend their territory from other males and to attract females. Males may also try to attract a female by performing displays. For example, males may strut in circles in front of a female, spreading his wings and crouching his head. This display is part of courtship.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Indigo buntings use vocalizations and visual cues to communicate. Only male indigo buntings sing. Each male has one complex song that it sings, during the breeding season to advertise occupancy of a territory to other males and to attract females. Males may also court females by performing displays, such as the display in which a male struts in circles in front of a female with his wings spread and his head crouched.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Indigo buntings can live up to 10 years in the wild.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
111 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Indigo buntings can live up to 10 years in the wild.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
111 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Indigo buntings are monogamous. This means that one male usually mates with one female. However, about 15% of males have more than one mate. Also, pairs do not stay together for very long. After the eggs are laid, the male leaves the female and she raises the chicks alone. Pairs may split and chose other mates during a breeding season. Indigo buntings sometimes mate with an individual that is not their partner.

Males do not sing often in courtship, but they do follow their mate around during the nest building and laying periods. They may chase other males away.

Mating System: monogamous

Indigo buntings breed between May and September. They may raise more than one brood during the breeding season. They may also change mates or move to a new location when they begin a second brood. The female indigo bunting chooses the nest site and builds the nest by herself. Building the nest may take her up to eight days. Nests are built in tall shrubs in fields or at the edges of woods, roadsides and railways. They are made of leaves, grasses, stems and strips of bark. After the nest is finished, the female lays 1 to 4 (usually 3 or 4) white eggs. One egg is laid each day, early in the morning. The female incubates the eggs for 11 to 14 (usually 12 to 13) days.

The chicks are helpless (altricial) when they hatch. The female must brood them for the first few days to keep them warm on cool days and protect them from the heat on hot, sunny days. She feeds the chicks insects and removes their fecal sacs from the nest. The chicks leave the nest 8 to 14 days after they hatch. They become independent about 3 weeks after they leave the nest. They may begin breeding the next summer.

Breeding interval: Indigo buntings breed between May and September, with most activity occurring June through August.

Breeding season: Indigo buntings may raise more than one brood per season, and may switch nests or mates between broods.

Range eggs per season: 1 to 4.

Average eggs per season: 3.5.

Range time to hatching: 11 to 14 days.

Average time to hatching: 12-13 days.

Range fledging age: 8 to 14 days.

Average time to independence: 3 weeks.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

The female chooses the nest site and builds the nest. She broods the chicks for the first few days after they hatch. She also feeds them insects and cleans the nest. The chicks leave the nest 8 to 14 days after they hatch. They become independent about 3 weeks after they first leave the nest. The male parent does not help incubate or raise the chicks.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indigo buntings are socially monogamous. However, pairs only associate until incubation begins, and may switch partners within a single breeding season. Fertilizations outside of a breeding pair are not uncommon and approximately 15% of males have more than one mate.

Males do not sing often in courtship, but they do follow their mate around during the nest building and laying periods, often chasing other males away.

Mating System: monogamous

Indigo buntings breed between May and September, with most activity occurring June through August. They may raise more than one brood per season, and may switch nests or mates between broods. The female chooses the nest site and builds the nest, which may take up to eight days. Nests are built in shrubs in fields or at the edges of woods, roadsides and railways. They are constructed of leaves, grasses, stems and strips of bark. After the nest is complete, the female lays 1 to 4 (usually 3 or 4) white eggs. One egg is laid each day, soon after sunrise. The female begins incubating after the last egg is laid. Incubation lasts for 11 to 14 (usually 12 to 13) days.

The female broods the altricial chicks for the first few days after they hatch. She also feeds the chicks insects and removes their fecal sacs from the nest. The chicks leave the nest 8 to 14 days after hatching, and become independent about 3 weeks after fledging. Indigo buntings are sexually mature at one year old.

Breeding interval: Indigo buntings breed between May and September, with most activity occurring June through August.

Breeding season: Indigo buntings may raise more than one brood per season, and may switch nests or mates between broods.

Range eggs per season: 1 to 4.

Average eggs per season: 3.5.

Range time to hatching: 11 to 14 days.

Average time to hatching: 12-13 days.

Range fledging age: 8 to 14 days.

Average time to independence: 3 weeks.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

The male does not generally help with incubation or raising the chicks. The female chooses the nest site and builds the nest. She broods the altricial chicks for the first few days after they hatch, feeds them insects and removes their fecal sacs from the nest. The chicks leave the nest 8 to 14 days after hatching, and become independent about 3 weeks after fledging.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size is three-six (commonly three-four). Sometimes produces two broods per year. Incubation lasts 12-13 days, by female. Young leave nest at 9-13 days; male may or may not feed nestlings and/or fledged young. Males sometimes have more than one female nesting on their territories.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Passerina cyanea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTGTACCTAATCTTCGGTGCATGAGCCGGGATAGTAGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCTCTTCTAGGAGACGACCAAGTCTACAACGTGGTCGTCACAGCCCATGCTTTTGTAATAATTTTCTTCATAGTTATACCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTACTTCTCCTAGCGTCCTCCACAGTCGAAGCAGGGGTAGGCACAGGATGAACAGTCTACCCCCCACTAGCTGGCAACTTAGCCCACGCCGGAGCCTCAGTTGACCTGGCAATCTTCTCCCTACACCTAGCCGGTATCTCTTCCATTCTAGGAGCCATCAACTTTATTACAACAGCAATTAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCCTTATTCGTCTGATCAGTCCTAATTACCGCAGTTCTCTTACTCCTATCCCTACCAGTACTAGCCGCAGGGATCACTATACTTCTAACAGACCGTAACCTCAATACCACATTCTTTGATCCCGCTGGAGGAGGAGACCCAGTTCTATACCAGCATCTCTTCTGATTTTTCGGTCACCCAGAAGTCTACATTCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Passerina cyanea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Indigo buntings are becoming more common. They are not threatened or endangered, but they are protected in the United States under the U.S. Migratory Bird Treaty Act.

Indigo buntings are sometimes killed by hunters. They are also a popular as pet birds in Europe and Mexico.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indigo buntings appear to be increasing in geographic range and density. They are protected under the U.S. Migratory Bird Act, but not under CITES or the U.S. Endangered Species Act.

Indigo buntings are occasionally killed for sport and food. They are also a popular cage bird in Europe and Mexico. (Payne, 1992)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of indigo buntings on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Indigo buntings are enjoyed by bird watchers. They are also a popular pet.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse affects of indigo buntings on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There is apparent aesthetic importance of songbirds like the Indigo bunting to bird watchers and listeners. This brightly colored species is commonly kept as a cage bird (Britannica, 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Indigo Bunting

The Indigo Bunting (Passerina cyanea), is a small seed-eating bird in the family Cardinalidae. It is migratory, ranging from southern Canada to northern Florida during the breeding season, and from southern Florida to northern South America during the winter.[2] It often migrates by night, using the stars to navigate.[3] Its habitat is farmland, brush areas, and open woodland.[4] The Indigo Bunting is closely related to the Lazuli Bunting and interbreeds with the species where their ranges overlap.

Quintana, Texas Spring Migration

The Indigo Bunting is a small bird, with a length of 11.5–13 cm (4.5–5 in). It displays sexual dimorphism in its coloration; the male is a vibrant blue in the summer and a brown color during the winter months, while the female is brown year-round. The male displays brightly colored plumage during the breeding season to attract a mate. Nest-building and incubation are done solely by the female. The diet of the Indigo Bunting consists primarily of insects during the summer months and seeds during the winter months.

Contents

Taxonomy [edit]

The Indigo Bunting is included in the family Cardinalidae, which is made up of passerine birds found in North and South America, and is one of seven birds in the genus Passerina.[5] It was originally described as Tanagra cyanea by Linnaeus in his 18th-century work, Systema Naturae. The current genus name, Passerina, is derived from the Latin term passer for true sparrows and similar small birds,[6] while the species name, cyanea, is from the Latin word meaning dark or sea blue.[7]

The Indigo Bunting is closely related to the Lazuli Bunting and interbreeds with the species where their ranges overlap, in the Great Plains.[8] They were declared to form a superspecies by the American Ornithologists' Union in 1983.[9] However, according to sequencing of the mitochondrial cytochrome-b gene of members of the genus Passerina, it was determined that the Indigo Bunting and Lazuli Bunting are not, in fact, sister taxa. The Indigo Bunting is the sister of two sister groups, a “blue” (Lazuli Bunting and Blue Grosbeak) and a “painted” (Rosita's Bunting, Orange-breasted Bunting, Varied Bunting, and Painted Bunting) clade. This genetic study shows these species diverged between 4.1 and 7.3 million years ago. This timing, which is consistent with fossil evidence, coincides with a late-Miocene cooling, which caused the evolution of a variety of western grassland habitats. Evolving to reduce size may have allowed buntings to exploit grass seeds as a food source.[10]

Description [edit]

The Indigo Bunting is a smallish songbird, around the size of a small sparrow. It measures 11.5–15 cm (4.5–5.9 in) long, with a wingspan of 18–23 cm (7.1–9.1 in).[11][2] Body mass averages 14.5 g (0.51 oz), with a reported range of 11.2–21.4 g (0.40–0.75 oz).[12] During the breeding season, the adult male has deep blue plumage, with a darker crown that verges on purple. The wings and tail are black with blue edges. In fall and winter plumage, the male is similar to the female, but often retains some blue feathers. The adult female is dark brown on the upperparts and lighter brown on the underparts. It has indistinct wing bars and is faintly streaked with dark underneath.[13] The immature bird resembles the female in coloring, although a male may have hints of blue on the tail and shoulders and have darker streaks on the underside. The beak is short and conical. In the adult female, the bill is light brown tinged with blue, and in the adult male the upper half is brownish-black while the lower is light blue.[14] The feet and legs are black or gray.[15]

Distribution and habitat [edit]

The habitat of the Indigo Bunting is brushy forest edges, open deciduous woods, second growth woodland, and farmland.[4] The breeding range stretches from southern Canada to Maine, south to northern Florida and eastern Texas, and westward to southern Nevada. The winter range begins in southern Florida and central Mexico and stretches south through the West Indies and Central America to northern South America.[2] It has occurred as a vagrant in Antigua and Barbuda, Barbados, Denmark, Ecuador, Germany, Iceland, Ireland, Netherlands, the Netherlands Antilles, Saint Pierre and Miquelon, Serbia and the United Kingdom.[1]

Behavior [edit]

The Indigo Bunting communicates through vocalizations and visual cues. A sharp chip! call is used by both sexes, and is used as an alarm call if a nest or chick is threatened. A high-pitched, buzzed zeeep is used as a contact call when the Indigo Bunting is in flight.[16] The song of the male bird is a high-pitched buzzed sweet-sweet chew-chew sweet-sweet, lasting two to four seconds, sung to mark his territory to other males and to attract females. Each male has a single complex song,[15] which he sings while perched on elevated objects, such as posts, wires, and bush-tops.[17] In areas where the ranges of the Lazuli Bunting and the Indigo Bunting overlap, the males defend territories from each another.[18] Migration takes place in April and May and then again in September and October.[2] The Indigo Bunting often migrates during the night, using the stars to direct itself.[3] In captivity, since it cannot migrate, it experiences disorientation in April and May and in September and October if it cannot see the stars from its enclosure.[2]

Breeding [edit]

A male in breeding plumage

These birds are generally monogamous but not always faithful to their partner. In the western part of their range, they often hybridize with the Lazuli Bunting. Nesting sites are located in dense shrub or a low tree, generally 0.3–1 m (1–3 ft) above the ground, but rarely up to 9 m (30 ft).[18] The nest itself is constructed of leaves, coarse grasses, stems, and strips of bark, lined with soft grass or deer hair and is bound with spider web. It is constructed by the female, who cares for the eggs alone.[18] The clutch consists of one to four eggs, but usually contains three to four. The eggs are white and usually unmarked, though some may be marked with brownish spots, averaging 18.7 × 13.7 mm (0.7 × 0.5 in) in size.[19] The eggs are incubated for 12 to 13 days and the chicks are altricial at hatching.[2] Chicks fledge 10 to 12 days after hatching. Most pairs raise two broods per year, and the male may feed newly fledged young while the females incubate the next clutch of eggs.[20]

The Brown-headed Cowbird may parasitize this species.[11] Indigo Buntings abandon their nest if a cowbird egg appears before they lay any of their own eggs, but accept the egg after that point. Pairs with parasitized nests have less reproductive success. The bunting chicks hatch, but have lower survival rates as they must compete with the cowbird chick for food.[21]

Diet [edit]

The Indigo Bunting forages for food on the ground or in trees or shrubs.[18] In winter, it often feeds in flocks with other Indigo Buntings, but is a solitary feeder during the breeding season.[15] During the breeding season, the species eats insects, seeds and berries, including caterpillars, grasshoppers, spiders, beetles, and grass seeds. The seeds of grasses are the mainstay of its diet during the winter, although buds, and insects are eaten when available. The young are fed mainly insects at first, to provide them with protein.[18] The Indigo Bunting does not drink frequently, generally obtaining sufficient water from its diet.[15]

Status [edit]

The species is of Least Concern according to the IUCN, with an estimated range of 5,900,000 km² (3,700,000 mi²) and a population of 28,000,000 individuals. Global population trends have not been quantified, but the species is not believed to approach the thresholds for a population decline warranting an upgrade in conservation status.[1] The criteria for a change in conservation status are a decline of more than 30% in ten years or over three generations.[1]

References [edit]

  1. ^ a b c d BirdLife International (2012). "Passerina cyanea". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f "Indigo Bunting". All About Birds. Cornell Lab of Ornithology. 2003. Retrieved 2008-07-12. 
  3. ^ a b Emlen, Stephen T. (October 1967). "Migratory Orientation in the Indigo Bunting, Passerina cyanea – Part II: Mechanism of Celestial Orientation" (pdf). The Auk 84 (4): 463–89. doi:10.2307/4083330. Retrieved 2008-07-12. 
  4. ^ a b Sibley, Charles Gald; Burt Leavelle Monroe (1991). Distribution and Taxonomy of Birds of the World. Yale University Press. p. 775. ISBN 0-300-04969-2. 
  5. ^ "Passerina cyanea". Integrated Taxonomic Information System. Retrieved 2008-07-12. 
  6. ^ Whitaker, William. "Passer". Words by William Whitaker. Retrieved 2008-07-12. 
  7. ^ Whitaker, William. "Cyanea". Words by William Whitaker. Retrieved 2008-07-12. 
  8. ^ Sharpe, Roger S.; W. Ross Silcock, Joel G. Jorgensen (2001). Birds of Nebraska: Their Distribution and Temporal Occurrence. University of Nebraska Press. p. 430. ISBN 0-8032-4289-1. 
  9. ^ Campbell, Robert Wayne (2001). The Birds of British Columbia. UBC Press. p. 184. ISBN 0-7748-0621-4. 
  10. ^ Klicka, J; Fry AJ, Zink RM, Thompson CW (September 16, 2000). "A Cytochrome-b Perspective on Passerina Bunting Relationships" (PDF). The Auk 118 (3): 610–623. doi:10.1642/0004-8038(2001)118[0610:ACBPOP]2.0.CO;2. Retrieved 2008-07-14. 
  11. ^ a b Terres, J. K. (1980). The Audubon Society Encyclopedia of North American Birds. New York, NY: Knopf. p. 290. ISBN 0-394-46651-9. 
  12. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  13. ^ Gough, Gregory (2003). "Passerina cyanea". USGS Patuxent Wildlife Research Center. Retrieved 2008-07-12. 
  14. ^ "Passerina cyanea". Audubon Society. 2003. Retrieved 2008-07-29. 
  15. ^ a b c d Zumberg, R (1999). "Passerina cyanea". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2008-07-12. 
  16. ^ Eliott, Lang (2004). Know Your Bird Sounds. Stackpole Books. p. 23. ISBN 0-8117-2964-8. 
  17. ^ Kaufman, Kenneth (2001). Birds of North America. HMCo Field Guides. p. 366. ISBN 0-618-13219-8. 
  18. ^ a b c d e Kaufman, Kenneth (2001). Lives of North American Birds. HMCo Field Guides. p. 569. ISBN 0-618-15988-6. 
  19. ^ Harrison, Hal H. (2001). A Field Guide to Western Birds' Nests. HMCo Field Guides. p. 231. ISBN 0-618-16437-5. 
  20. ^ Fergus, Charles (2000). Wildlife of Pennsylvania and the Northeast. Stackpole Books. pp. 316–317. ISBN 0-8117-2899-4. 
  21. ^ Johnsgard, Paul A. (1997). The Avian Brood Parasites: Deception at the Nest. Oxford: Oxford University Press. p. 349. ISBN 0-19-511042-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Hybridizes with P. AMOENA where ranges overlap in the Great Plains, but the two species are locally sympatric without interbreeding in the Southwest; they have been regarded as conspecific by a few authors, but are regarded as a superspecies by AOU (1998). Baker and Baker (1991) present evidence that indicates low levels of hybridization and introgression with assortative mating.

However, a recent phylogenetic study of the mitochondrial cytochrome-b gene indicates that these two hybridizing species are not sister taxa at all; instead, P. AMEONA is most closely related to the much larger Blue Grosbeak (Guiraca caerulea) and Cyanea is basal to the PASSERINA-GUIRACA group (Klicka et al. 2001).

Linaria is an invalid generic name for North America buntings (Banks and Browning 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!