Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: from eastern Panama south through most of South America to central Chile and central Argentina; during 1900s range expanded though Lesser and Greater Antilles, reaching Puerto Rico in 1955 and Hispaniola in 1970s (AOU 1998, Post and Wiley 1977). Established on Barbados (probably an introduction) and Grenada (AOU 1998). Has reached Cuba, Curacao, and the Bahamas (Derbot and Prins 1992, Carib. J. Sci. 28:104-105; Baltz 1995). Spreading with deforestation along rivers in Amazonia (Ridgely and Tudor 1989). Expansion in range has accompanied large-scale habitat alterations (deforestation) associated with agriculture and animal husbandry (Post and Wiley 1977, Cavalcanti and Pimentel 1988). Now established in southern Florida and occurring rarely to western Florida and southern Georgia, and casually west to central Texas and Oklahoma and north to North Carolina; accidental in Maine (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Size

Length: 20 cm

Weight: 39 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Various habitats but prefers open areas (Cruz et al. 1989). Partly open situations with scattered trees, open woodland, cultivated lands, pastures, marshes, and around human habitation (AOU 1983).

Brood parasite and host generalist; lays eggs in nests of many other bird species. In Puerto Rico (and elsewhere), heavily parasitized species include DENDROICA PETECHIA, VIREO ALTILOQUUS, MYIARCHUS ANTILLARUM, and various icterids, including ICTERUS DOMINICENSIS and AGELAIUS XANTHOMUS (Wiley 1985, Post et al. 1993). See Cavalcanti and Pimentel (1988) for hosts in central Brazil.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In Puerto Rico, common along southwestern coast June-October; few remain in coastal zone after October (Post and Wiley 1977). In U.S., apparently permanent residents south of Tampa, Florida, but numbers increase in northern part of range, possibly as a result of incursions from the Greater Antilles (Post et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Implicated in decline of several island bird populations, including yellow-shouldered blackbird in Puerto Rico. Other host species that should be monitored for possible cowbird-induced decline include Puerto Rican flycatcher, black-whiskered vireo, black-cowled oriole, and troupial (Cruz et al. 1989). Brood parasitism reduces nesting success and productivity of hosts (Wiley 1985).

Roosts communally in large numbers (1000s in Puerto Rico) with AGELAIUS XANTHOMUS and QUISCALUS NIGER (Post and Wiley 1977); otherwise occurs alone or more frequently in small loose groups. Females commuted daily about 4 kilometers between feeding and breeding areas (Woodworth 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

In Puerto Rico, lays eggs mainly March-July (Wiley 1988). In nests of AGELAIUS XANTHOMUS, lays 2-5 eggs per nest (Post and Wiley 1977). Incubation and rearing of young by host species; up to 3-4 cowbirds may fledge from nest of certain hosts (Wiley 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Molothrus bonariensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGTGCATGAGCCGGAATGGTAGGTACCGCTCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGGGGGTTCGGAAACTGACTAGTACCCCTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAACATGAGCTTCTGACTACTTCCCCCATCCTTCCTCCTTCTCCTAGCATCTTCCACGGTTGAGGCAGGCGTGGGCACAGGCTGAACAGTATACCCCCCACTAGCAGGCAATCTAGCTCACGCCGGAGCTTCAGTCGACCTCGCAATTTTCTCACTGCACCTAGCCGGTATCTCTTCAATCCTAGGAGCAATCAACTTTATTACAACAGCAGTCAACATAAAACCACCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTATTACTCCTATCCCTCCCAGTCCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGCAACCTTAACACCACATTCTTTGATCCTGCCGGAGGAGGAGACCCTGTACTGTACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Molothrus bonariensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2N,N3B : N2N: Imperiled - Nonbreeding, N3B: Vulnerable - Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Easily captured in traps baited with grain; trapping of cowbirds apparently is the most effective management technique for recovery of parasitized bird populations (Wiley 1985; see also Heisterberg and Nunez-Garcia 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: When present in large numbers, can have important effects on corn and rice cultivation (Borja 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Shiny cowbird

The shiny cowbird (Molothrus bonariensis) is a passerine bird in the New World family Icteridae. It breeds in most of South America apart from the most dense jungles, mountains and deserts (although spreading into these habitats as they are modified by humans), the coldest southernmost regions (e.g. Tierra del Fuego), and on Trinidad and Tobago. It has relatively recently colonised Chile and many Caribbean islands, and has reached the United States, where it is probably breeding in southern Florida. Northern and southernmost populations are partially migratory.

It is a bird associated with open woodland and cultivation. The male’s song is a purr and whistle, purr purr purrte-tseeeee. The male’s call is a sharp whistled tsee-tsee, but the female makes a harsh rattle.

Like most other cowbirds, it is a brood parasite, laying its eggs in the nests of many other bird species, such as (in Brazil) the rufous-collared sparrow and the masked water tyrant. The eggs are of two types, either whitish and unspotted, or pale blue or green with dark spots and blotches. The host’s eggs are sometimes removed, and if food is short their chicks may starve, but larger host species are less affected. The incubation period of 11–12 days is shorter than that of most hosts. Extermination of the shiny cowbird within the tiny range of the pale-headed brush finch has resulted in a population increase in this critically endangered species.

The male shiny cowbird is all black with an iridescent purple-blue gloss. The smaller female is dark brown in plumage, paler on the underparts. She can be distinguished from the female brown-headed cowbird by her longer, finer bill, pale supercilium and stronger face pattern. There is an all-black plumage variation, and the northern subspecies M. b. cabanisii of Panama and northern Colombia is paler than the nominate M. b. bonariensis. Juveniles are like the female but more streaked below. There is some variation in size across the range, with the race of M. b. minimus from northern South America and the West Indies being the smallest at 31 to 40 g (1.1 to 1.4 oz) and 18 cm (7.1 in) in length and M. b. cabanisii being the largest at 55 to 65 g (1.9 to 2.3 oz) and 22 cm (8.7 in) on average.[2]

This abundant and gregarious bird feeds mainly on insects and some seeds, including rice, and forages on the ground or perches on cattle.

Female shiny cowbird
A juvenile being fed by a rufous-collared sparrow

References[edit]

Further reading[edit]

Books[edit]

  • Lowther, P., and W. Post. 1999. Shiny Cowbird (Molothrus bonariensis). In The Birds of North America, No. 399 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
  • Pereira, J.F.M. 2008. Aves e Pássaros Comuns do Rio de Janeiro. Technical Books, Rio de Janeiro.


Articles[edit]

  • Arendt WJ & Mora TAV. (1984). Range Expansion of the Shiny Cowbird in the Dominican-Republic. Journal of Field Ornithology. vol 55, no 1. p. 104-107.
  • Astie AA. (2003). New record of Shiny Cowbird (Molothrus bonariensis) parasitism of Black-chinned Siskins (Carduelis barbata). Wilson Bulletin. vol 115, no 2. p. 212-213.
  • Astie AA & Reboreda JC. (2005). Creamy-bellied Thrush defenses against Shiny Cowbird brood parasitism. Condor. vol 107, no 4. p. 788-796.
  • Astie AA & Reboreda JC. (2006). Costs of egg punctures and parasitism by shiny cowbirds (Molothrus bonariensis) at Creamy-bellied Thrush (Turdus amaurochalinus) nests. Auk. vol 123, no 1. p. 23-32.
  • Baltz ME. (1995). First records of the Shiny Cowbird (Molothrus bonariensis) in the Bahama Archipelago. Auk. vol 112, no 4. p. 1039-1041.
  • Blanco DE. (1995). Brood Parasitism of the Shiny Cowbird Molothrus bonariensis on Chestnut-Capped Blackbird Agelaius ruficapillus, in Eastern Buenos Aires Province. Hornero. vol 14, no 1-2. p. 44-45.
  • Cavalcanti RB & Pimentel TM. (1988). Shiny Cowbird Parasitism in Central Brazil. Condor. vol 90, no 1. p. 40-43.
  • Cruz A & Andrews RW. (1997). The breeding biology of the Pied Water-Tyrant and its interactions with the Shiny Cowbird in Venezuela. Journal of Field Ornithology. vol 68, no 1. p. 91-97.
  • Cruz A, Manolis TD & Andrews RW. (1990). Reproductive Interactions of the Shiny Cowbird Molothrus-Bonariensis and the Yellow-Hooded Blackbird Agelaius-Icterocephalus in Trinidad West Indies. Ibis. vol 132, no 3. p. 436-444.
  • Cruz A, Manolis TH & Andrews RW. (1995). History of shiny cowbird Molothrus bonariensis brood parasitism in Trinidad and Tobago. Ibis. vol 137, no 3. p. 317-321.
  • Debrot AO & Prins TG. (1992). First Record and Establishment of the Shiny Cowbird in Curaçao. Caribbean Journal of Science. vol 28, no 1-2. p. 104-105.
  • Dolores M & Juan CR. (2005). Conspecific and heterospecific social learning in shiny cowbirds. Animal Behaviour. vol 70, p. 1087.
  • Feare CJ & Zaccagnini ME. (1993). Roost departure by shiny cowbirds (Molothrus bonariensis). Hornero. vol 13, no 4. p. 292-293.
  • Fiorini VD & Reboreda JC. (2006). Cues used by shiny cowbirds (Molothrus bonariensis) to locate and parasitise chalk-browed mockingbird (Mimus saturninus) nests. Behavioral Ecology and Sociobiology. vol 60, no 3. p. 379-385.
  • Fraga RM. (1978). The Rufous-Collared Sparrow as a Host of the Shiny Cowbird. Wilson Bulletin. vol 90, no 2. p. 271-284.
  • Fraga RM. (2002). Notes on new or rarely reported Shiny Cowbird hosts from Argentina. Journal of Field Ornithology. vol 73, no 2. p. 213-219.
  • Fraga RM. (2005). The Brown-backed Mockingbird (Mimus dorsalis) as a shiny cowbird (Molothrus bonariensis) host. Ornitologia Neotropical. vol 16, no 3. p. 435-436.
  • Gabriela L. (1998). Parasitism by Shiny Cowbirds of Rufous-bellied Thrushes. The Condor. vol 100, no 4. p. 680.
  • Gallardo JM. (1977). Molothrus-Bonariensis and Vigilance of Nests Parasitized by It. Physis Seccion C los Continentes y los Organismos Terrestres. vol 36, no 92. p. 345-346.
  • Gochfeld M. (1978). Begging by Nestling Shiny Cowbirds Molothrus-Bonariensis Adaptive or Mal Adaptive. Living Bird. vol 17, p. 41-50.
  • Grzybowski JA & Fazio VW, III. (1991). Shiny Cowbird Reaches Oklahoma USA. American Birds. vol 45, no 1. p. 50-52.
  • Hutcheson WH & Post W. (1990). Shiny Cowbird Collected in South Carolina USA First North American Specimen. Wilson Bulletin. vol 102, no 3.
  • Juan Pablo I. (2002). Nectarivorous feeding by Shiny Cowbirds: A complex feeding innovation. The Wilson Bulletin. vol 114, no 3. p. 412.
  • Kattan GH. (1996). Growth and provisioning of Shiny Cowbird and House Wren host nestlings. Journal of Field Ornithology. vol 67, no 3. p. 434-441.
  • Kattan GH. (1997). Shiny cowbirds follow the 'shotgun' strategy of brood parasitism. Animal Behaviour. vol 53, p. 647.
  • King JR. (1973). Reproductive Relationships of the Rufous-Collared Sparrow and the Shiny Cowbird. Auk. vol 90, no 1. p. 19-34.
  • Kluza DA. (1998). First record of Shiny Cowbird (Molothrus bonariensis) in Yucatan, Mexico. Wilson Bulletin. vol 110, no 3. p. 429-430.
  • Lea SEG & Kattan GH. (1998). Reanalysis gives further support to the 'shotgun' model of shiny cowbird parasitism of house wren nests. Animal Behaviour. vol 56, p. 1571-1573.
  • Lichtenstein G. (2001). Low success of shiny cowbird chicks parasitizing rufous-bellied thrushes: chick-chick competition or parental discrimination?. Animal Behaviour. vol 61, p. 401-413.
  • Lopez-Ortiz R, Ventosa-Febles EA, Ramos-Alvarez KR, Medina-Miranda R & Cruz A. (2006). Reduction in host use suggests host specificity in individual shiny cowbirds (Molothrus bonariensis). Ornitologia Neotropical. vol 17, no 2. p. 259-269.
  • Lyon BE. (1997). Spatial patterns of shiny cowbird brood parasitism on chestnut-capped blackbirds. Animal Behaviour. vol 54, p. 927-939.
  • Mason P. (1986). Brood Parasitism in a Host Generalist the Shiny Cowbird Molothrus-Bonariensis I. the Quality of Different Species as Hosts. Auk. vol 103, no 1. p. 52-60.
  • Mason P. (1986). Brood Parasitism in a Host Generalist the Shiny Cowbird Molothrus-Bonariensis Ii. Host Selection. Auk. vol 103, no 1. p. 61-69.
  • Mason P & Rothstein SI. (1986). Coevolution and Avian Brood Parasitism Cowbird Molothrus-Bonariensis Eggs Show Evolutionary Response to Host Discrimination. Evolution. vol 40, no 6. p. 1207-1214.
  • Mason P & Rothstein SI. (1987). CRYPSIS VERSUS MIMICRY AND THE COLOR OF SHINY COWBIRD EGGS. American Naturalist. vol 130, no 2. p. 161-167.
  • Massoni V & Reboreda JC. (1998). Costs of brood parasitism and the lack of defenses on the yellow-winged blackbird shiny cowbird system. Behavioral Ecology and Sociobiology. vol 42, no 4. p. 273-280.
  • Massoni V & Reboreda JC. (2001). Number of close spatial and temporal neighbors decreases the probability of nest failure and Shiny Cowbird parasitism in colonial Yellow-winged Blackbirds. Condor. vol 103, no 3. p. 521-529.
  • Mermoz ME & Fernandez GJ. (1999). Low frequency of Shiny Cowbird parasitism on Scarlet-headed Blackbirds: anti-parasite adaptations or nonspecific host life-history traits?. Journal of Avian Biology. vol 30, no 1. p. 15-22.
  • Mermoz ME & Reboreda JC. (1994). Brood parasitism on of the shiny cowbird Molothrus bonariensis, on the brown-and-yellow Marshbird, Pseudoleistes virescens. Condor. vol 96, no 3. p. 716-721.
  • Mermoz ME & Reboreda JC. (1999). Egg-laying behaviour by shiny cowbirds parasitizing brown-and-yellow marshbirds. Animal Behaviour. vol 58, p. 873.
  • Mermoz ME & Reboreda JC. (2003). Reproductive success of shiny cowbird (Molothrus bonariensis) parasitizing the larger brown-and-yellow marshbird (Pseudoleistes virescens) in Argentina. Auk. vol 120, no 4. p. 1128-1139.
  • Pereira LE, Suzuki A, Moraes Coimbra TL, Pereira de Souza R & Bocato Chamelet EL. (2001). [Ilheus arbovirus in wild birds (Sporophila caerulescens and Molothrus bonariensis)]. Revista de Saude Publica. vol 35, no 2. p. 119-123.
  • Perez-Rivera RA. (1986). Parasitism by the Shiny Cowbird Molothrus-Bonariensis in the Interior Parts of Puerto-Rico. Journal of Field Ornithology. vol 57, no 2. p. 99-104.
  • Porto GR & Piratelli A. (2005). Ethogram of the shiny cowbird, Molothrus bonariensis Gmelin (Aves, Emberizidae, Icterinae). Revista Brasileira de Zoologia. vol 22, no 2. p. 306-312.
  • Post W. (1992). First Florida Specimens of the Shiny Cowbird. Florida Field Naturalist. vol 20, no 1. p. 17-18.
  • Post W. (1993). First specimen of the shiny cowbird, Molothrus bonariensis (Aves: Emberizidae) in North Carolina. Brimleyana. vol 0, no 19. p. 205-208.
  • Post W, Cruz A & McNair DB. (1993). The North American invasion pattern of the shiny cowbird. Journal of Field Ornithology. vol 64, no 1. p. 32-41.
  • Post W, Nakamura TK & Cruz A. (1990). Patterns of Shiny Cowbird Parasitism in St. Lucia West Indies Southwestern Puerto Rico. Condor. vol 92, no 2. p. 461-469.
  • Post W & Wiley JW. (1977). Reproductive Interactions of the Shiny Cowbird and the Yellow-Shouldered Blackbird. Condor. vol 79, no 2. p. 176-184.
  • Post W & Wiley JW. (1977). The Shiny Cowbird in the West-Indies. Condor. vol 79, no 1. p. 119-121.
  • Post W & Wiley JW. (1992). The head-down display in Shiny Cowbirds and its relation to dominance behavior. The Condor. vol 94, no 4. p. 999.
  • Ruckdeschel C, Shoop CR & Sibley D. (1996). First sighting of the shiny cowbird in Georgia. Oriole. vol 61, no 2-3. p. 29-30.
  • Sackmann P & Reboreda JC. (2003). A comparative study of Shiny Cowbird parasitism of two large hosts, the Chalk-browed Mockingbird and the Rufous-bellied Thrush. Condor. vol 105, no 4. p. 728-736.
  • Salvador SA. (1984). Study of Parasitism in Raising Shiny Cowbirds Molothrus-Bonariensis and Chalk-Browed Mockingbirds Mimus-Saturninus in Villa Maria Cordoba Argentine. Hornero. vol 12, no 3. p. 141-149.
  • Smith PW & Sprunt AI. (1987). The Shiny Cowbird Reaches the USA Will the Scourge of the Caribbean Impact Florida's Avifauna Too?. American Birds. vol 41, no 3. p. 370-371.
  • Sykes PW, Jr. & Post W. (2001). First specimen and evidence of breeding by the shiny cowbird in Georgia. Oriole. vol 66, no 3-4. p. 45-51.
  • Viviana M & Juan Carlos R. (2002). A neglected cost of brood parasitism: Egg punctures by Shiny Cowbirds during inspection of potential host nests. The Condor. vol 104, no 2. p. 407.
  • Wiley JW. (1985). Shiny Cowbird Molothrus-Bonariensis Parasitism in 2 Avian Communities in Puerto-Rico. Condor. vol 87, no 2. p. 165-176.
  • Wiley JW. (1986). Growth of Shiny Cowbirds Molothrus-Bonariensis and Host Chicks. Wilson Bulletin. vol 98, no 1. p. 126-131.
  • Wiley JW. (1988). Host Selection By the Shiny Cowbird. Condor. vol 90, no 2. p. 289-303.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!