Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: from eastern Panama south through most of South America to central Chile and central Argentina; during 1900s range expanded though Lesser and Greater Antilles, reaching Puerto Rico in 1955 and Hispaniola in 1970s (AOU 1998, Post and Wiley 1977). Established on Barbados (probably an introduction) and Grenada (AOU 1998). Has reached Cuba, Curacao, and the Bahamas (Derbot and Prins 1992, Carib. J. Sci. 28:104-105; Baltz 1995). Spreading with deforestation along rivers in Amazonia (Ridgely and Tudor 1989). Expansion in range has accompanied large-scale habitat alterations (deforestation) associated with agriculture and animal husbandry (Post and Wiley 1977, Cavalcanti and Pimentel 1988). Now established in southern Florida and occurring rarely to western Florida and southern Georgia, and casually west to central Texas and Oklahoma and north to North Carolina; accidental in Maine (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Size

Length: 20 cm

Weight: 39 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Various habitats but prefers open areas (Cruz et al. 1989). Partly open situations with scattered trees, open woodland, cultivated lands, pastures, marshes, and around human habitation (AOU 1983).

Brood parasite and host generalist; lays eggs in nests of many other bird species. In Puerto Rico (and elsewhere), heavily parasitized species include DENDROICA PETECHIA, VIREO ALTILOQUUS, MYIARCHUS ANTILLARUM, and various icterids, including ICTERUS DOMINICENSIS and AGELAIUS XANTHOMUS (Wiley 1985, Post et al. 1993). See Cavalcanti and Pimentel (1988) for hosts in central Brazil.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In Puerto Rico, common along southwestern coast June-October; few remain in coastal zone after October (Post and Wiley 1977). In U.S., apparently permanent residents south of Tampa, Florida, but numbers increase in northern part of range, possibly as a result of incursions from the Greater Antilles (Post et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Implicated in decline of several island bird populations, including yellow-shouldered blackbird in Puerto Rico. Other host species that should be monitored for possible cowbird-induced decline include Puerto Rican flycatcher, black-whiskered vireo, black-cowled oriole, and troupial (Cruz et al. 1989). Brood parasitism reduces nesting success and productivity of hosts (Wiley 1985).

Roosts communally in large numbers (1000s in Puerto Rico) with AGELAIUS XANTHOMUS and QUISCALUS NIGER (Post and Wiley 1977); otherwise occurs alone or more frequently in small loose groups. Females commuted daily about 4 kilometers between feeding and breeding areas (Woodworth 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

In Puerto Rico, lays eggs mainly March-July (Wiley 1988). In nests of AGELAIUS XANTHOMUS, lays 2-5 eggs per nest (Post and Wiley 1977). Incubation and rearing of young by host species; up to 3-4 cowbirds may fledge from nest of certain hosts (Wiley 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Molothrus bonariensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGTGCATGAGCCGGAATGGTAGGTACCGCTCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGGGGGTTCGGAAACTGACTAGTACCCCTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAACATGAGCTTCTGACTACTTCCCCCATCCTTCCTCCTTCTCCTAGCATCTTCCACGGTTGAGGCAGGCGTGGGCACAGGCTGAACAGTATACCCCCCACTAGCAGGCAATCTAGCTCACGCCGGAGCTTCAGTCGACCTCGCAATTTTCTCACTGCACCTAGCCGGTATCTCTTCAATCCTAGGAGCAATCAACTTTATTACAACAGCAGTCAACATAAAACCACCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTATTACTCCTATCCCTCCCAGTCCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGCAACCTTAACACCACATTCTTTGATCCTGCCGGAGGAGGAGACCCTGTACTGTACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Molothrus bonariensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5