Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Geothlypis aequinoctialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGACATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAACGTGGTTGTTACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATACCGATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCGCCATCATTCCTCCTCCTCCTAGCATCCTCCACAGTTGAAGCAGGAGTAGGTACAGGTTGAACGGTGTACCCCCCACTAGCTGGCAACCTGGCCCACGCTGGAGCCTCAGTCGACCTCGCAATCTTCTCCCTACACCTAGCCGGTATTTCCTCAATCCTTGGAGCAATCAACTTCATTACAACAGCAATCAACATGAAACCTCCTGCCCTCTCACAATACCAGACCCCACTATTCGTCTGATCAGTACTGATCACTGCAGTCCTCCTACTCCTCTCCCTCCCGGTTCTGGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACTACATTCTTCGACCCTGCTGGAGGAGGAGATCCAGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCCGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTCGTAACATACTACGCAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Geothlypis aequinoctialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Masked yellowthroat

The masked yellowthroat (Geothlypis aequinoctialis) is a New World warbler. It has a number of separate resident breeding populations in Central and South America, some of which may be considered to form separate species.

The breeding habitat is marshes and other wet areas with dense low vegetation. The masked yellowthroat may also be found in other areas with dense shrub, but is less common in drier habitats. Two white eggs with reddish-brown markings are laid in a lined cup nest low in grass or rank vegetation.

The masked yellowthroat is 13.2 cm long and weighs 13 g. It has yellow-green upperparts, bright yellow underparts, and a mainly black bill. The adult male has a black facemask, bordered above with a gray band. The female is similar, but lacks the black mask. She is slightly duller, has variable amounts of gray to the head (often virtually none), a yellowish eye ring and a yellowish stripe from the bill to the eye. There are significant racial variations in the male plumage (see Taxonomy).

This species is easily distinguished from wintering common yellowthroat by its uniform yellow underparts, whereas the North American bird has a white belly.

The masked yellowthroat is usually seen in pairs, and does not associate with other species. It is often skulking, but may pop up occasionally, especially to sing. It feeds on insects, including caterpillars, which are usually captured in dense vegetation. The call is a fast chattering, quite unlike that of other yellowthroat species, and a more typical sharp chip.

This species may be spreading in Central America due to deforestation.

Taxonomy[edit]

There are five subspecies of the masked yellowthroat, differing in size, male head pattern and song. The Central American subspecies is sometimes considered a separate species, and the two Pacific subspecies together are also often treated as a species. Recent genetic evidence suggests that the southern South American subspecies may also merit specific status. The populations are as follows:

  • The nominate race, G. a. aequinoctialis, described above, breeds from central Colombia, through northern Venezuela, Trinidad, the Guianas, to the regions near the Amazon River in Brazil. The song is a warbled tee-chee-chee teecheweet teecheweet.
  • G. (a). velata, southern yellowthroat, breeds in central South America from south-eastern Peru and adjacent parts of Brazil, through Bolivia, Paraguay, Uruguay and southern Brazil, to central Argentina. It is slightly smaller than aequinoctialis, and the male has a narrower black mask, with a broader gray band which extends onto the nape and neck sides. The song is longer, faster and more warbled than that of the northern race.
  • G. (a). auriculata and G. a. peruviana, black-lored yellowthroat, breeds in western Ecuador and western Peru. The male has the black mask restricted to the area from the bill back to the eye and a narrow band on the forehead. The subspecies peruviana, which is found in the Marañón valley, is similar in size to aequinoctialis, but auriculata is noticeably smaller. The song of is a cheerful wee wee wee weeyou weeyou.
  • G. (a). chiriquensis, Chiriqui yellowthroat, occurs in western Panama and Costa Rica. It is another small form, but the male has the broadest black mask of all the races, extending on to the forecrown. The song is similar to auriculata, but repeated many times, becoming faster, higher and weaker before a final flourish, and it may be given in flight.

It is likely that the range of this species was once continuous, perhaps in the cooler conditions of the last ice age, but the populations are now separated by the dense sections of wet lowland forests of the Amazon and Chocó. The auriculata and chiriquensis groups are further separated from the nominate and velata groups by the Andes Mountains.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!