Overview

Brief Summary

The Brown-headed Cowbird (Molothrus ater) is named for the male's distinctive brown head, which contrasts with his metallic green-black body. This is a common bird of woodlands, farmland, and suburbs across most of North America, breeding from British Columbia and southern Quebec in Canada south to southern Mexico, with a southward contraction of this range in the winter.

Brown-headed Cowbirds are well known as "brood parasites", sneaking their eggs into the nests of birds of other species to be reared by adoptive "host" parents (which are often much smaller than them). During the breeding season, Brown-headed Cowbirds tend to engage in courtship and nest parasitism mainly in the morning and to feed in the afternoon. A single female may travel more than 6 km through woodlands to lay as many as several dozen eggs in a breeding season. Providing bird food in spring around the edges of large woodlands unintentionally facilitates brood parasitism by cowbirds, which can greatly reproduce the reproductive output of their hosts.

In the breeding season, males display by fluffing up their body feathers, partly speading their wings and tail, and bowing deeply while singing. Groups of males sometimes perch together, singing and displaying. The male's song is a squeaky gurgle.

Brown-headed Cowbird eggs are whitish with brown and gray spots concentrated at the larger end and are often easily recognized because they look different and larger than the other eggs in a host nest. A female may lay nearly an egg per day for several weeks, up to 40 in a breeding season (rarely as many as 70 or more). A female will often remove a host egg before adding one of her own. Brown-headed Cowbird eggs have been found in the nests of more than 220 species and over 140 of these are known to have successfully reared young cowbirds. Fed by their host parents, cowbird nestlings develop rapidly, usually leaving the nest after about 10 or 11 days.

The diet of the Brown-headed Cowbird consists mainly of seeds and insects (seeds account for around half the diet during the breeding season, but more than 90% in the winter). Centuries ago, these birds probably followed bison herds on the Great Plains, as they often follow cattle and horses across North America today, feeding on insects flushed from the grass. This dramatic range expansion over the past century or two has negatively impacted a number of parasatized songbird species, some quite seriously.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: Breeding range extends from southeast Alaska, northern British Columbia, and southern Mackenzie to Newfoundland, and south to central Mexico, southern Texas, Gulf Coast, and southern Florida (AOU 1983, Lowther 1993). Winter range extends from northern California, southern New Mexico, Kansas, Great Lakes region, New England, and Nova Scotia south to southern Baja California, Oaxaca, central Veracruz, Gulf Coast, and southern Florida (AOU 1983, Lowther 1993). This species historically occurred in the Great Plains west of the Mississippi River and often was associated with bison that stirred up insects and uncovered seeds. In the 1700s and 1800s, European settlers fragmented the once unbroken expanse of eastern deciduous forest, leading to cowbird expansion throughout the eastern United States and Canada (Mayfield 1965, 1977). Fragmentation of forests and cowbird expansion occurred more recently in the western United States (Verner and Ritter 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Brown-headed Cowbirds breed from southeastern Alaska, through Canada and the entire continental United States to central Mexico. They winter throughout the southern portions of this range, and also in southern Mexico and the tip of Florida.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding Range: The range of brown-headed cowbird extends from
southeastern Alaska, northern British Columbia, southern Mackenzie
District, northern Alberta, and north-central Saskatchewan; east to
southern Manitoba and southern Newfoundland; south to central Florida,
the Gulf Coast, and southern Texas; and south in Mexico to Oaxaca and
northern Baja California [57].

Winter Range: The brown-headed cowbird winters from northern
California, central Arizona, the Great Lakes States, and New England
south to Mexico, the Gulf Coast, and southern Florida [11].

Ranges of subspecies are as follows:

Brown-headed cowbird - Midwest and eastern United States
Western cowbird - western states including California
Dwarf cowbird - Great Basin and California [35].
  • 11. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 35. Lowther, Peter E. 1993. Brown-headed cowbird. In: Poole, A.; Gill, F., eds. The birds of North America. No. 47. Philadelphia, PA: THe Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [24953]
  • 57. Sibley, Charles G.; Monroe, Burt L., Jr. 1990. Distribution and taxonomy of the birds of the world. New Haven, CT: Yale University Press. 1111 p. [22814]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID IL IN IA KS KY LA ME MD MA
MI MN MS MO MT NE NV NH NJ NM
NY NC ND OH OK OR PA RI SC SD
TN TX UT VT VA WA WV WI WY DC


AB BC MB NB NF NT NS ON PE PQ
SK YK



MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Cowbirds breed from SE Alaska, through lower Canada, through the entire continental U.S. to central Mexico. They winter throughout this range, and also in southern Mexico and the tip of Florida.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Brown-headed Cowbirds are small blackbirds with short cone-shaped bills and long, pointed wings. Males appear black with a unique brown head and neck. Females are either dullish gray or brown. Their bills are a dull grey, while their eyes are black. Adult males weigh between 40 and 50 g, and females are about 10% smaller.

Range mass: 50.0 (high) g.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Average basal metabolic rate: 0.6315 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The cowbird is a small blackbird with a short conical bill and long, pointed wings. Males appear black with a unique brown head and neck. Females are either dullish gray or brown throughout. The bill is a dull grey, while the eyes are black.

Range mass: 40 to 50 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Average basal metabolic rate: 0.6315 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 19 cm

Weight: 49 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brown-headed Cowbirds prefer habitats with low or  scattered trees among grassland vegetation, such as  woodland edges, brushy thickets, prairies, fields,  pastures, orchards, and residential areas.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Requirements

More info for the terms: shrubs, tree

Female brown-headed cowbirds use perches to spot potential host nests;
areas with hidden perches are preferred (i.e., shrubs in grass-dominated
communities) [35].

In Ohio autumn roosts were usually in dense stands of deciduous trees on
moist soils; tree crowns were generally narrow, vertical, and dense [40].
In the Southeast brown-headed cowbirds commonly roost in thickets [24].
  • 24. Hamel, Paul B.; LeGrand, Harry E., Jr.; Lennartz, Michael R.; Gauthreaux, Sidney A., Jr. 1982. Bird-habitat relationships on southeastern forest lands. Gen. Tech. Rep. SE-22. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 417 p. [15423]
  • 35. Lowther, Peter E. 1993. Brown-headed cowbird. In: Poole, A.; Gill, F., eds. The birds of North America. No. 47. Philadelphia, PA: THe Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [24953]
  • 40. Micacchion, Mick; Townsend, T. W. 1983. Botanical characteristics of autumnal blackbird roosts in central Ohio. Ohio Academy of Sciences. 83(3): 131-135. [5620]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: density, shrubs

Brown-headed cowbirds prefer open habitats of low or scattered trees
interspersed with grasslands; they usually avoid unbroken forest. They
prefer, and may require, areas of short grass or bare ground for
foraging [50]. Open coniferous and deciduous woodlands, forest edges,
brushy thickets, agricultural land, and suburban areas are all
acceptable brown-headed cowbird habitat [11,24]. In the Sierra Nevada
brown-headed cowbirds are largely or completely absent from extensive
stands of old-growth forest. They are rare in meadow and riparian areas
more than 16 miles (10 km) from centers of human activities. In areas
close to human activities, brown-headed cowbirds were observed in
meadow-edge communities more often than in clearcuts, partially logged
forests, or uncut forests [70]. In Saskatchewan aspen (Populus spp.)
parklands, brown-headed cowbird abundance increased with increasing
grove size; however, brown-headed cowbirds occupied even very small
groves [29]. In the western states the brown-headed cowbird is more
abundant in second-growth than in old-growth forests, and more abundant
in stands surrounded by a large amount of open land [25]. In North
Dakota mixed-grass prairie, brown-headed cowbird density was higher on
plots with shrubs present than on shrubless plots [5]. In Texas
loblolly pine plantations less than 10 years old, brown-headed cowbirds
were more abundant on plots with snags than on snagless plots [12].

In Pennsylvania a mosaic of even-aged aspen stands (various ages) and
mixed-oak stands (either mature or early successional) was assessed for
use of edges by birds. In mature aspen stands, there was no difference
between brown-headed cowbird use of edge and interior. In stands that
were cut less than 10 years prior to the survey, brown-headed cowbirds
only occupied edges, and they were not present in recently cut (less
than 2 years) stands. In mature oak stands, brown-headed cowbird use
was confined largely to edges; in stands cut less than 10 years prior to
the survey a few brown-headed cowbirds were observed in the interior and
none on the edges [72].
  • 5. Arnold, Todd W.; Higgins, Kenneth F. 1986. Effects of shrub coverages on birds of North Dakota mixed-grass prairies. Canadian Field-Naturalist. 100(1): 10-14. [23671]
  • 11. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 12. Dickson, James G.; Conner, Richard N.; Williamson, J. Howard. 1983. Snag retention increases bird use of a clear-cut. Journal of Wildlife Management. 47(3): 799-804. [13855]
  • 24. Hamel, Paul B.; LeGrand, Harry E., Jr.; Lennartz, Michael R.; Gauthreaux, Sidney A., Jr. 1982. Bird-habitat relationships on southeastern forest lands. Gen. Tech. Rep. SE-22. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 417 p. [15423]
  • 25. Hejl, Sallie J. 1992. The importance of landscape patterns to bird diversity: a perspective from the Northern Rocky Mountains. Northwest Environmental Journal. 8: 119-137. [22066]
  • 29. Johns, Brian W. 1993. The influence of grove size on bird species richness in aspen parklands. Wilson Bulletin. 105(2): 256-264. [22269]
  • 50. Rothstein, Stephen I. 1994. The cowbird's invasion of the Far West: history, causes and dadsf consequences experienced by host species. In: Jehl, J. R., Jr.; Johnson, N. K., eds. A century of avifaunal change in western North America. Studies in Avian Biology. No. 15: 301-315. [24955]
  • 70. Verner, Jared; Ritter, Lyman V. 1983. Current status of the brown-headed cowbird in the Sierra National Forest. Auk. 100: 355-368. [24958]
  • 72. Yahner, Richard H. 1987. Use of even-aged stands by winter and spring bird communities. Wilson Bulletin. 99(2): 218-232. [24959]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the terms: cover, hardwood, presence, shrubs, succession

In Maryland and the District of Columbia, brown-headed cowbirds inhabit
agricultural areas and adjacent woodlands [64].

In the central and southeastern oak (Quercus spp.)-pine (Pinus spp.)
region, brown-headed cowbirds are common to abundant in all successional
stages of central hardwood forest. They are present to common in
loblolly pine (P. taeda)-shortleaf pine (P. echinata) stands in early
stages of succession, but not present in mature loblolly-shortleaf pine
stands [13].

In Kansas a census of floodplain tallgrass prairie taken from 1974 to
1988 revealed 15.4 brown-headed cowbirds per square mile (6/sq km) in
the prairie, but less than 2.6 per square mile (1/sq km) in adjacent
wetlands.

In southwestern South Dakota brown-headed cowbirds are present in Rocky
Mountain juniper (Juniperus scopulorum) communities where fields or
grasslands were interspersed with shrubs or trees. Brown-headed
cowbirds use closed deciduous woodlands (riparian areas) for
reproductive activities [58].

In Texas on the Rio Grande plain, brown-headed cowbirds are common in
thorn forests dominated by blackbrush (Acacia rigidula), guajillo (A.
berlandieri), Texas persimmon (Diospyros texana), and other thorny
shrubs. They are also present in adjacent grasslands and areas cleared
of shrubs for agriculture and cattle grazing [69].

On the lower Colorado River in Arizona, the brown-headed cowbird was one
of a number of granivores that reached their highest densities in common
reed (Phragmites spp.) communities in fall, winter, and spring [1].
Brown-headed cowbirds are more numerous in riparian stands of Fremont
cottonwood (Populus fremontii) than in nearby mesquite (Prosopis spp.)
bosques or saltcedar (Tamarix ramosissima) stands [61].

In southern California brown-headed cowbirds sucessfully breed in
chaparral communities [71].

In Washington shrub-steppe communities dominated by big sagebrush
(Artemisia tridentata) and rubber rabbitbrush (Chrysothamnus nauseosus),
brown-headed cowbirds occurred on 38.7 percent of transects. There was a
positive correlation between observations of brown-headed cowbirds and
big sagebrush cover. The presence of brown-headed cowbirds in this
ecosystem is apparently recent. Shortly after settlement unbroken
sagebrush and bunchgrass landscapes were rapidly degraded and fragmented
by conversion to agriculture and cattle range, creating feeding habitat
for brown-headed cowbirds [14].

REFERENCES :
NO-ENTRY
  • 1. Anderson, Bertin W.; Ohmart, Robert D.; Meents, Julie K.; Hunter, William C. 1984. Avian use of marshes on the lower Colorado River. In: Warner, Richard E.; Hendrix, Kathleen M., eds. California riparian systems: Ecology, conservation, and productive management: Proceedings of a conference; 1981 September 17-19; Davis, CA. Berkeley, CA: University of California Press: 598-604. [5861]
  • 13. Dickson, James G.; Thompson, Frank R., III; Conner, Richard N.; Franzreb, Kathleen E. 1993. Effects of silviculture on neotropical migratory birds in central and southeastern oak pine forests. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1993 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 374-385. [24663]
  • 14. Dobler, Frederick C. 1994. Washington State shrub-steppe ecosystem studies with emphasis on the relationship between nongame birds and shrub and grass cover densities. In: Monsen, Stephen B.; Kitchen, Stanley G., compilers. Proceedings--ecology and management of annual rangelands; 1992 May 18-22; Boise, ID. Gen. Tech. Rep. INT-GTR-313. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 149-161. [24272]
  • 58. Sieg, Carolyn Hull. 1991. Rocky Mountain juniper woodlands: year-round avian habitat. Res. Pap. RM-296. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 7 p. [16110]
  • 61. Stamp, Nancy E. 1978. Breeding birds of riparian woodland in south-central Arizona. Condor. 80: 64-71. [8079]
  • 64. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]
  • 69. Vega, Jorge H.; Rappole, John H. 1994. Composition and phenology of an avian community in the Rio Grande plain of Texas. Wilson Bulletin. 106(2): 366-380. [23933]
  • 71. Wirtz, William O., II. 1991. Avifauna in southern California chaparral: seasonal distribution, habitat association, reproductive phenology. Res. Pap. PSW-RP-209. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station. 19 p. [23431]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

The brown-headed cowbird occurs in all or nearly all SRM types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

The brown-headed cowbird occurs in all or nearly all SAF types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

The brown-headed cowbird occurs in all or nearly all Kuchler types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cowbirds prefer habitats with low or scattered trees among grassland vegetation, such as woodland edges, brushy thickets, prairies, fields, pastures, orchards, and residential areas. Fragmentation of forests has greatly increased the Brown-headed Cowbirds favorite habitat.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Breeding habitat includes woodland, forest (primarily deciduous), forest edge, city parks, suburban gardens, farms, and ranches. Cowbirds often are associated with forest-field edge habitat and clearings in forests. Feedlots, pastures, and fields with livestock also attract cowbirds, especially in predominately forested areas. In the Sierra Nevada of California, cowbirds feed in horse corrals, meadows with herds of cattle, and at bird feeders in towns, and few cowbirds are found more than 10 km from these food sources (Verner and Ritter 1983). In this same area, the number of cowbirds in meadows decreases as the distance of the meadow from pack stations and horse corrals increases. In migration and winter, cowbirds often occur in open situations, cultivated lands, fields, pastures, and scrub.

Before European settlement of the eastern U.S., Brown-headed Cowbirds were apparently limited to the open grasslands of the United States, mostly west of the Mississippi River. However, because the cowbirds need suitable perches for searching for nests to parasitize, the species was probably limited in the breeding season to prairie riparian corridors (Mayfield 1965).

The main reason for cowbird expansion outside of the Great Plains appears to be the fragmentation of once unbroken forest tracts into small pieces of forest interspersed with fields, pastures, roads, and towns (Mayfield 1977b, Kerlinger and Doremus 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern breeding populations are long-distance migrants. Most migrant cowbirds arrive in northern breeding areas in late March-April. Adult males and females arrive first, followed two weeks later by yearling males, who are followed one week later by yearling females (Darley 1982). Southward migration begins in August, peaks in September, and extends into October. Specific timing varies with latitude.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Brown-headed cowbirds often feed on the ground, away from vegetation. Their main food items are seeds and insects. They sometimes hunt in the air, looking for slow flying insects. Their diet is nearly 75% 'weed' seed, with most of the remaining 25% made up of Orthoptera and Coleoptera.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The brown-headed cowbird is a ground gleaner, consuming weed seeds,
grass seeds, waste grain, and insects. Historically it may have
depended on grazing by large ungulates to create suitable feeding
conditions. A common foraging technique is to follow large grazing
animals, gleaning seeds and the insects stirred up by the feet of the
grazer [11,39,35]. Brown-headed cowbirds also feed on insects present
on large ungulates; they have been observed walking on resting bison
(Bison bison), picking insects from the hide [39]. In the northeastern
United States plant foods common in brown-headed cowbird diets include
seeds of bristle grasses (Setaria spp.), ragweeds (Ambrosia spp.), oats
(Avena spp.), corn (Zea mays), crab grasses (Digitaria spp.), knotweeds
and smartweeds (Polygonum spp.), paspalums (Paspalum spp.), and
sheepsorrel (Rumex spp.). In the Southeast plant foods include seeds of
bristle grasses, panic grasses (Panicum spp.), ragweeds, oats, wheat
(Triticum spp.), doveweeds (Croton spp.), corn, and paspalums [36]. A
summary of several dietary studies reveals that approximately 75 percent
of the brown-headed cowbird diet is weed seeds; grasshoppers and beetles
form the larger part of the remaining 25 percent of the diet [35].
  • 11. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 35. Lowther, Peter E. 1993. Brown-headed cowbird. In: Poole, A.; Gill, F., eds. The birds of North America. No. 47. Philadelphia, PA: THe Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [24953]
  • 36. Martin, Alexander C.; Zim, Herbert S.; Nelson, Arnold L. 1951. American wildlife and plants. New York: McGraw-Hill Book Company, Inc. 500 p. [4021]
  • 39. McHugh, Tom. 1958. Social behavior of the American buffalo (Bison bison). Zoologica. 43(1): 1-40. [3981]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Cowbirds often feed on the ground, away from vegetation. Their main food items are seeds and arthropods. They sometimes hawk, looking for slow flying insects. In a quantitative anaylsis of the cowbird diet, it was found that nearly 75% of the diet was 'weed' seed, with most of the remaining 25% made up of grasshoppers and beetles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds almost entirely in open habitats such as pastures, old fields, and prairies (Whitcomb et al. 1981). Diet includes insects (wasps, ants, beetles, grasshoppers and caterpillars), waste grain (corn, wheat, oats, sunflowers, rice), and seeds from noncommercial plants such as panic grass, ragweed (Ambrosia artemisifolia), barnyard grass (Echinochloa crusgalla) and yellow foxtail (Choetochloa glauca) (Friedmann 1929, Bent 1958). Females eat some of the eggs removed from nests (Condor 94:579-584). Nestlings are fed the typical insect diet of their host (Friedmann 1929).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Not only do cowbirds, provide food for many animals, they also help to control insect populations and disperse seeds.

Species Used as Host:

  • Brown-headed Cowbirds have been documented parasitizing the nests of over 140 species of birds, mostly small passerines.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Cowbird eggs can be lost when host species reject them. Not all hosts reject cowbird eggs, but when they do, they may push them out of the nest (for example, Turdus migratorius and Dumetella carolinensis), bury them under a new nest lining (for example, Dendroica petechia), or desert the nest.

Predators on fledgling cowbirds include Coluber constrictor, Elaphe obsoleta, and Cyanocitta cristata. Accipitridae and Strigiformes may also prey on cowbirds as adults. A wide range of nest predators probably takes brown-headed cowbird nestlings, along with those of their hosts, including Cyanocitta cristata, Procyon lotor, Mephitis mephitis, Didelphis virginiana, Corvus brachyrhynchos, Lanius excubitor, and Squamata.

Cowbirds have been known to mob Bubo virginianus.

Known Predators:

  • Turdus migratorius
  • Dumetella carolinensis
  • Tyrannus tyrannus
  • Toxostoma rufum
  • Bombycilla cedrorum
  • Icterus galbula
  • Coluber constrictor
  • Elaphe obsoleta
  • Cyanocitta cristata
  • Procyon lotor
  • Mephitis mephitis
  • Didelphis virginiana
  • Corvus brachyrhynchos

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predators

In northeastern Arkansas short-eared owl (Asio flammeus) pellets
contained brown-headed cowbird remains [60]. Predators on fledglings
include black racer (Coluber constictor), black rat snake (Elaphe
obsoleta), and blue jay (Cyanocitta cristata). Brown-headed cowbirds
join in mobbing great horned owls (Bubo virginianus), a potential
predator of both adults and young [35].
  • 35. Lowther, Peter E. 1993. Brown-headed cowbird. In: Poole, A.; Gill, F., eds. The birds of North America. No. 47. Philadelphia, PA: THe Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [24953]
  • 60. Smith, Ronald A.; Hanebrink, Earl L. 1982. Analysis of regurgitated short-eared owl (Asio flammeus) pellets from the Roth Prairie, Arkansas County, Arkansas. Arkansas Academy of Science Proceedings. 36: 106-108. [22376]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: density, fire exclusion, shrubs

Effects of Fire Exclusion: Fire exclusion in mixed-grass prairie has
allowed shrubs to invade grasslands. In North Dakota brown-headed
cowbird density was higher on shrubby plots than on shrubless plots [5].
  • 5. Arnold, Todd W.; Higgins, Kenneth F. 1986. Effects of shrub coverages on birds of North Dakota mixed-grass prairies. Canadian Field-Naturalist. 100(1): 10-14. [23671]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: altricial, competition, cover, density

Diurnal Activity: In the Sierra Nevada during the breeding season,
brown-headed cowbirds spend the early morning hours in host-rich
forests, then commute up to 2.7 miles (6.7 km) to prime feeding sites
such as residential developments (especially where bird feeders are
present) and horse corrals. Flocks of up to 30 brown-headed cowbirds
may develop at feeding areas. Evening roosting behavior depends on
locality. In the Sierra Nevada flocks of brown-headed cowbirds roost
in willow (Salix spp.) thickets, away from both feeding and breeding
areas. The flocks disperse to breeding areas in the early morning
[51,70].

Spring Migration: The brown-headed cowbird is a short-distance migrant
within North America. In the Northeast most brown-headed cowbirds
travel 300 to 340 miles (800-850 km) between breeding season banding and
winter recovery. Brown-headed cowbirds travel during the day, often as
part of large mixed-species flocks with other blackbirds: red-winged
blackbirds (Agelaius phoeniceus), common grackle (Quiscalus quiscula),
European starling (Sturnus vulgaris), and, less frequently, Euphagus
blackbirds and American robins (Turdus migratorius) [35]. In Maryland
and the District of Columbia, spring movements of brown-headed cowbirds
occur from February 5 to April 25, with a peak of activity from March 10
to April 10 [64].

Mating Systems and Pair Bonding: Brown-headed cowbird mating systems
have been variously reported as monogamous, polygynous, and polygamous
[35,51]. Rothstein and others [51] reviewed reports on mating systems
and could come to no conclusion. Different mating systems may occur
with different densities or sex ratios; males guard mates more
frequently in low density populations. Pair bonding is difficult to
assess due to the difficulty of defining a pair. Bonding may be brief
or season-long [35].

Nesting: The brown-headed cowbird is a brood parasite; no nest is built
and the eggs are laid in the nests of other birds (host species). In
Maryland and the District of Columbia, brown-headed cowbirds lay eggs
from late April to late July, with the peak from early May to early
July. Extreme dates are April 24 and July 28 [64]. In Missouri
brown-headed cowbirds eggs have been present in nests from mid-April
until mid-July [35].

Nests: Female brown-headed cowbirds choose the nest, finding nests in
one of three ways. They may perch in a hidden spot, watching for nest
building activity in nearby open areas; walk on the ground watching for
activity; or search noisily on short flights appearing to intentionally
flush potential hosts from nests [35]. Preferred host nests have eggs
present. Host eggs are usually of smaller volume than brown-headed
cowbird eggs. Preferred nests are active; eggs are added on a daily
basis by the host female. Large diameter (greater than 3 inches [7.6
cm]) closed nests are preferred over small diameter (less than 2 inches
[5.1 cm]) open and closed nests. Large, open nests are least preferred.

Clutch: Brown-headed cowbirds lay eggs in "sequences" of one to seven
eggs (laid daily with pauses of 1 or more days between eggs) and rest
periods of at least 2 days between sequences throughout the breeding
season [54].

Incubation: Since incubation depends on host nesting activity it is
difficult to assess; incubation may be as short as 10 days but is
probably 11 to 12 days. Brown-headed cowbird eggs laid the same day as
host eggs usually hatch first [35].

Development of Young: Brown-headed cowbird hatchlings are altricial and
remain in the nest. Growth is rapid. Brown-headed cowbird nestlings
emerge from the nest onto nearby branches at 8 to 13 days. Short
flights are attempted at 11 days. Fledglings continue to be fed by host
parents until 16 to 28 days after leaving the nest [35].

Territoriality: In the eastern Sierra Nevada, where both hosts and
brown-headed cowbirds are widely dispersed on the breeding areas, there
is no apparent territoriality. Elsewhere, such as in the eastern states
where brown-headed cowbirds are moderately abundant and competition for
host nests is higher, territorial defense is typical. At very high
brown-headed cowbird densities, territoriality is apparently not cost
effective and is rarely observed [51].

Resistant Hosts: Vireos (Vireo spp.) and some warblers (i.e., yellow
warbler [Dendroica petechia]) cover brown-headed cowbird eggs with a new
floor and lay their own eggs on top of it. Yellow-breasted chats
(Icteria virens) abandon nests with foreign eggs [36]. American robins
and gray catbirds (Dumetella carolinensis) usually eject foreign eggs
from the nest. Instances of brown-headed cowbird nest parasitism in
gray catbird nests apparently occur when the brown-headed cowbird egg is
laid before a gray catbird has laid any of its own eggs and has learned
to recognize its own eggs [34,36].

Fall Migration: On western slopes of the Sierra Nevada, juvenile
brown-headed cowbirds began to form flocks as independence was achieved.
The first independent juveniles appeared on July 14. In the same area
all adult brown-headed cowbirds left between July 17 and July 21. In
Maryland and the District of Columbia, fall movements occur from August
15 to December 10, with peak activity from September 25 to November 1
[64].

Roosting Behavior: In the nonbreeding season, brown-headed cowbirds
spend the night in large mixed-species roosts with other blackbirds
[40]. Mixed-species roosts in Kentucky may be as large as 5 million
birds, 2 to 5 percent of which are usually brown-headed cowbirds.
Oklahoma roost numbers peak in November with 250 to 900 thousand birds
[35].

Demography: Males are sexually mature at 1 year but rarely copulate
until they are 2 years old. Females breed at 1 year [35]. Female
brown-headed cowbirds may lay up to 40 eggs in a season [52]. Stable
populations of brown-headed cowbirds would be maintained by 2.5 percent
survival rate and lifetime fecundity of 80 eggs per female. Annual
adult survivorship is 48.5 percent for males and 40.4 percent for
females. The longevity record is 15 years, 10 months for a banded male [35].

Mortality Factors: Lowther [35] reviewed reports of ectoparasites,
helminth parasites, and infectious bacteria in brown-headed cowbirds.
  • 34. Lowther, Peter E. 1980. Gray catbirds rear brown-headed cowbirds. Banding. 52(3): 29-30. [23361]
  • 35. Lowther, Peter E. 1993. Brown-headed cowbird. In: Poole, A.; Gill, F., eds. The birds of North America. No. 47. Philadelphia, PA: THe Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [24953]
  • 36. Martin, Alexander C.; Zim, Herbert S.; Nelson, Arnold L. 1951. American wildlife and plants. New York: McGraw-Hill Book Company, Inc. 500 p. [4021]
  • 40. Micacchion, Mick; Townsend, T. W. 1983. Botanical characteristics of autumnal blackbird roosts in central Ohio. Ohio Academy of Sciences. 83(3): 131-135. [5620]
  • 51. Rothstein, Stephen I.; Verner, Jared; Stevens, Ernest. 1984. Radio-tracking confirms a unique diurnal pattern of spatial occurrence in the parasitic brown-headed cowbird. Ecology. 65(1): 77-88. [24956]
  • 52. Rothstein, Stephen I.; Yokel, David A.; Fleischer, Robert C. 1986. Social dominance, mating & spacing systems, female fecundity, & social vocal dialects in captive and free-ranging brown-headed cowbirds. In: Johnston, Richard F., ed. Current Ornithology. Volume 3. New York: Plenum Press: 127-185. [24957]
  • 54. Scott, D. M.; Ankney, C. Davidson. 1983. The laying cycle of brown-headed cowbirds: passerine chickens?. Auk. 100: 583-592. [24946]
  • 64. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]
  • 70. Verner, Jared; Ritter, Lyman V. 1983. Current status of the brown-headed cowbird in the Sierra National Forest. Auk. 100: 355-368. [24958]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Females hold and defend territories, whereas males have home ranges (0.4-2.5 ha in Ontario; Darley 1982) but do not defend a territory (Ankney and Scott 1982). Breeding and feeding areas of breeding females may be up to several kilometers apart: mean of 1.2 km in Illinois-Missouri; mean of 4.0 km in one area in California (Thompson 1994), and up to 6.7 km in the Sierra Nevada (Rothstein et al. 1980, 1984). NON-BREEDING: Roosts and forages in mixed flocks with red-wing blackbirds (Agelaius phoeniceus) and grackles (Quiscalus quiscula).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Brown-Headed Cowbirds have a wide variety of calls, such as glug glug glee, bublowcomseee, bub ko lum tseee, glug glug, whssss, pseeee, ch'ch'ch'ch'ch,' kek, kik, and tek. They tend to sing in the winter shortly before mating season. They sing most often at sun-rise and almost never sing while in flight. Each individual Cowbird is thought to have an extensive repertoire.  Brown-headed Cowbirds also use their eyesight to distinguish appropriate host species and for communicating among themselves.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known wild Brown-headed Cowbird was 15 years and 10 months old, most do not live nearly as long.

Range lifespan

Status: wild:
15.8 (high) years.

Average lifespan

Status: wild:
202 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
202 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.9 years (wild) Observations: IMR was calculated from demographic data in the wild. Females may lay up to 40 eggs in a season (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating System: monogamous ; polyandrous ; polygynous

Brown-headed Cowbirds lay their eggs in the nests of other birds; female Cowbirds select host nests of another species of bird to lay their eggs in. They wander about, laying eggs in as many nests as they can find and laying up to 40 eggs per season. They lay sequences of 7 eggs, one egg laid in a different nest each day, then rest for several days between egg-laying sequences. The young are then cared for by the host bird. There are 144 different host species documented that raise Brown-headed Cowbird young, so the incubation and parental care of Brown-headed Cowbirds varies greatly depending on the nest in which they are deposited. During the various care processes for Brown-headed Cowbirds, however, they are always fed more often than the young of the host species because they are very active in begging for food from the parents and tend to be bigger than the host species' nestlings. The smallest recorded host of cowbird young is the Brown Creeper, while the largest host is the Meadowlark. Eggs hatch about 9 to 12 days after being laid in the host nest. This is a fairly common length of time for the eggs of the host birds as well. If they survive, they leave the nest in about 8-13 days but continue to be fed by the host parents for between 18 and 35 days. Female Cowbirds are ready to breed when they are 1 year old, but males often take longer. Cowbirds breed between April and June with variation depending on area.

Breeding interval: Females mate several times in a season. They lay their eggs in the nests of many other birds throughout the extended summer breeding season.

Breeding season: Breeding occurs between late April and late July.

Range eggs per season: 40.0 (high) .

Range time to hatching: 12.0 (high) days.

Range fledging age: 16.0 to 28.0 days.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

These birds are brood parasites, they lay their eggs in the nests of other birds. These hosts provide all the parental care.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Brown-headed Cowbird is a brood parasite; the female cowbird selects a host nest of another species of bird to lay her eggs in. She wanders about, parasitizing many nests and laying up to 40 eggs per season. The young are then cared for by the host. 144 different host species have been documented to rear cowbird young, so the incubation and parental care of cowbirds varies greatly depending on the nest in which they are deposited. During the various care processes for the cowbirds, however, they are always fed more often than the young of the host species. The smallest recorded host of cowbird young is the 10 g creeper, while the largest host is the 150 g meadowlark.

Average time to hatching: 11 days.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This is an obligate brood parasite; females always deposit their eggs in the nests of other bird species,usually resulting in the death of some or all of the host species eggs or nestlings. Females never build a nest, incubate eggs, or tend young. Eggs have been found in the nests of more than 200 species, and young cowbirds are known to have been raised by at least 139 host species (Eastzer et al. 1980).

Females usually locate nests to parasitize by watching nest-building activities from a perch (Thompson and Gottfried 1976, 1981), especially in semi-open or open habitats. Females have also been observed walking on the ground in dense woods, quietly searching for activity or nests and noisily flapping through dense shrubbery, supposedly to flush incubating females (Norman and Robertson 1975).

Egg laying, in the nests of other bird species, generally extends from April to July, with most eggs laid in May-June. Individual females lay up to a few dozen eggs each season, but usually much fewer (Jackson and Roby 1992, Holford and Roby 1993). Females may lay eggs in different nests or lay multiple eggs in a single nest. They often, but not always, remove and eat one of the host eggs so that the clutch size is the same when the host female returns. The incubation period (11-12 days, sometimes 10) is often shorter than that of the host species. The host birds feed and tend the nestling and recently fledged cowbirds. A nestling cowbird may weigh up to 10 g when the host nestlings, weighing 1-3 g, hatch and the smaller nestlings are often crushed, crowded out of the nest, or starved (Friedmann 1929, 1963; Mayfield 1965). Cowbird nestlings stay in the nest 10-12 days, begin feeding themselves around day 20-22, and become independent when 25-39 days old (Woodward 1983). Young cowbirds just out of the nest are fed more by the host parent than an equivalent mass of host young. During this period, cowbird young perch at the same height and have the same home ranges as their host (Woodward 1983). Hatching success is not necessarily higher than that of their host species. In Pennsylvania, 57.3% of the eggs of several passerine hosts in unparasitized nests hatched but only 42.6% of the cowbird eggs hatched (Friedmann 1963). Approximately 15% of all cowbird eggs laid in Kansas grasslands resulted in a cowbird young leaving the nest (Zimmerman 1983). Cowbird survival in the nest is similar to host nestling survival but, in Vancouver, cowbird survival was much lower after leaving the nest, possibly because the young cowbird's loud begging calls may attract predators (Smith 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Molothrus ater

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCNTATACCTAATTTTCNGTGCATGNACCGGAATGGTAGGTACCGCTCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATGATCGGAGGGTTCGGAAACTGATTAGTACCCCTAATAATCGGAGCCCCAGATATGGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTCCTAGCATCTTCCACGGTTGAGGCAGGCGTAGGCACAGGCTGAACAGTATACCCCCCACTAGCGGGAAATCTAGCTCACGCCGGAGCCTCAGTCGACCTCGCAATTTTCTCACTACATCTAGCCGGTATCTCTTCGATCCTAGGAGCAATCAACTTTATTACAACAGCAGTCAACATAAAACCACCCGCCCTGTCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTATTACTTCTATCCCTCCCAGTCCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGCAACCTTAACACCACATTCTTTGATCCTGCTGGAGGAGGAGACCCTGTACTGTACCAACACCTGTTCTGATTCTTCGGTCACCCAGAAGTCTATATCCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Molothrus ater

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brown-headed Cowbirds are common. They do, however, pose a threat to the populations of other birds, such as the Kirtland's Warbler, Black-Capped Vireo, and Least Bell's Vireo, whose small populations are frequently parasitized by Brown-headed Cowbirds. This has led to programs that involve trapping and killing of Brown-headed Cowbirds at specific breeding areas where other species are threatened.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The cowbird is common. It does, however, pose a threat to the populations of other birds, such as the Kirtland's Warbler, Black-capped Vireo, and Least Bell's Vireo, whose small populations are frequently parasitized by the Brown-headed Cowbird. This has led to programs that involve trapping of the cowbirds at specific breeding areas where other species are threatened.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Increased range as forested areas were cleared during human settlement; increases were related to more abundant forest edge habitat and to increased food supplies (e.g., in pastures, feedlots). Overall, population trend is downward; breeding populations throughout the west coast ranges, northern Rockies, and much of the eastrn U.S. (except coastal areas from New England to the Deep South) are declining; populations within interior basins, ranges, deserts, and most of the northern prairie are increasing; perhaps declines are related to reduced availability of farm grain (data analysis by S. Droege, North American Breeding Bird Survey 1966-1993, Christmas Bird Count 1959-1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Considerations

More info for the terms: cover, density, presence

Range Expansion: Historically brown-headed cowbirds were largely
confined to the mid-continental prairies where they presumably followed
herds of nomadic bison, and perhaps pronghorn (Antilocapra americana)
and elk (Cervus canadensis) as well [46]. The brown-headed cowbird
underwent a rapid range expansion with habitat alterations due to forest
clearing, domestic cattle grazing, urbanization, and conversion of
forested habitats to agricultural land [46]. It invaded the Great Lakes
States and the Northeast during the nineteenth century [44].

Root and Weckstein [49] reported that brown-headed cowbird winter range
has recently expanded into Maine and Nova but has contracted elsewhere,
particularly Pennsylvania, Michigan, Wisconsin, Iowa, Montana, and
Washington. He speculated that the trapping of brown-headed cowbirds in
Michigan (for preservation of the Kirtland's warbler [Dendroica
kirtlandii]) that removed more than 40,000 brown-headed cowbirds was
partly responsible for this unexpected phenomenon. Breeding Bird Survey
(BBS) data from 1965 to 1979 indicate that brown-headed cowbirds have
been increasing in the Southeast, including the Carolinas and southern
Georgia [44]. Colonization of the Sierra Nevada by brown-headed
cowbirds has taken place in the last 50 years [51]. Expansion into the
western states is due largely to rapid colonization by dwarf cowbirds
[32,50]. Rothstein [50] stated that the separation of breeding and
feeding areas has allowed much of this range expansion. Since
brown-headed cowbirds can commute up to 3 miles (7 km) between breeding
areas and feeding areas, creation of feeding habitat (i.e., pack
stations, horse corrals, suburban developments, and bird feeders) within
formerly continuous forest has opened new areas for brown-headed cowbird
breeding [50]. In the Sierra Nevada brown-headed cowbird numbers
dropped sharply with distance from pack stations; they were always
present when horses were present [70].

Population Status: Estimates of the North American population of
brown-headed cowbirds range from 20 to 40 million individuals [63].
Graber and Graber [76] estimated the 1957 brown-headed cowbird
population of Illinois as 1.1 million. The estimated brown-headed
cowbird population in North Dakota in 1972 was approximately 1 million,
with a maximum density of 15.2 pairs per square mile (5.9 pairs/sq km)
[63].

Brown-headed cowbird populations have increased throughout the twentieth
century in most sections of the United States. In the Northeast,
brown-headed cowbirds have experienced a statistically significant
population decrease [59]. A ranking system for neotropical migrants
(including brown-headed cowbird) listed the population trend for
brown-headed cowbird in Alaska as unknown (no data), decreasing in
Arizona (uncertain due to small size of the BBS), slightly increasing in
Idaho (also uncertain due to small BBS sample), and sharply increasing
in Montana [75]. In Oregon brown-headed cowbird populations increased
in juniper woodlands between 1899 and 1983, although they decreased
significantly statewide [35,55]. In the Sierra Nevada brown-headed
cowbird populations increased between 1966 and 1985 [43]. Breeding Bird
Survey data for the Midwest suggest a decrease in brown-headed cowbird
populations for the period 1966 to 1981, but an increase from 1982 to
1991 [66]. Significant population increases (BBS data 1966-1987)
occurred in Georgia, North Carolina, Iowa, North Dakota, Utah, and
Colorado. Significant decreases occurred in Minnesota, Michigan,
Wisconsin, New York, Rhode Island, Ohio, Ontario, West Virginia,
Tennessee, New Brunswick, Oklahoma, and Texas [35]. Another
interpretation of BBS data indicates a generally negative trend for the
United States but a sharply increasing trend for Illinois during the
period 1966 to 1991 [26].

Host Species: Because of range expansion the brown-headed cowbird has
come into recent contact with many new potential host species, most of
which lack defenses against nest parasitism. Numbers of parasitized
species have increased in the last half century; new parasitism records
for species continue to be reported making estimation of the number of
parasitized species difficult. Stewart and Robbins [64] listed 223
parasitized species in the United States. In their area (Maryland and
the District of Columbia), the species most heavily parasitized were
red-eyed vireo (Vireo olivaceous), song sparrow (Melospiza melodia), and
chipping sparrow (Spizella passerina) [64]. In 1985, Friedmann and Kiff
[73] listed 240 species known to be parasitized, the majority of which
are neotropical migrant songbirds. Lowther [35] reported that 144
species have actually reared brown-headed cowbird young. Over the
entire United States the top 17 species with over 100 records of fledged
brown-headed cowbirds are yellow warbler, song sparrow, red-eyed vireo,
chipping sparrow, eastern phoebe (Sayornis phoebe), rufous-sided towhee
(Pipilo erythrophthalmus), ovenbird (Seiurus aurocappilus), common
yellowthroat (Geothylpis trichas), American redstart (Setophaga
ruticilla), indigo bunting (Passerina cyanea), yellow-breasted chat,
red-winged blackbird, Kentucky warbler (Oporomis formosis), willow
flycatcher (Empidonax traillii), Bell's vireo (Vireo bellii),
yellow-throated vireo (V. flavescens), and field sparrow (Spizella
pusilla) [35]

Brown-headed cowbirds reduce host productivity because 1) females remove
one egg from 33 to 90 percent of host nests, 2) brown-headed cowbird
eggs are thick-shelled, often causing breakage of host eggs, 3)
brown-headed cowbird eggs have a shorter incubation period than those of
host species, 4) host nestlings are usually smaller and less aggressive
than brown-headed cowbird nestlings, and 5) brown-headed cowbird
nestlings grow more rapidly, beg louder, and have larger gapes (bigger
mouths) than host nestlings [46].

Threats to Endangered Species: Brown-headed cowbird parasitism is one
of the variables used in a scoring method to determined species
prioritization for songbird conservation [28]. Several neotropical
migrant songbirds with restricted ranges are endangered at least partly
as a result of brown-headed cowbird nest parasitism, including
Kirtland's warbler [37,48], Bell's vireo [42,48], golden-cheeked warbler
(Dendroica chrysoparia) [48], black-capped vireo (V. atricapillus), and
willow flycatcher [46,48,53]. The precise effect of nest parasitism on
willow flycatcher has not been clearly established, however. For willow
flycatcher and most of the other endangered species affected by
brown-headed cowbird parasitism, there is a complex interaction between
direct effects due to habitat loss and indirect effects related to nest
parasitism [50].

Threat to Other Species: Brown-headed cowbirds pose a potential threat
to many neotropical migrant songbirds. Brown-headed cowbirds feed
mostly in short grass communities including shortgrass prairie,
pastures, and lawns; and on bare ground. Feeding areas are enhanced by
human activities [46]. At least 10 species of songbirds have declined
since brown-headed cowbirds have expanded their range into California,
possibly due to brown-headed cowbird nest parasitism [50]. On the
western slopes of the Sierra Nevada, no host species is immediately
threatened, but increased human use of backcountry areas and increased
fragmentation of dense forests will increase potential feeding areas for
brown-headed cowbirds [70]. Low intensity monitoring for neotropical
migrant conservation may include checks for cowbird parasitism every 3
years in management areas; monitoring is recommended for the western
Sierra Nevada [15,70]. Airola [2] recommended that any development
activities should be far from the highest densities of potential host
species.

Parasitism Rates and Habitat Parameters: Brown-headed cowbird nest
parasitism has been enhanced by shifts in agricultural practice and
farmland structure in this century. There is a higher rate of
brown-headed cowbird parasitism near field edges with elevated perches
than away from field edges and perches [48]. Brown-headed cowbirds are
often more abundant on edges than in interior. Parasitism rates are
higher near forest edges and edges of prairie fragments [19]. In the
eastern deciduous forest, numbers of brown-headed cowbirds and rates of
parasitism decrease with distance from forest edges [9]. According to
Brittingham and Temple [9] forest fragmentation leads to higher levels
of nest parasitism by increasing the ratio of forest edge to forest
interior (defined as area more than 990 feet [300 m] from an edge). In
the Midwest brown-headed cowbird parasitism is negatively correlated
with forest cover [47]. Nest parasitism is low (less than 10% of all
potential host nests) in extensively forested sections of Mark Twain and
Hoosier National Forests (Missouri and Indiana, respectively) [46].
However, Robinson and others [47] reported that in a highly fragmented
landscape with a long history of brown-headed cowbird presence, there
was no appreciable decline in nest parasitism even more than 2,310 feet
(700 m) from the nearest edge. They speculated that in this area,
brown-headed cowbirds have saturated all available host nests because
brown-headed cowbird populations are high and host populations are
minimal. In addition, brown-headed cowbird populations in the most
highly fragmented areas may be more limited by host availability than
feeding sites or forest density [47].

In western states and particularly in the Sierra Nevada, availability of
local feeding areas such as livestock corrals and pack stations is
associated with increased levels of brown-headed cowbird nest parasitism
[46]. Bock and others [8] listed the brown-headed cowbird as either
unresponsive or showing mixed or uncertain response to grazing in
grasslands in the western states but showed a positive response to
domestic cattle grazing in shrub-steppe communities. Robinson and
others [46] concluded the magnitude of edge effect on brown-headed
cowbird parasitism rates varies within and among regions in relation to
landscape level variation in fragmentation and brown-headed cowbird
abundance.

Management Recommendations/Cowbird Control: Methods for removal of
brown-headed cowbirds from critical breeding habitat for neotropical
migrants include trapping and shooting individuals, and roost kills.
The use of baited decoy traps to capture and kill female brown-headed
cowbirds has reduced the rate of nest parasitism and increased nesting
success for a few species. It is thought that this action was the key
element in stabilizing populations of Kirtland's warbler [38,46]. In
1971 Mayfield [37] predicted that the Kirtland's warbler would be
extinct by 1980 if brown-headed cowbirds were not controlled. An
extensive program of trapping and shooting of brown-headed cowbirds was
initiated in 1972. The Kirtland's warbler population did not rebound,
but remained stabilized (with very low levels of nest parasitism) until
there was a slight population increase in 1991 and 1992 [38]. In other
cases use of decoys and shooting of female brown-headed cowbirds has
effectively reduced nest parasitism rates [32,46]. Removal of
brown-headed cowbirds from riparian habitats occupied by Bell's vireos
has resulted in increased Bell's vireo productivity [22].

It is not clear whether brown-headed cowbird trapping at the landscape
level would reduce nest parasitism in extensively fragmented landscapes
such as the Midwest. Large-scale elimination of brown-headed cowbirds
at winter roosts may reduce overall numbers of brown-headed cowbirds,
but this approach may not affect target songbird populations in breeding
habitats. Winter banding programs are needed to determine movements of
brown-headed cowbirds and the feasibility of winter trapping for
population reduction in critical areas [32].

The ethical implications of large-scale eradication of the brown-headed
cowbird, a native songbird, need to be considered [46]. The
brown-headed cowbird is protected under the Migratory Bird Treaty Act
[68]. Trapping and killing female brown-headed cowbirds is at best a
temporary solution to excessive nest parasitism. The most complete
solution is landscape level management including consolidation of
ownership to preserve large tracts of forest, reduction or elimination
of brown-headed cowbird feeding areas within large tracts, and
minimization of edge [47]. Shape of forest tracts influences the ratio
of edge to interior. Long narrow areas like riparian woodlands have
very little interior area. Forest tracts in simple square or circle
shapes have the greatest interior to edge ratios [19]. Riparian
corridors need to be wide [46]. In the case of willow flycatcher in
California, protection of high-elevation riparian areas and meadows from
grazing and/or pack animals is recommended to reduce the threat of
brown-headed cowbird parasitism [53]. Laymon [32] recommended
elimination of grazing near riparian areas and removal of feedlots,
stables, and dairies in critical areas, and reforestation of riparian
areas. Robbins and others [45] suggested that in the mid-Atlandtic
States, 7,410 acres (3,000 ha) of contiguous forest is the minimum
required for population maintenance of other songbirds in the presence
of brown-headed cowbird parasitism. Data from moderately fragmented
areas of the Midwest suggest that 49 thousand to 1.2 million acres
(20,000-50,000 ha) may be necessary. In Texas the Biological Advisory
Team [74] suggested that 4,940 to 12,700 acres (2,000-5,000 ha) are
needed to minimize the effects of brown-headed cowbird parasitism on the
golden-cheeked warbler [46].

REFERENCES :
NO-ENTRY
  • 2. Airola, Daniel A. 1986. Brown-headed cowbird parasitism and habitat disturbance in the Sierra Nevada. Journal of Wildlife Management. 50(4): 571-575. [24948]
  • 8. Bock, Carl E.; Saab, Victoria A.; Rich, Terrell D.; Dobkin, David S. 1993. Effects of livestock grazing on neotropical migratory landbirds in western North America. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 296-309. [24618]
  • 9. Brittingham, Margaret Clark; Temple, Stanley A. 1983. Have cowbirds caused forest songbirds to decline?. Bioscience. 33: 31-35. [24949]
  • 15. Droege, Sam. 1993. Monitoring neotropical migrants on managed lands: when, where, why. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 189-191. [10040]
  • 19. Faaborg, John, Brittingham, Margaret; Donovan, Therese; Blake, John. 1993. Habitat fragmentation in the temperate zone: a perspective for managers. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1993 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 331-338. [24662]
  • 22. Franzreb, Kathleen E. 1989. Ecology and conservation of the endangered least Bell's vireo. U.S. Fish and Wildlife Service Biological Report 89(1). Washington, DC. 17 p. [24942]
  • 26. Herkert, James R. 1994. The effects of habitat fragmentation on midwestern grassland bird communities. Ecological Applications. 4(3): 461-471. [24146]
  • 28. Hunter, William C.; Carter, Michael F.; Pashley, David N.; Barker, Keith. 1993. The partners in flight species prioritzation scheme. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 109-119. [2433]
  • 32. Laymon, Stephen A. 1987. Brown-headed cowbirds in California: historical perspectives and management opportunities in riparian habitats. Western Birds. 18: 63-70. [24951]
  • 35. Lowther, Peter E. 1993. Brown-headed cowbird. In: Poole, A.; Gill, F., eds. The birds of North America. No. 47. Philadelphia, PA: THe Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [24953]
  • 37. Mayfield, Harold F. 1975. The numbers of Kirtlands's warblers. Jack-Pine Warbler. 53(2): 39-47. [24989]
  • 38. Mayfield, Harold F. 1993. Kirtland's warblers benefit from large forest tracts. Wilson Bulletin. 105(2): 351-353. [22270]
  • 42. Olson, Thomas E.; Gray, M. Violet. 1989. Characteristics of least Bell's vireo nest sites along the Santa Ynez River. In: Proceedings of the California riparian systems conference: Protection, management, and restoration for the 1990's; 1988 September 22-24; Davis, CA. Gen. Tech. Rep. PSW-110. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station: 278-284. [14447]
  • 43. Raphael, Martin G.; Morrison, Michael L.; Yoder-William, Michael P. 1987. Breeding bird populations during twenty-five years of postfire succession in the Sierra Nevada. Condor. 89: 614-626. [24941]
  • 44. Robbins, Chandler S.; Bystrak, Danny; Geissler, Paul H. 1986. The breeding bird survey: its first fifteen years, 1965-1979. Resource Publication 157. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 196 p. [24549]
  • 45. Robbins, Chandler S.; Dawson, Deanna K.; Dowell, Barbara A. 1989. Habitat area requirements of breeding forest birds of the Middle Atlantic States. Wildlife Monographs. 103: 1-34. [24947]
  • 46. Robinson, Scott K.; Grzybowski, Joseph A.; Rothstein, Stephen I.; [and others]
  • 47. Robinson, Scott K.; Thompson, Frank R., III; Donovan, Therese M.; [and others]
  • 48. Rodenhouse, Nicholas L.; Best, Louis B.; O'Connor, Raymond J.; Bollinger, Eric K. 1993. Effects of temperate agriculture on neotropical migrant landbirds. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 280-295. [23441]
  • 49. Root, Terry L.; Weckstein, Jason D. 1994. Changes in distribution patterns of select wintering North American birds form 1901 to 1989. In: Jehl, J. R., Jr.; Johnson, N. K., eds. A century of avifaunal change in western North America. Studies in Avian Biology. No. 15: 191-201. [24954]
  • 50. Rothstein, Stephen I. 1994. The cowbird's invasion of the Far West: history, causes and dadsf consequences experienced by host species. In: Jehl, J. R., Jr.; Johnson, N. K., eds. A century of avifaunal change in western North America. Studies in Avian Biology. No. 15: 301-315. [24955]
  • 51. Rothstein, Stephen I.; Verner, Jared; Stevens, Ernest. 1984. Radio-tracking confirms a unique diurnal pattern of spatial occurrence in the parasitic brown-headed cowbird. Ecology. 65(1): 77-88. [24956]
  • 53. Sanders, Susan D.; Flett, Mary Anne. 1989. Montane riparian habitat and willow flycatchers: threats to a sensitive environment and species. In: Abell, Dana L., technical coordinator. Proceedings of the California riparian systems conference: Protection, management, and restoration for the 1990's; 1988 September 22-24; Davis, CA. Gen. Tech. Rep. PSW-110. Berkeley, CA:U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station: 262-266. [14010]
  • 55. Sharp, Brian. 1985. Avifaunal changes in central Oregon since 1899. Western Birds. 16: 63-70. [24940]
  • 59. Smith, Charles R.; Pence, Diane M.; O'Connor, Raymond J. 1993. Status of neotropical migratory birds in the Northeast: a preliminary assessment. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 172-188. [17614]
  • 63. Stewart, Robert E.; Kantrud, Harold A. 1972. Population estimates of breeding birds in North Dakota. Auk. 89: 766-788. [23410]
  • 64. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]
  • 66. Thompson, Frank R.; Lewid, Stephen J.; Green, Janet; Ewert, David. 1993. Status of neotropical migrant landbirds in the Midwest: identifying species of management concern. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 145-158. [21273]
  • 68. U.S. Department of the Interior, Fish and Wildlife Service. 1990. Title 50, Code of federal regulations, Part 10: General provisions. FWS/LE Reg. 10. Washington, DC. 15 p. [23848]
  • 70. Verner, Jared; Ritter, Lyman V. 1983. Current status of the brown-headed cowbird in the Sierra National Forest. Auk. 100: 355-368. [24958]
  • 73. Friedmann, Herbert; Kiff, Lloyd F. 1985. The parasitic cowbirds and their hosts. Proceedings of the Western Foundation of Vertebrate Zoology. 2: 226-304. [24950]
  • 74. Biological Advisory Team. 1990. Comprehensive report of the Biological Advisory Team for the Balcones Canyonlands Habitat Conservation Plan. Austin, TX: City of Austin, Environmental Division. 80 p. Unpublished report. [27372]
  • 75. Carter, Michael F.; Barker, Keith. 1993. An interactive database for setting conservation priorities for western neotropical migrants. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 120-144. [16259]
  • 76. Kline, Patricia; Broersma, Klaas; Wright, Scott B. M.; Rode, Lyle M. 1993. Meadow foxtail: A production guide. Publication 1890/E. Ottawa, ON: Agriculture Canada. 23 p. [26080]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preserve Selection and Design Considerations: The main reason for the recent spread of the cowbird's breeding distribution appears to be a dramatic increase in the amount of field-forest edge habitat and increased availability of feeding areas. Therefore, the best long-term control of cowbirds probably is to eliminate as much field-forest edge habitat as possible and to reduce the number of nearby food sources. With endangered populations with very limited distributions, removing cowbirds is probably the optimal method for immediately reducing the incidence of cowbird parasitism.

Management Requirements: TRAPPING: An effective but labor-intensive method of rapidly decreasing cowbird parasitism in a small region is to live-trap the birds in decoy traps baited with grain or seeds (Shake and Mattsson 1975). The cowbirds are then removed and destroyed. In the Kirtland's warbler project in Michigan, blackbird traps operating between May 1 and July 15 successfully removed cowbirds within a 1 km radius area of the trap and during 1972-1981, 33,536 cowbirds were removed (Mayfield 1977). The parasitism rates of warbler nests dropped from 74.6% during 1957-1971 to 6.1% during 1972-1977 (Walkinshaw 1983). Cowbird removal substantially increased warbler reproductive success. During 1966-1971, an average of 0.8 warblers survived to leave the nest, and this number increased to 2.7 warblers per nest after cowbird removal (Walkinshaw 1983).

ELIMINATION OF EDGE: Because parasitism rates are highest near forest-field edges (Gates and Gysel 1978, Johnson pers. comm.), one method of cowbird control may be to eliminate as much edge habitat as possible. In grasslands, nest parasitism by cowbirds can be reduced by removing any structures that provide an observation perch, such as fences, posts, telephone lines, or fencerows. In all habitats, preserves can be designed with a high ratio of non-edge, "interior" habitat to edge habitat. Efforts should be made to avoid fragmenting large tracts of forest or grasslands into smaller pieces with more field-forest edge. Finally, the nearby presence of livestock or supplemental food (e.g., pastures, feedlots, grain fields) may attract cowbirds and should be reduced or eliminated, if possible.

See Glahn et al. (1991) for information on the impact of ground-based surfactant roost control treatments on local urban and agricultural blackbird/starling problems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Fragmentation of forest habitat in North America has resulted in a great increase in the edge habitats favored by Brown-headed Cowbirds, and a reduction (and in many places an elimination) of forest-interior habitats that they do not penetrate. As a result, a number of other forest birds' nests are now being used by Brown-headed Cowbirds at a much increased rate. This parasitism may be one cause in the general decrease in numbers of songbirds in North America.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The cowbird eats many insects which are pests to humans.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Fragmentation of forest habitats in North America has resulted in a great increase in the edge habitats favored by cowbirds, and a reduction (and in many places an elimination) of forest-interior habitats that cowbirds do not penetrate. As a result, a number of species of forest birds are now subject to increasing parasitism by cowbirds. Cowbird parasitism may be one cause in the general decrease in numbers of songbirds in North America.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The cowbird eats many insects which are pests to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: In areas where cowbirds are detrimentally impacting the reproduction of native birds, the following actions may be appropriate:

Reduce or eliminate the amount of forest-field edge habitat by removing fencerows and other perches in grasslands and designing preserves with proportionally larger amounts of "interior" habitat and less forest-field edge habitat.

Reduce or eliminate livestock herds and supplementary feeding areas, such as agricultural fields, feedlots, and bird feeders.

Trap and remove cowbirds.

Species Impact: Cowbird parasitism apparently is contributing to the decline of some songbird populations by reducing the reproductive success of the host species. In the eastern U.S., birds have only recently been exposed to brood parasitism (Mayfield 1977, Brittingham and Temple 1983) and many species lack appropriate responses to minimize the impact of cowbird parasitism. Cowbird parasitism has contributed to the decline in numbers of endangered species such as Kirtland's warbler (Dendroica kirtlandii), least Bell's vireo (VIREO BELLI PUSILLUS), southwestern willow flycatcher (Empidonax traillii EXTIMUS), and black-capped vireo (Vireo atricapillus) (Robinson et al. 1995). Because cowbirds do not rely on just one host, parasitism pressure usually does not relax even when a single host's numbers decrease.

Friedmann (1963) summarized the reactions of hosts to cowbird eggs. Female hosts may 1) continue laying and incubating eggs without apparently noticing the cowbird eggs, 2) throw out the strange eggs, 3) bury the eggs by building a new floor to the nest, or 4) desert the nest. Most of the lower reproductive success experienced by hosts is from egg mortality caused by nest desertion or removal of host eggs by the female cowbird (Gates and Gysel 1978, Smith 1981). In Kirtland's warbler, unparasitized clutches averaged 4.4 eggs but parasitized nests contained an average of only 2.2 warbler eggs (Walkinshaw 1983). Nonparasitized dickcissel (Spiza americana) nests averaged 4.0 eggs while parasitized nests contained an average of 2.4 dickcissel eggs (Zimmerman 1983). In most species, fewer host young fledge in parasitized nests than in unparasitized nests (Friedmann 1963). For instance, Smith (1981) estimated that cowbird parasitism reduced the average number of song sparrows (Melospiza melodia) alive at age six days by 0.38 young.

Parasitism rates vary according to host species (Friedmann 1929, 1963) and habitat (Gates and Gysel 1978, Brittingham and Temple 1983) and vary within a species' range (Mayfield 1965, Zimmerman 1983). On a community-wide basis, some reported parasitism rates include 30.8% of the nests in central Pennsylvania, 13.2% in eastern Washington, 22.4% in Michigan and 1% and 21% in the Sierra Nevada (Ricklefs 1969, Verner and Ritter 1983). The birds most prone to parasitism are open-nesting species that are smaller than cowbirds, have a longer incubation period, feed insects to their young, and do not desert or destroy cowbird eggs. Most of the host species are flycatchers, finches, vireos, and warblers (Friedmann 1929). Within a species, the rate of parasitism can vary greatly. For instance, in a study in Ontario, there was no parasitism of red-eyed vireo (Vireo olivaceus) nests but 72.2% of nests in Michigan were parasitized (Friedmann 1963). In the center of the dickcissel's range, parasitism rates vary from 31% to 95% (Zimmerman 1983).

Timing of breeding can also determine how seriously a host is affected by cowbird parasitism. Cowbirds generally breed from early May through early July; any single-brooded species that breeds outside of this period, and double-brooded species, are less affected by cowbird parasitism (Friedmann 1963, Zimmerman 1983). In a Michigan study, only 3% of the nests failed because of parasitism in May, July, and August, while 11% of the June nests were parasitized (Gates and Gysel 1978). Cowbird parasitism rates can differ among habitat types. The nesting substrate of the host may be important. In riparian habitats of central Iowa, cowbirds did not parasitize nests in deciduous or evergreen trees but did parasitize nests (at a rate of 6-8%) in deciduous saplings, shrubs, forbs, and grass (Best and Stauffer 1980). In a study on the effect of fire on field sparrows (Spizella pusilla) in Iowa, Best (1979) found that two years before a burn 11% of the nests were parasitized by cowbirds. The first season after the late April burn, in which almost all of the herbaceous vegetation and litter was completely burned, no parasitized sparrow nests were found.

In Michigan, Gates and Gysel (1978) found that as distance from the forest-field edge increased, the rate of parasitism decreased. Johnson (pers. comm.) obtained similar results in Minnesota prairies. Nests less than 45 m from the prairie-forest edge had a higher probability of being parasitized than did prairie nests farther than 45 m from an edge (Johnson pers. comm.). One possible reason for the increased rate of parasitism near forest-field edges is because there is a higher density of host nests in edge habitats (Gates and Gysel 1978) and this may attract more cowbirds. In addition, edge provides observation perches nest-searching females. Brittingham and Temple (1983) studied the incidence of cowbird parasitism in Wisconsin deciduous forests in areas with openings such as campgrounds, fields, and logged areas. Forest nests within 100 m of a forest opening >0.2 ha had a parasitism rate of 65% while only 18% of the nests more than 300 m from an opening were parasitized. Cowbirds fed in open areas and parasitized nests that were the shortest distances from feeding areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown-headed Cowbird

Brown-headed cowbird, one call

The Brown-headed Cowbird (Molothrus ater) is a small brood parasitic icterid of temperate to subtropical North America. They are permanent residents in the southern parts of their range; northern birds migrate to the southern United States and Mexico in winter, returning to their summer habitat around March or April.[2]

Description[edit]

The Brown-headed Cowbird is typical for an icterid in general shape but is distinguished by a finch-like head and beak and is smaller than most icterids. The adult male is iridescent black in color with a brown head. The adult female is slightly smaller and is dull grey with a pale throat and very fine streaking on the underparts. The total length is 16–22 cm (6.3–8.7 in) and the average wingspan is 36 cm (14 in).[3] Body mass can range from 30–60 g (1.1–2.1 oz), with females averaging 38.8 g (1.37 oz) against the males' average of 49 g (1.7 oz).[4]

Ecology[edit]

Brown-headed Cowbird male (right) courting female

They occur in open or semi-open country and often travel in flocks, sometimes mixed with Red-winged Blackbirds (particularly in spring) and Bobolinks (particularly in fall), as well as Common Grackles or European Starlings.[2] These birds forage on the ground, often following grazing animals such as horses and cows to catch insects stirred up by the larger animals. They mainly eat seeds and insects.

Before European settlement, the Brown-headed Cowbird followed bison herds across the prairies. Their parasitic nesting behaviour complemented this nomadic lifestyle. Their numbers expanded with the clearing of forested areas and the introduction of new grazing animals by settlers across North America. Brown-headed Cowbirds are now commonly seen at suburban birdfeeders.

Reproduction[edit]

Eastern Phoebe nest with one Brown-headed Cowbird egg
Juvenile in California

This bird is a brood parasite: it lays its eggs in the nests of other small passerines (perching birds), particularly those that build cup-like nests. The Brown-headed Cowbird eggs have been documented in nests of at least 220 host species, including hummingbirds and raptors.[5][6] The young cowbird is fed by the host parents at the expense of their own young. Brown-headed Cowbird females can lay 36 eggs in a season. More than 140 different species of birds are known to have raised young cowbirds.[7]

Unlike the Common Cuckoo, it has no gentes whose eggs imitate those of a particular host.

Some species, such as the House Finch, feed their young a vegetarian diet. This is unsuitable for young Brown-headed Cowbirds, meaning almost none survive to fledge.[8]

Male behavior and reproductive success[edit]

Social behaviors of cowbird males include aggressive, competitive singing bouts with other males and pair-bonding and monogamy with females. By manipulating demographics so juveniles only had access to females, juvenile males developed atypical social behavior; they did not engage in the typical social singing bouts with other males, did not pair bond with females, and were promiscuous. This demonstrates that there is great flexibility in the behavior of cowbirds, and that the social environment is extremely important in structuring their behavior. Adult males housed with juvenile males were shown to have greater reproductive success compared to adult males housed with other adult males. Being housed with juvenile males honed the reproductive skills of the adult males by providing them with a more complex social environment. This finding was further studied by comparing the behaviors and reproductive success of males exposed to a dynamic flock, consisting of changing individuals, with males exposed to a static group of individuals. The individuals that stayed with the same group had a stable, predictable relationship between social behavior and reproductive success; the males that sang high amounts to females experienced the greatest reproductive success. The adult males that were exposed to a rotating roster of new individuals had an unpredictable relationship between social variables and reproductive success; these males were able to copulate using a much greater variety of social strategies. The males who lived in static flocks had high levels of consistency in their behaviors and reproductive success across multiple years. The males in dynamic flocks experienced varying levels of dominance with other males, differing levels of singing to females, and differing levels of reproductive success.[9]

Brood parasitism[edit]

Behavior[edit]

Brown-headed cowbirds do not raise their own young, instead laying their eggs in the nests of other bird species. Because of this, cowbirds are not exposed to species-typical visual and auditory information unlike other birds. Despite this, cowbirds are able to develop species-typical singing, social, and breeding behaviors.[9]

Host response[edit]

The acceptance of a cowbird egg and rearing of a cowbird can be costly to a host species. In the American Redstart, nests parasitized by cowbirds were found to have a higher rate of predation, likely due in part to the loud begging calls by the cowbird nestling, but also partly explained by the fact that nests likely to be parasitized are also more likely to be predated.[10]

Host birds sometimes notice the cowbird egg, to which different host species react in different ways. Rejection manifests in three forms: nest desertion (e.g., Blue-gray Gnatcatcher), burying of the egg under nest material (e.g., Yellow Warbler),[11] and physical ejection of the egg from the nest (e.g., Brown Thrasher).[6] Brown-headed Cowbird nestlings are also sometimes expelled from the nest. The Gray Catbird rejects cowbird eggs over 95% of the time; experimentation has suggested that in this species, the cost of accepting an egg is much higher (0.79 catbird fleglings) than the cost of rejecting an egg (0.0022 catbird fledglings).[12]

Nestlings of host species can also alter their behavior in response to the presence of a cowbird nestling. Song Sparrow nestlings in parasitized nests alter their vocalizations in frequency and amplitude so that they resemble the cowbird nestling, and these nestlings tend to be fed equally often as nestlings in unparasitized nests.[13]

Parasite response[edit]

It seems that Brown-headed Cowbirds periodically check on their eggs and young after they have deposited them. Removal of the parasitic egg may trigger a retaliatory reaction termed "mafia behavior". According to a study by the Florida Museum of Natural History published in 1983, the cowbird returned to ransack the nests of a range of host species 56% of the time when their egg was removed. In addition, the cowbird also destroyed nests in a type of "farming behavior" to force the hosts to build new ones. The cowbirds then laid their eggs in the new nests 85% of the time.[14]

Human intervention[edit]

Humans sometimes engage in cowbird control programs, with the intention of protecting species negatively impacted by the cowbirds' brood parasitism. A study of nests of Bell's Vireo highlighted a potential limitation of these control programs, demonstrating that removal of cowbirds from a site may create an unintended consequence of increasing cowbird productivity on that site, because with fewer cowbirds, fewer parasitized nests are deserted, resulting in greater nest success for cowbirds.[15]

References[edit]

  1. ^ BirdLife International (2012). "Molothrus ater". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bull. 18 (2): 47–60. 
  3. ^ Brown-headed Cowbird, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2013-03-09.
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0849342585.
  5. ^ Friedman and Kiff, Herbert and Lloyd F. (1985-05-16). "The parasitic cowbirds and their hosts". Proceedings of the Western Foundation of Vertebrate Zoology 2 (4): 225–304. 
  6. ^ a b Ortega, C.P. (1998) Cowbirds and Other Brood Parasites. University of Arizona Press, Tucson, ISBN 0816515271.
  7. ^ Jaramillo, Alvaro; Peter Burke (1999). New World Blackbirds: The Iceterids. London: Christopher Helm. p. 382. 
  8. ^ Kozlovic, Knapton, and Barlow, Daniel R., Richard W., and Jon C. (1996). "Unsuitability of the House Finch as a Host of the Brown-Headed Cowbird" (PDF). The Condor 96 (2). Retrieved 2008-07-25. 
  9. ^ a b White, D.J.; Gersick, A.S.; Snyder-Mackler, N. (2012). "Social Networks and the Development of Social Skills in Cowbirds". Philosophical Transactions of the Royal Society B: Biological Sciences 367 (1597): 1892–900. 
  10. ^ Hannon, Susan J.; Wilson, Scott; McCallum, Cindy A. (2009). "Does cowbird parasitism increase predation risk to American redstart nests?". Oikos 118 (7): 1035–1043. doi:10.1111/j.1600-0706.2008.17383.x. 
  11. ^ Sealy, Spencer g. (April 1995). "Burial of cowbird eggs by parasitized yellow warblers: an empirical and experimental study". Animal Behaviour (The Association for the Study of Animal Behaviour) 49 (4): 877–889. doi:10.1006/anbe.1995.0120. Retrieved 2008-07-25. 
  12. ^ Lorenzana, J. C. (2001). "Fitness costs and benefits of cowbird egg ejection by Gray Catbirds". Behavioral Ecology 12 (3): 325–329. doi:10.1093/beheco/12.3.325. 
  13. ^ Pagnucco, K.; Zanette, L.; Clinchy, M.; Leonard, M. L (2008). "Sheep in wolf's clothing: host nestling vocalizations resemble their cowbird competitor's". Proceedings of the Royal Society B: Biological Sciences 275 (1638): 1061–1065. doi:10.1098/rspb.2007.1706. 
  14. ^ Hoover, Jeffrey P. &. Robinson, Scott K. (2007). "Retaliatory mafia behavior by a parasitic cowbird favors host acceptance of parasitic eggs". PNAS 104 (11): 4479–4483. doi:10.1073/pnas.0609710104. 
  15. ^ Kosciuch, Karl L.; Sandercock, Brett K. (2008). "Cowbird removals unexpectedly increase productivity of a brood parasite and the songbird host". Ecological Applications 18 (2): 537–548. doi:10.1890/07-0984.1. PMID 18488614. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

The currently accepted scientific name for brown-headed cowbird is
Molothrus ater (Boddaert) [4,57]. It is a member of the family
Emberizidae [35]. The three recognized subspecies are as follows:

M. a. ssp. ater, brown-headed cowbird
M. a. ssp. obscurus, dwarf cowbird
M. a. ssp. artemisiae, western or sagebrush cowbird [3,4,35].

Introgression between western and dwarf cowbirds has been occurring
since contact in the 1930's in the Sierra Nevada. The size of western
cowbirds in the area of overlap has been decreasing [21].
  • 35. Lowther, Peter E. 1993. Brown-headed cowbird. In: Poole, A.; Gill, F., eds. The birds of North America. No. 47. Philadelphia, PA: THe Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [24953]
  • 57. Sibley, Charles G.; Monroe, Burt L., Jr. 1990. Distribution and taxonomy of the birds of the world. New Haven, CT: Yale University Press. 1111 p. [22814]
  • 3. American Ornithologists' Union. 1957. Checklist of North American birds. 5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p. [21235]
  • 4. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 21. Fleischer, Robert C.; Rothstein, Stephen I. 1988. Known secondary contact and rapid gene flow among subspecies and dialects in the brown-headed cowbird. Evolution. 42(6): 1146-1158. [24943]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common Names

brown-headed cowbird
cowbird
buffalo bird

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Range-wide mtDNA data reveal no evidence of long-standing population separations (Ball and Avise 1992). See Fleischer et al. (1991) for information on gene flow between subspecies OBSCURUS and ARTEMISIAE in the Sierra Nevada, California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!