Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

The bright orange and black Baltimore Oriole (Icterus galbula) was named in reference to the colors of the coat of arms of the 17th century Lord Baltimore. These orioles are widespread in North America east of the Great Plains during the northern summer and winter mainly from Mexico south to northern Colombia, northern Venezuela, and Trinidad, although small numbers may winter in the southeastern United States and Greater Antilles.

As a result of frequent hybridization between the Bullock's (I. bullockii) and Baltimore Orioles where their ranges meet in the Great Plains, these two orioles were at one time treated as conspecific (i.e., members of the same species), representing two forms of a species that was known as the Northern Oriole. However, genetic studies have indicated that these two species are not even each other’s closest relatives (for a full discussion of this issue, see Jacobsen and Omland 2011).

Baltimore Orioles breed in deciduous and mixed woodlands, usually in open woods or along edges rather than in the interior of dense forests. They may be common in towns and other relatively developed areas with appropriate trees (especially elms). The familiar nest of the Baltimore Oriole is a hanging pouch woven of plant fibers and may be seen in shade trees in towns and suburbs. The nest is typically attached firmly by its rim near the end of a slender drooping branch 6 to 9 (sometimes 2 to 18 or more) meters above the ground. There are 4 to 5 eggs (range 3 to 6) eggs. Eggs are incubated by the female for around 12 to 14 days. Nestlings are fed by both parents and leave the nest around 12 to 14 days after hatching.The diet include mainly insects in summer, especially caterpillars, including hairy types avoided by many other birds. They also consume many berries and sometimes cultivated fruit. They may feed on nectar from some flowers and will take sugar water at feeders. The liquid, musical tones of the Baltimore Oriole's song floating down from the treetops are a familiar harbinger of spring in the eastern United States.

(Kaufman 1996; AOU 1998)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Jacobsen, F. and K.E. Omland. 2011. Species tree inference in a recent radiation of orioles (Genus Icterus): Multiple markers and methods reveal cytonuclear discordance in the northern oriole group. Molecular Phylogenetics and Evolution 61: 460-469.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Baltimore orioles are neotropical migrants. They spend summers in the Nearctic, primarily the eastern United States. They breed from Wisconsin to Maine and south to central Mississippi and Alabama, northern Georgia, and western South Carolina and North Carolina. They winter in the neotropics as far north as Mexico and sometimes the southern coast of the United States.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Harrison, H. 1975. A field guide to birds' nests. Boston: Houghton Mifflin Company.
  • National Geographic Society, 1999. Field guide to the birds of North America. Washington, D.C.: National Geographic Society.
  • Peterson, R. 1980. A field guide to the birds. Boston: Houghton Mifflin Company.
  • Peterson, R. 1990. A field guide to western birds. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Breeding range extends from central Alberta, central Saskatchewan, southern Manitoba, western Ontario, northern Michigan, southern Ontario, southwestern Quebec, central Maine, southern New Brunswick, and central Nova Scotia south to eastern Texas, central regions of Gulf coast states except Florida (accidental), north-central Georgia, western South Carolina, central North Carolina, central Virginia, Maryland, and Delaware, and west to the western edge of the Great Plains (AOU 1998). Range during the northern winter extends from Nayarit and Veracruz (casually from coastal California and Sonora) south through Middle America to northern Colombia, northern Venezuela, and Trinidad, regularly in small numbers in the Atlantic states north to Virginia, in the Greater Antilles east to the Virgin Islands, and casually elsewhere in eastern North America (AOU 1998). This species migrates regularly through the southeastern and south-central United States and northeastern Mexico, and in coastal California, rarely through the northern Bahama Islands and Yucatan Peninsula, and casually elsewhere in western North America (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Baltimore orioles are neotropical migrants. They spend summers in the Nearctic, primarily the eastern United States. They breed from Wisconsin to Maine and south to central Mississippi and Alabama, northern Georgia, and western South Carolina and North Carolina. They winter in the neotropics as far north as Mexico and sometimes the southern coast of the United States.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Harrison, H. 1975. A field guide to birds' nests. Boston: Houghton Mifflin Company.
  • National Geographic Society, 1999. Field guide to the birds of North America. Washington, D.C.: National Geographic Society.
  • Peterson, R. 1980. A field guide to the birds. Boston: Houghton Mifflin Company.
  • Peterson, R. 1990. A field guide to western birds. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E N America (s Canada to s US); > to n South America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult birds are 17 to 20 cm long, somewhat smaller than a robin. There is sexual dimorphism in plumage and in size; males are 1-5% larger than females in a variety of measurements. Adult males have a black head, bill, and back, and a bright orange breast, rump, and underparts. Their wings are black with orange and white wing bars, and the tail is orange with black streaks. Adult females are paler than males, olive-brown to orange. Their wings are brown with white wing bars, and the bill is gray. She may have traces of black on her head. Immature animals are variable, but typically resemble the female. Males take over a year to reach adult plumage.

Range mass: 28 to 42 g.

Range length: 17 to 20 cm.

Range wingspan: 9 to 10 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Average basal metabolic rate: 0.5052 W.

  • Tekiela, S. 1999. Birds of Michigan field guide. Cambridge, Minnesota: Adventure Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Adult birds are 17 to 20 cm long, somewhat smaller than a robin. There is sexual dimorphism in plumage and in size; males are 1-5% larger than females in a variety of measurements. Adult males have a black head, bill, and back, and a bright orange breast, rump, and underparts. Their wings are black with orange and white wing bars, and the tail is orange with black streaks. Adult females are paler than males, olive-brown to orange. Their wings are brown with white wing bars, and the bill is gray. She may have traces of black on her head. Immature animals are variable, but typically resemble the female. Males take over a year to reach adult plumage.

Range mass: 28 to 42 g.

Range length: 17 to 20 cm.

Range wingspan: 9 to 10 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Average basal metabolic rate: 0.5052 W.

  • Tekiela, S. 1999. Birds of Michigan field guide. Cambridge, Minnesota: Adventure Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 22 cm

Weight: 34 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Baltimore orioles prefer open woods, with a strong preference for deciduous over coniferous trees. They are very adaptable, however, and can be found breeding in a variety of habitats. They are rare on farmlands but have adapted well to urban parks and suburban landscapes. In Mexico, they winter in flowering canopy trees over shade coffee plantations.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Greenberg, R., P. Bichier, J. Sterling. 1997. Bird populations in rustic and planted shade coffee plantations of Eastern Chiapas, Mexico. Biotropica, 29 (4): 501-514.
  • Jobin, B., J. Des Granges, C. Boutin. 1998. Farmland habitat use by breeding birds in southern Quebec. Canadian Field-Naturalist, : 611-618.
  • Rising, J., N. Flood. 1998. Baltimore Oriole. The Birds of North America, No. 384: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Habitat includes open woodland, deciduous forest edge, riparian woodland, partly open situations with scattered trees, orchards, and groves of shade trees. In migration and winter this oriole also occurs in humid forest edge, second growth, and scrub; treetop level in coffee and cacao plantations, and savanna groves. Nests are placed in trees, an average of around 25-30 feet (8-9 meters) above ground, usually at the end of a drooping branch.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltimore orioles prefer open woods, with a strong preference for deciduous over coniferous trees. They are very adaptable, however, and can be found breeding in a variety of habitats. They are rare on farmlands but have adapted well to urban parks and suburban landscapes. In Mexico, they winter in flowering canopy trees over shade coffee plantations.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Greenberg, R., P. Bichier, J. Sterling. 1997. Bird populations in rustic and planted shade coffee plantations of Eastern Chiapas, Mexico. Biotropica, 29 (4): 501-514.
  • Jobin, B., J. Des Granges, C. Boutin. 1998. Farmland habitat use by breeding birds in southern Quebec. Canadian Field-Naturalist, : 611-618.
  • Rising, J., N. Flood. 1998. Baltimore Oriole. The Birds of North America, No. 384: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Most Baltimore orioles migrate north through the southeastern United States in March-April, arrive in the northern states and Canada in April-May; males precede females by a few days. Southward migration begins in late July or early August and continues in the United States through August and September and sometimes later. South-bound migrants arrives in Costa Rica early September, depart by early May (Stiles and Skutch 1989). The species is present in South America mostly October-April (Ridgely and Tudor 1989).

Most individuals from eastern North America probably cross Gulf of Mexico en route to winter range (Rohwer and Manning 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Baltimore orioles eat primarily caterpillars, including many pest species. They also eat other insects, some small fruits, and nectar. They are an important predator of the nuisance forest tent caterpillar, Malacosoma disstria, which it eats in both its larval and pupal forms. Large larvae are seized and smashed against a twig to break them open and avoid the setae (stiff, hair-like structures). Pupae are pulled out of their cocoon.

In suburban and rural areas, I. glabula can be attracted to feeders by providing orange halves, grape jelly, or artificial nectar. Adults who come to feeders will take their young to the feeder once they are fledged.

Baltimore orioles eat primarily caterpillars, including many pest species. They also eat other insects, some small fruits, and nectar. They are an important predator of the nuisance forest tent caterpillar, which it eats in both its larval and pupal forms. Large larvae are seized and smashed against a twig to break them open and avoid the setae (stiff, hair-like structures). Pupae are pulled out of their cocoon.

In suburban and rural areas, Baltimore orioles can be attracted to feeders by providing orange halves, grape jelly, or artificial nectar. Adults who come to feeders will take their young to the feeder once they are fledged.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: fruit; nectar

Primary Diet: carnivore (Insectivore )

  • Parry, D., J. Spence, W. Volney. 197. Responses of natural enemies to experimentally increased populations of the forest tent caterpillar *Malacosoma disstria*. Ecological Entomology, : 97-108.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Gleans insects, especially caterpillars, from trees and shrubs; also eats various fruits (Terres 1980) and nectar (Stiles and Skutch 1989). South America: often feeds in flowering trees (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Baltimore orioles eat primarily caterpillars, including many pest species. They also eat other insects, some small fruits, and nectar. They are an important predator of the nuisance Malacosoma disstria, which it eats in both its larval and pupal forms. Large larvae are seized and smashed against a twig to break them open and avoid the setae (stiff, hair-like structures). Pupae are pulled out of their cocoon.

In suburban and rural areas, Baltimore orioles can be attracted to feeders by providing orange halves, grape jelly, or artificial nectar. Adults who come to feeders will take their young to the feeder once they are fledged.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: fruit; nectar

  • Parry, D., J. Spence, W. Volney. 197. Responses of natural enemies to experimentally increased populations of the forest tent caterpillar *Malacosoma disstria*. Ecological Entomology, : 97-108.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Baltimore orioles are important predators on insects in the communities in which they live. Because they live in forested areas and prey on caterpillars, the lifestage at which many insects do most damage to plants, they are especially important in protecting forest trees from damage.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltimore orioles have many different kinds of predators, including larger birds and mammals. Most predators take eggs, nestlings, or fledglings. In western Massachusetts, avain predators caused 16% of egg losses and 9% of nestling and fledgling losses. In response to predators, both males and females give alarm calls, and chase and mob (harass) predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Flowering Plants Visited by Icterus galbula in Illinois

Icterus galbula Linnaeus: Icteridae, Passeriformes
(this is the Baltimore Oriole; this bird perforates [prf] the flowers of Trumpet Creeper to steal the nectar [sn@prf]; this observation is from Bertin)

Bignoniaceae: Campsis radicans prf sn@prf np (Brt)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Baltimore orioles are important predators on insects in the communities in which they live. Because they live in forested areas and prey on caterpillars, the lifestage at which many insects do most damage to plants, they are especially important in protecting forest trees from damage.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Baltimore orioles have many different kinds of predators, including larger birds and mammals. Most predators take eggs, nestlings, or fledglings. In western Massachusetts, avain predators caused 16% of egg losses and 9% of nestling and fledgling losses. In response to predators, both males and females give alarm calls, and chase and mob (harass) predators.

Known Predators:

  • common grackles (Quiscalus_quiscula)
  • American crows (Corvus_brachyrhynchos)
  • eastern screech owls (Otus_asio)
  • blue jays (Cyanocitta_cristata)
  • black-billed magpies (Pica_pica)
  • red squirrels (Tamiasciurus_hudsonicus)
  • fox squirrels (Sciurus_niger)
  • eastern gray squirrels (Sciurus_carolinensis)
  • domestic cats (Felis_silvestris)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Icterus galbula (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) is prey of:
Accipiter striatus
Accipiter cooperii
Bubo virginianus

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Icterus galbula (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) preys on:
Araneae
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Nonbreeding: usually in groups of 2-5 (rarely 15), in definite home ranges; sometimes large communal roosts (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The male sings all summer. His song is rich and flute-like, with each individual having a distinct song. The female song is generally shorter and simpler. The call, from both sexes, is a whistled "hew-li." Nestlings beg loudly.

Baltimore orioles also use postures and movements to communicate, such as male courtship displays, female wing-flutter displays, and nestling wing-flutters when begging for food.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

The male sings all summer. His song is rich and flute-like, with each individual having a distinct song. The female song is generally shorter and simpler. The call, from both sexes, is a whistled "hew-li." Nestlings beg loudly.

Baltimore orioles also use postures and movements to communicate, such as male courtship displays, female wing-flutter displays, and nestling wing-flutters when begging for food.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest recorded Baltimore oriole in the wild lived to 11 years and 7 months old. They have been recorded living 14 years in captivity.

Range lifespan

Status: wild:
11.5 (high) years.

Range lifespan

Status: captivity:
14 (high) years.

Average lifespan

Status: wild:
139 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest recorded Baltimore oriole in the wild lived to 11 years and 7 months old. They have been recorded living 14 years in captivity.

Range lifespan

Status: wild:
11.5 (high) years.

Range lifespan

Status: captivity:
14 (high) years.

Average lifespan

Status: wild:
139 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Baltimore orioles are generally considered monogamous, although evidence suggests that extra-pair copulation is reasonably common. In the spring, males display to females on their territory by singing and/or chattering while hopping from perch to perch in front of her. Males give a bow display, bowing with wings lowered and tail fanned. Some females ignore these displays while others sing and give calls or a wing-quiver display in response. The wing-quiver display involves leaning forward, often with tail partly fanned, and fluttering or quivering slightly lowered wings.

Mating System: monogamous ; polygynandrous (promiscuous)

Males arrive on breeding grounds in the spring a few days before females. Courtship displays by the male consist of bowing, to show off the bright orange front and black back, and singing. The female builds a woven pouch nest hanging from the end branches of trees, well concealed by leaves. She builds a new nest each year with little or no help from the male. Icterus galbula prefers to build in elms, maples, willow, or apples, twenty-five to thirty feet above the ground. Any available plant and animal fibers may be used.

The female lays four to six eggs, typically four. The eggs are pale grayish or bluish white, irregularly blotched and streaked with browns and black. The female incubates for twelve to fourteen days. Both parents feed the nestlings. Fledglings will stay with their parents for two weeks, and are fed by their parents duing that period. Baltimore orioles lay only one brood per season.

Breeding interval: Baltimore orioles breed once yearly.

Breeding season: Breeding occurs from May to June.

Range eggs per season: 3 to 7.

Average eggs per season: 4.

Range time to hatching: 11 to 14 days.

Average time to hatching: 12 days.

Average time to independence: 2 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 4.

The female alone broods nestlings; the male occasionally feeds the brooding female, but she usually forages for herself. Parents feed nestlings by regurgitation during the first few days of the nesting period.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Bent, A. 1965. Life histories of North American blackbirds, orioles, tanagers, and allies. New York: Dover Publications, Inc.
  • Harrison, H. 1975. A field guide to birds' nests. Boston: Houghton Mifflin Company.
  • Rising, J., N. Flood. 1998. Baltimore Oriole. The Birds of North America, No. 384: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In most areas, nesting begins in May (or late April in southern locations). Clutch size is 3-6 (commonly 4-5). Incubation, by the female, lats 12-14 days. Young are tended by both parents, leave nest at 12-14 days, generally in June oe early July. Yearling males (in their second calendar year) resemble adult females but nevertheless may successfully attract a mate and raise young. This species ejects brown-headed cowbird eggs from the nest (Sealy and Neudorf 1995, Condor 97:369-375).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltimore orioles usually find one mate for a breeding season, but may mate with more than one other bird as well.

In the spring, males try to attract mates to their territory by singing or chattering while hopping from perch to perch in front of her. Males give a bow display, bowing with wings lowered and tail fanned. Interested females sing and give calls or a wing-quiver display in response. The wing-quiver display involves leaning forward, often with tail partly fanned, and fluttering or quivering slightly lowered wings.

Mating System: monogamous ; polygynandrous (promiscuous)

Males arrive on breeding grounds in the spring a few days before females. Courtship displays by the male consist of bowing, to show off the bright orange front and black back, and singing. The female builds a woven pouch nest hanging from the end branches of trees, well concealed by leaves. She builds a new nest each year with little or no help from the male. Baltimore orioles prefer to build nests in elms, maples, willow, or apples, twenty-five to thirty feet above the ground. Any available plant and animal fiber may be used in nest-building.

The female lays four to six eggs, typically four. The eggs are pale grayish or bluish white, irregularly blotched and streaked with browns and black. The female incubates them for twelve to fourteen days. Both parents feed the nestlings. Fledglings will stay with their parents for two weeks, and are fed by both parents during that period. Baltimore orioles lay only one brood per season.

Breeding interval: Baltimore orioles breed once yearly.

Breeding season: Breeding occurs from May to June.

Range eggs per season: 3 to 7.

Average eggs per season: 4.

Range time to hatching: 11 to 14 days.

Average time to hatching: 12 days.

Average time to independence: 2 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

The female alone broods nestlings; the male occasionally feeds the brooding female, but she usually forages for herself. Parents feed nestlings by bringing up already-eaten food from their crops during the first few days of the nesting period.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Bent, A. 1965. Life histories of North American blackbirds, orioles, tanagers, and allies. New York: Dover Publications, Inc.
  • Harrison, H. 1975. A field guide to birds' nests. Boston: Houghton Mifflin Company.
  • Rising, J., N. Flood. 1998. Baltimore Oriole. The Birds of North America, No. 384: 1-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Icterus galbula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTGACCGATGATTATTCTCAACCAACCACAAAGACATCGGAACCCTATATCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTCCTGGGAGACGACCAGGTCTACAACGTAGTTGTTACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGGGGATTCGGCAACTGACTAGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCTTTCCTCCTCCTCCTAGCATCCTCTACAGTTGAAGCAGGAGTAGGTACAGGTTGAACAGTGTACCCCCCACTAGCAGGTAACCTAGCCCATGCTGGAGCTTCAGTCGACCTTGCAATTTTCTCACTACACCTAGCTGGTATCTCTTCAATCCTAGGGGCAATCAATTTTATTACAACCGCAATCAATATAAAACCCCCTGCCCTCTCACAATACCAAACTCCCCTATTTGTATGATCAGTATTAATCACCGCAGTACTCCTACTCCTATCCCTTCCGGTCCTCGCTGCAGGGATCACAATACTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCCGCCGGGGGAGGAGACCCTGTACTATACCAACACCTTTTCTGATTCTTCGGCCATCCAGAGGTGTACATCTTAATTCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Icterus galbula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Baltimore orioles are protected by the Migratory Bird Treaty Act. They may be at risk due to habitat loss, as they prefer wooded areas, but this is not well documented. Although direct human impacts on oriole populations are unknown, the increase in number of orioles wintering in temperate North America may be due to an increase in bird feeders in backyards and elsewhere.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltimore orioles are protected by the Migratory Bird Treaty Act. They may be at risk due to habitat loss, as they prefer wooded areas, but this is not well documented. Although direct human impacts on oriole populations are unknown, the increase in number of orioles wintering in temperate North America may be due to an increase in bird feeders in backyards and elsewhere.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Baltimore orioles may occasionally damage crops of peas or small fruits.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltimore orioles are attractive songbirds that will come to feeders. They are generally liked by both serious birdwatchers and casual backyard enthusiasts for both their appearance and song. They are also important predators on some insect pests such as forest tent caterpillars.

Positive Impacts: ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Sometimes a pest of citrus crops in the winter range (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Baltimore orioles may occasionally damage crops of peas or small fruits.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Baltimore orioles are attractive songbirds that will come to feeders. They are generally liked by both serious birdwatchers and casual backyard enthusiasts for both their appearance and song. They are also important predators on some insect pests such as Malacosoma disstria.

Positive Impacts: ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Baltimore oriole

This article is about the New World blackbird. For the Major League Baseball team, see Baltimore Orioles.

The Baltimore oriole (Icterus galbula) is a small icterid blackbird common in eastern North America as a migratory breeding bird. It received its name from the resemblance of the male's colors to those on the coat-of-arms of Lord Baltimore. Like all New World orioles, it is named after an unrelated, physically similar family found in the Old World: the Oriolidae. At one time, this species and the Bullock's oriole, Icterus bullockii, were considered to be a single species called the northern oriole.

The Baltimore oriole is the state bird of Maryland. It is also the inspiration for the Baltimore Orioles baseball club.

Description[edit]

This medium-sized passerine measures 17–22 cm (6.7–8.7 in) in length and spans 23–32 cm (9.1–12.6 in) across the wings. Their build is typical of icterids, as they have a sturdy body, a longish tail, fairly long legs and a thick, pointed bill. The body weight averages 33.8 g (1.19 oz), with a range of weights from 22.3 to 42 g (0.79 to 1.48 oz).[2] The male oriole is slightly larger than the female, although the size dimorphism is minimal by icterid standards.[3][4][5] Adults always have white bars on the wings. The adult male is orange on the underparts shoulder patch and rump, with some birds appearing a very deep flaming orange and others appearing yellowish-orange. All of the rest of the male's plumage is black. The adult female is yellow-brown on the upper parts with darker wings, and dull orange-yellow on the breast and belly. The juvenile oriole is similar-looking to the female, with males taking until the fall of their second year to reach adult plumage.

Distribution and habitat[edit]

Juvenile in Maryland, United States

Baltimore orioles are found in the Nearctic in summer, primarily the eastern United States. They breed from Minnesota to Maine and south to central Mississippi and Alabama and northern Georgia. They migrate to winter in the Neotropics as far north as Mexico and sometimes the southern coast of the United States, but predominantly in Central America and northern South America. Some areas of the southern United States may retain orioles all winter if they have feeders that appeal to them. The range of this bird overlaps with that of the similar Bullock's oriole in the Midwest, and the two species were once considered to be conspecific under the name northern oriole because they form fertile hybrids. The Baltimore oriole is a rare vagrant to Western Europe.

Baltimore orioles are often found high up in large, leafy deciduous trees, but do not generally reside in deep forests. The species has been found in summer and migration in open woodland, forest edge, and partially wooded wetlands or stands of trees along rivers. They are very adaptable and can breed in a variety of secondary habitats. In recent times, they are often found in orchards, farmland, urban parks and suburban landscapes as long as they retain woodlots. In Mexico, they winter in flowering canopy trees, often over shade coffee plantations.[6]

Behavior[edit]

Voice[edit]

The male sings a loud flutey whistle, with a buzzy, bold quality, a familiar sound in much of the eastern United States. The male typically sings from the tree canopy, often giving away its location before being sighted.

Male Baltimore oriole singing

Problems playing this file? See media help.

Breeding[edit]

Baltimore orioles are basically solitary outside their mating season. The species is generally considered monogamous, although evidence suggests that extra-pair copulation is reasonably common. In the spring, males establish a territory then display to females by singing and chattering while hopping from perch to perch in front of them. Males also give a bow display, bowing with wings lowered and tail fanned. Depending on their receptiveness, the females may ignore these displays or sing and give calls or a wing-quiver display in response. The wing-quiver display involves leaning forward, often with tail partly fanned, and fluttering or quivering slightly lowered wings.

The Baltimore oriole's nest is built by the female. It is a tightly woven pouch located on the end of a branch, consisting of any plant or animal materials available, hanging down on the underside. Trees such as elms, cottonwoods, maples, willows or apples are regularly selected, with the nest usually located around 7 to 9 m (23 to 30 ft) above the ground. The female lays three to seven eggs, with the norm being around four. The eggs are pale gray to bluish white, measuring 2.3 cm × 1.6 cm (0.91 in × 0.63 in) on average. The incubation period is 12 to 14 days. Once the nestlings hatch, they are fed by regurgitation by both parents and brooded by the female for two weeks. After this the young start to fledge, becoming largely independent shortly thereafter. If the eggs, young, or nest are destroyed, the oriole is unable to lay a replacement clutch.[6]

Mortality[edit]

Predation is a common source of mortality, typically also occurring with eggs, nestlings and fledgings. Common predators at Baltimore oriole nests can include common grackles, American crows, blue jays, black-billed magpies, tree squirrels and domestic cats, which most commonly capture newly fledged orioles or adults engaged in brooding behavior. Rapacious birds commonly prey on both young and fully-grown orioles, the most prolific being the eastern screech owl and Cooper's and sharp-shinned hawks. Somewhat larger rapacious birds also sometimes opportunistically predate the oriole, including peregrine falcons, great horned owls, and barn owls, while merlins may do so while orioles are migrating.[7][8] In d fledgling losses [6][9]

The record lifespan for a wild bird was 11 years and 7 months, with captive orioles living up to 14 years.

Feeding[edit]

Baltimore orioles forage in trees and shrubs, also making short flights to catch insects. They acrobatically clamber, hover and hang among foliage as they comb high branches. They mainly eat insects, berries and nectar, and are often seen sipping at hummingbird feeders. Their favored prey is perhaps the forest tent caterpillar moth, which they typically eat in their larval stage, and can be a nuisance species if not naturally regulated by predation. The larvae caterpillar are beaten against a branch until their protective hairs are skinned off before being eaten. Unlike American robins and many other fruit-eating birds, Baltimore orioles seem to prefer only ripe, dark-colored fruit. Orioles seek out the darkest mulberries, the reddest cherries, and the deepest-purple grapes, and will ignore green grapes and yellow cherries even if they are ripe. Baltimore orioles sometimes use their bills in an unusual way, called "gaping": they stab the closed bill into soft fruits, then open their mouths to cut a juicy swath from which they drink with their tongues. During spring and fall, nectar, fruit and other sugary foods are readily converted into fat, which supplies energy for migration.

Many people now attract Baltimore orioles to their backyards with oriole feeders. Such feeders contain essentially the same food as hummingbird feeders, but are designed for orioles, and are orange instead of red and have larger perches. Baltimore orioles are also fond of halved oranges, grape jelly and, in their winter quarters, the red arils of gumbo-limbo (Bursera simaruba).[10] If they discover a well-kept feeder, orioles lead their young there.

Footnotes[edit]

  1. ^ BirdLife International (2012). "Icterus galbula". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  3. ^ Baltimore Oriole, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2012-08-23.
  4. ^ ADW: Icterus galbula: INFORMATION. Animaldiversity.ummz.umich.edu. Retrieved on 2012-08-23.
  5. ^ Baltimore Orioles, Baltimore Oriole Pictures, Baltimore Oriole Facts – National Geographic. Animals.nationalgeographic.com. Retrieved on 2012-08-23.
  6. ^ a b c Rising, J., N. Flood. 1998. Baltimore Oriole: The Birds of North America, No. 384: 1–32.
  7. ^ Bent, A. C. 1958. Life histories of North American blackbirds, orioles, tanagers, and allies. U.S. Natl. Mus. Bull. 211.
  8. ^ Schaefer, V. H. 1976. Geographic variation in the placement and structure of oriole nests. Condor 78:1976.
  9. ^ Pank, L. F. 1974. Nesting biology of the Baltimore Oriole. Master's Thesis. Univ. of Massachusetts, Amherst.
  10. ^ Foster, Mercedes S. (2007). "The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico". Bird Conservation International 17: 45. doi:10.1017/S0959270906000554. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly considered conspecific with I. BULLOCKII under the name I. GALBULA (Northern Oriole) but resplit into separate species by AOU (1995). See AOU (1995, 1998) for a brief summary of the bases for the split.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!