Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lophophanes cristatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophophanes cristatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATNTAATCTTCGGCGCATGAGCCGGAATAGTGGGAACAGCCCTGAGCCTCCTCATTCGTGCAGAACTCGGCCAACCCGGCGCCCTCCTTGGAGACGACCAGATCTACAACGTGGTCGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATGCCAATCATAATCGGGGGATTTGGGAACTGACTAGTCCCTCTAATAATCGGAGCCCCTGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTCCTACCCCCCTCCTTCCTCCTCCTACTAGCCTCCTCTACCGTGGAAGCAGGCGCAGGTACAGGATGAACAGTATACCCCCCCCTAGCCGGCAACCTGGCCCACGCCGGAGCATCAGTAGACCTGGCCATCTTCTCCCTCCACTTAGCAGGTATCTCCTCAATCCTAGGAGCAATCAACTTCATCACAACCGCAATCAACATAAAACCGCCTGCCCTTTCACAATACCAAACCCCTCTATTCGTCTGATCCGTACTAATCACCGCAGTACTCCTACTGCTCTCACTCCCAGTCCTCGCCGCCGGCATCACCATACTCCTCACTGATCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCAGTGCTCTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European Crested Tit

"Crested Tit" redirects here. For the Crested Tit species from southeast Asia, Lophophanes dichrous, see Grey Crested Tit.

The European crested tit, or simply crested tit (Lophophanes cristatus) (formerly Parus cristatus), is a passerine bird in the tit family Paridae. It is a widespread and common resident breeder in coniferous forests throughout central and northern Europe and in deciduous woodland in France and the Iberian peninsula. In Great Britain, it is chiefly restricted to the ancient pinewoods of Inverness and Strathspey in Scotland, and seldom strays far from its haunts. A few vagrant crested tits have been seen in England. It is resident, and most individuals do not migrate.

Taxonomy and systematics[edit]

This species was formerly placed in Parus, but the distinctness of Lophophanes is well supported,[2] and it is now recognised by the American Ornithologists' Union and the British Ornithologists' Union as a distinct genus.

Behaviour and ecology[edit]

It is an easy tit to recognise, for besides its erectile crest, the tip of which is often recurved, its gorget and collar are distinctive. It is, like other tits, talkative, and birds keep up a constant zee, zee, zee About this sound birdsong , similar to that of the coal tit.

It makes a nest in a hole in rotting stumps. This bird often feeds low down in trees, but although not shy, it is not always easily approached. It will join winter tit flocks with other species.

Like other tits it is found in pairs and it feeds on insects (including caterpillars) and seeds.

References[edit]

  1. ^ BirdLife International (2004). Parus cristatus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006.
  2. ^ Gill, Frank B.; Slikas, Beth; Sheldon, Frederick H. (2005). "Phylogeny of titmice (Paridae): II. Species relationships based on sequences of the mitochondrial cytochrome-b gene.". Auk 122: 121–143. doi:10.1642/0004-8038(2005)122[0121:POTPIS]2.0.CO;2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!