Overview

Brief Summary

The Western Meadowlark (Sturnella neglecta) breeds mainly in natural grasslands, abandoned weedy fields, and rangeland, but also on cultivated land. In the midwestern United States, the Western Meadowlark seems to prefer shorter grass and drier fields than those used by the Eastern Meadowlark. In winter, they are often found in stubble fields and other farmland.

The Western Meadowlark breeds from southwestern Canada and the western United States south to the highlands of central Mexico. They winter over the southern and western portion of the breeding range as well as farther to the east and south. This species has also been introduced and established on Kauai (Hawaiian Islands).

Western Meadowlarks feed mainly on insects and seeds. Seeds and waste grain make up around a third of the diet annually and are especially important in fall and winter.

The male Western Meadowlark defends his nesting territory by singing. In courtship, the male faces the female, puffs out his chest feathers and points his bill straight up, prominently displaying the black "V" on his bright yellow underparts, spreads his tail wide, and flicks his wings. Males may mate with more than one female. The nest is built by the female on the ground in a small depression in dense grass. It is a domed structure made of grass stems with the entrance on the side, often with narrow trails leading through the grass to the nest. The 3 to 7 eggs, which are white and heavily spotted with brown and purple, are incubated by the female for 13 to 15 days. Both parents (but especially the female) feed the nestlings, which leave the nest at around 12 days, at which point they are still unable to fly and are tended by parents for at least two more weeks. Two broods per year are typical.

The Western Meadowlark is extremely similar to the Eastern Meadowlark (Sturnella magna) in color and pattern, but has a very different song. The two generally do not interbreed where their ranges overlap and hybrids are largely sterile (Lanyon 1979), but they do actively defend their territories against members of the other species. Birds in the dry desert grasslands of the southwestern United States and adjacent Mexico may represent a distinct species, referred to as Lilian's Meadowlark (S. lilianae) (Barker et al. 2008).

(Kaufman 1996; AOU 1998)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Barker, F.K., A.J. Vandergon, and S.M. Lanyon. Assessment of Species Limits Among Yellow-Breasted Meadowlarks (Sturnella Spp.) Using Mitochondrial and Sex-Linked Markers. The Auk 125: 869-879.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
  • Lanyon, W.E. 1979. Hybrid sterility in meadowlarks, Nature 279: 557-558.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from central British Columbia, northernl Alberta, central Saskatchewan, southern Manitoba, western Ontario, northeastern Minnesota, northern Wisconsin, northern Michigan, and southern Ontario south to northwestern Baja California, southern California, northwestern Sonora, central Arizona, Mexican highlands (to Jalisco, Guanajuato, San Luis Potosí, Nuevo León, and western Tamaulipas), west-central Texas, southeastern Kansas, northwestern Missouri, central Illinois, northern Indiana, northwestern Ohio, and extreme northwestern New York (Davis and Lanyon 2008).

Winter range extends primarily from southern British Columbia, central Idaho, central Utah, central Colorado, southern South Dakota, southern Wisconsin, and northern Indiana south to southern Baja California, Michoacán, the state of México, Veracruz, and U.S. Gulf Coast east to northwestern (Davis and Lanyon 2008).

Introduced and established in Hawaii (Kauai) (AOU 1998, Davis and Lanyon 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 24 cm

Weight: 106 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Sturnella neglecta
Catalog Number: USNM 364855
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): S. Rathbun
Year Collected: 1895
Locality: Seattle, King, Washington, United States, North America
  • Type: Rathbun. January 2, 1917. Auk. 34 (1): 68.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Habitat includes grasslands, savannas, cultivated fields, and pastures, in lowland and mountain valleys, foothills, and open mountains (Subtropical and Temperate zones) (AOU 1998), nesting at elevations as high as 3,110 meters in Colorado (Kingery 1998). Female builds nest on dry ground. Nest is a large domed structure of woven grasses and ground vegetation.

Grassland habitat range from shrubsteppe and shortgrass prairie to mixed-grass and tallgrass prairie (Bent 1958, Maher 1974, Stewart 1975, Salt and Salt 1976, Dale 1983, Laubach 1984, Bock and Bock 1987, Renken and Dinsmore 1987, Lanyon 1994, Bock et al. 1995). In the Great Plains, this species uses a wide range of vegetation heights and densities, although it avoids extremely sparse or tall cover (Dale 1983, Patterson 1994, Patterson and Best 1996), preferring high forb and grass cover, low to moderate litter cover, and little or no woody cover (Sample 1989, Kimmel et al. 1992, Anstey et al. 1995, Hull et al. 1996, Madden 1996). In shrubsteppe and desert grasslands, it prefers mesic areas; low shrub cover and density; patchiness in vegetative structure and in heights of forbs and shrubs; and high coverage of grass, forb, and litter (Lanyon 1962, Rotenberry and Wiens 1980, Wiens and Rotenberry 1981, Wiens et al. 1987, McAdoo et al. 1989, Knick and Rotenberry 1995). In general, open, treeless areas are most suitable (Salt and Salt 1976, Sample 1989, Johnson 1997), although a few shrubs may be used as song perches (Knick and Rotenberry 1995).

Suitable habitats are found in idle native and idle tame grasslands (including fields of planted cover, such as Conservation Reserve Program [CRP] fields, Permanent Cover Program [PCP] fields, and dense nesting cover [DNC]), native and tame pastures and hayland (Graber and Graber 1963; Giezentanner 1970; Maher 1973, 1974; Stewart 1975; Salt and Salt 1976; Johnsgard 1979, 1980; Ducey and Miller 1980; Kantrud 1981; Kantrud and Kologiski 1982; Faanes 1983; Laubach 1984; Renken and Dinsmore 1987; Frawley and Best 1991; Dhol et al. 1994; Hartley 1994; Klute 1994; Anstey et al. 1995; Berthelsen and Smith 1995; Bock et al. 1995; Faanes and Lingle 1995; King and Savidge 1995; Prescott et al. 1995; Skeel et al. 1995; Sutter 1996; Delisle and Savidge 1997; Klute et al. 1997; Prescott 1997; Davis and Duncan 1999). Road rights-of-way, field edges, cropland, retired cropland, wet meadows, pine (PINUS) foothills, mountain meadows, orchards, windbreaks, riparian areas, and to a limited extent, wet areas on shortgrass prairie and sagebrush (Artemisia)-dominated plains also are used (Hergenrader 1962, Bent 1958, Strong 1971, Stewart 1975, Salt and Salt 1976, Johnsgard 1979, Ducey and Miller 1980, Stauffer and Best 1980, Faanes 1983, Basore et al. 1986, Cable et al. 1992, Camp and Best 1993, Hartley 1994, Lanyon 1994, Faanes and Lingle 1995, Prescott 1997).

Within mixed-grass areas in North Dakota, abundance was positively associated with percent grass cover, litter depth, and density of low-growing shrubs (western snowberry [Symphoricarpos occidentalis] and silverberry [Eleagnus commutata]; Schneider 1998). In mixed-grass prairie in North Dakota, density was positively correlated with maximum and average vegetation heights, and negatively correlated with shrub coverage (George and McEwen 1991). When vegetation variables were grouped and analyzed in combination, western meadowlark density was positively correlated with vertical density of vegetation and grass cover, and negatively correlated with vertical heterogeneity (diversity of vegetation) and litter cover.

In riparian areas in Iowa, density was positively associated with grass cover and the cover of all life forms combined (life forms were defined as grass-like vegetation, forbs, shrubs, deciduous and evergreen trees, and vines; Best et al. 1981). Density was negatively associated with sapling and tree richness, the horizontal patchiness of trees, and forb cover.

In crested wheatgrass (Agropyron cristatum) pastures in Saskatchewan, abundance was positively correlated with litter depth and the number of plant contacts from 0 to 10 centimeters from the ground (Sutter and Brigham 1998). Numbers were higher in areas with high percent grass and sedge cover and high maximum vegetation height than in areas with high litter depth and number of plant contacts more than 10 centimeters tall. In mixed-grass pastures, density was negatively correlated with maximum vegetation height and the number of plant contacts less than 10 centimeters. Numbers were higher in areas with high percent grass and sedge cover and high maximum vegetation height than in areas with high litter depth and number of plant contacts more than 10 centimeters tall. In Nebraska, western meadowlarks were equally abundant in idle fields planted to native grasses and in idle fields planted to tame grasses (Delisle and Savidge 1997). In Saskatchewan, they occurred with equal frequency in native pastures and tame pastures (Anstey et al. 1995, Sutter 1996, Davis and Duncan 1999). In Manitoba and Alberta, however, they preferred native grasses to tame grasses (Wilson and Belcher 1989, Dhol et al. 1994, Prescott and Murphy 1996).

Nests were found in grassed waterways planted to smooth brome (Bromus inermis) in Iowa rowcrop fields (Bryan and Best 1991). Occasionally nest occur in no-till cropland (Basore et al. 1986). In Iowa, western meadowlarks preferred untilled fields of corn and soybeans rather than tilled fields (Basore et al. 1986). Untilled fields were idle in the fall and spring and contained year-round crop residue. Specifically, they preferred nesting in fields where corn was planted into sod residue over fields where corn or soybeans were planted into corn residue (Basore et al. 1986). In wheat-stubble fields, the tightly woven nest often protected eggs from rolling out during tillage with undercutter blades (Rodgers 1983).

In South Dakota mixed-grass prairies, densities were higher in large grassland patches (> 50 hectares) than smaller ones (Bakker et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

This species is partially migratory in the northern parts of the breeding range (Terres 1980).

Home range size has been estimated at 4-13 hectares (Bent 1958). In Colorado, mean territory size of 17 mated males was 1.24 hectares, 0.32 hectares in 7 unmated males (Aweida 1995). Estimates of male territory size are 3-13 hectares within tallgrass prairie (Kendeigh 1941, Lanyon 1956, Laubach 1984), 2-7 hectares within short- and mixed-grass prairies (Wiens 1970, 1971; Schaeff and Picman 1988), 2 hectares in tame pastures in Wisconsin (Wiens 1969), and 3 hectares in alfalfa fields and surrounding edges in Iowa (Frawley and Best 1991). In idle shrubsteppe and shrubsteppe pasture, the estimated territory sizes for males were 2.2 hectares and 2.3 hectares, respectively (Wiens 1971). Breeding home range size is essentially same as territory size (Lanyon 1957).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet varies seasonally and includes small invertebrates (beetles, cutworms, caterpillars, grasshoppers, spiders, sow bugs, snails, etc.), grain, and seeds. (Terres 1980). Meadowlarks usually forage on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Sturnella neglecta (westwern meadowlark) preys on:
Insecta
Hemiptera
Diptera
Elateridae
Noctuidae

Based on studies in:
Canada: Manitoba (Grassland)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Sturnella neglecta (westwern meadowlark) is prey of:
Tyto alba
Buteo regalis
Buteo swainsoni

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrnces (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown bu presumably exceeds 1,000,000. Rich et al. (2004) estimated population size at 32,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

This species occurs in flocks of up to 10-75 birds in winter.

Predators include: hawks, crows, skunks, weasels, raccoons, and coyotes.

This species is regarded as an intolerant host of the brown-headed cowbird (Molothrus ater) in some areas and is known to eject the eggs of this parasitic species (Hergenrader 1962). Brood parasitism rates of more than 40 percent, however, have been recorded (Davis 1994; Klute 1994; Koford et al., in press), although other studies have recorded lower parasitism rates (Hergenrader 1962, Friedmann 1963, Bent 1958, Maher 1973, Hill 1976). In Manitoba, a relatively high brood parasitism rate of 44 percent on 65 nests was recorded (Davis 1994; Davis and Sealy 2000). Within native grasslands in North Dakota, frequency of brood parasitism on 294 nests was 47 percent; within Conservation Reserve Program (CRP) and dense nesting cover (DNC) grasslands, the frequency of brood parasitism on 26 nests was 19 percent (Koford et al., in press). Within annually burned and moderately grazed tallgrass pastures in Kansas, the brood parasitism rate for 6 nests was 83 percent (Klute 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In the north (Manitoba), nests are initiated in late April-June (mainly first half of May). Clutch size is three to seven (usually five). Incubation, by female, lasts 13-15 days. Nestlings are tended by both parents, leave nest in about 12 days, fed by parents for two more weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sturnella neglecta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCGTTAATCGATGATTATTCTCTACTAACCATAAAGACATTGGAACCTTATACTTAATTTTTGGCGCATGGGCCGGAATAGTCGGCACTGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGACAACCTGGAGCCCTTCTGGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCTCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATCATAATCGGAGGATTCGGAAACTGACTAGTACCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTCCTCCTTCTAGCATCTTCCACAGTCGAAGCAGGGGTAGGAACAGGATGAACAGTGTACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTTGCAATTTTCTCCCTACACTTAGCCGGTATCTCCTCAATCCTAGGGGCAATCAACTTCATCACAACAGCAATTAACATAAAACCACCCGCCCTATCCCAATACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACTGCAGTCCTTTTACTACTCTCCCTCCCAGTTCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGCAATCTTAACACTACATTCTTTGACCCCGCCGGAGGCGGAGACCCTGTGCTATACCAGCACCTTTTCTGATTCTTTGGTCACCCAGAAGTTTACATCTTAATCCTCCCAGGATTCGGAATTATCTCTCACGTCGTAACTTACTACGCAGGTAAAAAAGAACCATTCGGCTACATAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sturnella neglecta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in North America; large population size; many occurrences; apparently undergoing a slow decline.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Breeding Bird Survey data indicate a slow ongoing decline that is close to 10% over 10 years, which is probably close to three generations.

Global Long Term Trend: Unknown

Comments: Trend over the past 200 years in unknown, but this species appears to have undergone a slow decline over the past several decades. North American Breeding Bird Survey (BBS) data indicate a significant survey-wide decline of 0.9% per year for the period 1966-2007; this amount to a decline of 31% over this time period. BBS abundance (average number of individuals per route) declined from mostly 48-52 (late 1960s to mid-1970s) to 34-37 in 2000-2007. Decline during 1980-2007 averaged 1% per year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: Much habitat has been lost to intensive agricultural development of habitat. Cultivation of habitat generally eliminates successful nesting until revegetation occurs. Grassland alterations that result in tall dense vegetation reduce habitat suitability for meadowlarks (Davis and Lanyon 2008). Hay cutting during the nesting season generally precludes successful nesting (Davis and Lanyon 2008).

Moderate grazing generally is not a threat, unless vegetation already is very low and sparse. Grazing may increase habitat suitability of areas that have tall, dense vegetation.

Encroachment of woody vegetation generally reduces suitability of habitat for meadowlarks.

In some areas this species is a frequent host of the brown-headed cowbird (a brood parasite), but this is not known to be a significant threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Herkert et al. (1993) suggested that Western Meadowlarks were moderately sensitive to habitat fragmentation. In Nebraska, the minimum area used was 5 hectares (Helzer 1996). In Idaho shrubsteppe, no relationship was found between occupancy of an area and patch size (Knick and Rotenberry 1995). However, in mixed-grass grasslands of South Dakota, density was greater in large (>50 hectare) patches than in smaller ones (Bakker et al. 2002). The probability of encountering nests was highest on large fragments near forest edges; however, nest productivity was highest for nests far from forest edges in areas 1 year postburn (Johnson and Temple 1986). In Saskatchewan, cowbird brood parasitism rates for Western Meadowlarks were negatively associated with area; 700-1600 hectares would be required to reduce brood parasitism by 50 percent (SWCC 1997). In Minnesota tallgrass prairie, nest depredation and brood parasitism decreased farther from woody edges, and nest depredation rates were lower on large (130-486 hectares) than on small (16-32 hectares) grasslands (Johnson and Temple 1990).

Management Requirements: BURNING: Tallgrass prairie management to maximize nest productivity should provide large (more than 130 hectares), regularly burned prairies with no nearby wooded edges (Johnson and Temple 1990). In Saskatchewan, population initially was adversely impacted by an October prescribed fire, but densities in burned and unburned areas were comparable by the third year (Pylypec 1991). Densities are low immediately following burning, but increase a few years postburn, probably in response to recovery of vegetation and absence of woody vegetation (Johnson 1997). Densities declined by 5 year postburn. In the northern Great Plains, densities in prairie generally declined 1-2 year postburn, but peaked 2-4 year postburn (Forde et al. 1984, Pylypec 1991). However, in northern North Dakota, density peaked 1-3 years postburn (Madden 1996). In one Saskatchewan field, densities on a 3 year postburn were comparable to unburned areas (Pylypec 1991). In northern North Dakota, were absent from unburned, native mixed-grass areas, but were present in areas subjected to repeated (e.g., every 3 years) burning; prairies in which the last burn was more than 80 years ago did not attract meadowlarks (Madden 1996). In South Dakota, use of native pastures burned in the spring increased during June and July to the extent that abundance was significantly higher in burned than in unburned prairie in July, and abundance was significantly higher in July than June in the burned prairie (Huber and Steuter 1984). Within Idaho shrubsteppe, densities were higher 1-3 years postburn than preburn; densities leveled off about 4 years postburn (Petersen and Best 1987). In Montana, abundance was higher in burned than in unburned shrubsteppe (Bock and Bock 1987). Within burned areas, occupied sites contained significantly less grass and herbaceous cover than was available in the burned areas as a whole. Numbers in Wyoming shrubsteppe were significantly higher in untreated (i.e., unburned and not sprayed with herbicides) shrubsteppe than in burned shrubsteppe; no differences were detected between sprayed and burned areas or between sprayed and untreated areas (Kerley and Anderson 1995). Untreated areas contained higher shrub density, higher percent shrub cover, and taller shrubs than treated areas.

MOWING: On native grasslands in North Dakota, density was highest in hayland mowed the previous year compared to grasslands under light, moderate, or heavy grazing (Kantrud 1981). In Saskatchewan, were consistently found in annually mowed hayfields, and occasionally were found in periodically mowed (mowed some years, idled during other years) fields, but were most abundant in idle native grasslands (Dale et al. 1997). In Iowa alfalfa fields, density did not differ between unmowed fields and fields mowed in early June and again in mid-July, but territories were not entirely within alfalfa fields (Frawley and Best 1991). Nested in both first and second alfalfa crops; nest success was low due mainly to depredation (Frawley 1989). Nests in Nebraska hayfields were unsuccessful because of disturbance caused by mowing (Ducey and Miller 1980). Emergency haying (haying due to severe drought) of Conservation Reserve Program (CRP) fields in the Midwest resulted in an increase in the herbaceous canopy cover and an increase in the proportion of grasses composing the herbaceous canopy in the following year (Hays and Farmer 1990); these vegetative changes were favored by Eastern Meadowlarks (STURNELLA MAGNA) and Western Meadowlarks.

GRAZING: In Nebraska, were more abundant in pastures grazed by cattle than in a pasture grazed by American bison (BISON BISON) and burned (Griebel et al. 1998). Usually respond positively to light to moderate grazing and negatively to heavy grazing (Giezentanner 1970, Kantrud and Kologiski 1982, Bock et al. 1993), although they also may exhibit no response to grazing (Karasiuk et al. 1977, Renken 1983, Messmer 1990). In North Dakota, preferred grazed fields over Dense Nesting Cover (DNC), but showed no response to grazing intensities or to short-duration (involved a system of pastures rotated through a grazing schedule of about 1 week grazed and 1 month ungrazed, repeated throughout the season), twice-over rotation (involved grazing a number of pastures twice per season, with about a 2-month rest in between grazing), or season-long (involved leaving cattle on the same pasture all season) grazing systems (Renken 1983; Messmer 1985, 1990). In mixed-grass prairie in South Dakota, were more abundant in ungrazed areas than grazed areas (Wiens 1973). In Alberta, frequencies of occurrence did not differ significantly between four grazing treatments: early season tame (grazed from late April to mid-June), early season native (grazed in early summer), deferred-grazed native (grazed after 15 July), and continuously grazed native (Dale and McKeating 1996, Prescott and Wagner 1996). Western Meadowlarks in Saskatchewan were equally abundant in grazed and ungrazed areas (Dale 1984). However, in another Saskatchewan study, density was three times higher in ungrazed than grazed grassland, although the species was common in both (Maher 1973, 1974). In Alberta, nested in both idle and grazed areas and tolerated any intensity of grazing (from light to heavy grazing), especially if some shrubs remained; they were abundant on mowed and cultivated areas as well (Owens and Myres 1973). In Alberta aspen parkland, abundance was greater in idle mixed-grass prairie than in continuously grazed prairie, although were common in both (Prescott et al. 1995). In shortgrass pasture of Colorado, nested in lightly to moderately summer- or winter-grazed shortgrass pastures, heavily winter-grazed pastures, and avoided heavily summer-grazed pastures (Giezentanner 1970, Porter and Ryder 1974, Wiens 1973, Ryder 1980). In Oklahoma, meadowlarks (Eastern and Western Meadowlarks combined) nested more frequently in moderately grazed tallgrass pasture than in undisturbed prairie (Smith 1940). Within shortgrass pastures of Arizona, Western Meadowlarks were absent from heavily grazed pastures where sheep had unlimited grazing access; they were common in moderately grazed pastures where sheep were kept at carrying capacity and where erosion by floodwater was controlled (Monson 1941). In Idaho, nested in low numbers in ungrazed areas of big sagebrush (ARTEMISIA TRIDENTATA) or crested wheatgrass, and did not nest in grazed areas of these habitats (Reynolds and Trost 1980). In Saskatchewan, were common in lightly grazed crested wheatgrass (Sutter and Brigham 1998).

CONSERVATION RESERVE PROGRAM (CRP): Nest density within native or tame CRP fields in Texas did not differ by cover type (blue grama [BOUTELOUA GRACILIS]/sideoats grama [BOUTELOUA CURTIPENDULA], blue grama/Kleingrass [PANICUM COLORATUM], and blue grama/Turkestan bluestem [ANDROPOGON ISCHAEMUM]) (Berthelsen and Smith 1995). In Iowa, were abundant in CRP planted to tame grasses and legumes; abundance in CRP was positively correlated with vertical patchiness and negatively correlated with vertical vegetation cover (Patterson 1994, Patterson and Best 1996). Nested in CRP, but not in rowcrops (Patterson 1994). In Nebraska, there was no difference in Western Meadowlark abundance between agricultural landscapes with 20 percent CRP land and landscapes with less than 5 percent CRP, or between areas dominated by warm- or cool-season grasses (King and Savidge 1995, Delisle and Savidge 1997). In Kansas, meadowlarks (Eastern and Western Meadowlarks combined) were more abundant in moderately grazed, annually burned tallgrass prairie than in native, annually burned CRP, possibly because invertebrate prey was more common in the grazed areas (Klute 1994). Six nests were found in pastures, and none in CRP (Klute et al. 1997). Were not common within Kansas native CRP, but the highest abundances occurred in fields with a high (more than 60 percent) frequency of occurrence of forbs (Hull et al. 1996).

DENSE NESTING COVER (DNC): Density in North Dakota was higher in grazed native prairie than in DNC planted to alfalfa and wheatgrass (AGROPYRON SPP.); they also were found in formerly grazed fields that had been idle for 1 year (Renken 1983, Renken and Dinsmore 1987). Density was negatively correlated with vegetation height and forb cover (Renken 1983). In Saskatchewan, were more common in idle native grasslands than in wheat or DNC (both native and tame) (Hartley 1994). In Manitoba, were more abundant in idle native grasslands than native DNC (Dhol et al. 1994).

PERMANENT COVER PROGRAM (PCP): In southern Canada, occurred more frequently in PCP grasslands than in cropland (McMaster and Davis 1998).

PESTICIDES: The effects of grasshopper control methods (malathion, sevin-4-oil, carbaryl bait, and Nosema locustae bait, a biological control agent) on Western Meadowlark density were evaluated in Colorado, Idaho, North Dakota, Utah, and Wyoming (George et al. 1995). Density declined 10 and 21 days post-treatment (all treatments combined), probably due to a reduction in insect prey. Mortality of eight Eastern and Western Meadowlarks due to insecticides was reported in Oklahoma (Griffin 1959).

DISTURBANCE: In a study examining the influence of recreational trails on the density of songbirds, Western Meadowlarks were significantly more abundant along control transects than along recreational trails (Miller et al. 1998). Abundance increased with increasing distance from trails.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Keys to management include providing a variety of grassland types and heights, sparse woody cover, and high forb and grass cover. Avoid disturbance (burning, mowing, grazing, tilling, and chemical spraying) during the breeding season (Messmer 1985, Frawley 1989, Lanyon 1994, Patterson 1994, Patterson and Best 1996, Dale et al. 1997). Spray weeds on a spot-by-spot basis, and delay spraying until after the peak breeding season (Patterson 1994, Patterson and Best 1996, Delisle and Savidge 1997).

Protect large, native grassland areas and wet meadows from conversion to agricultural production; management of native grasslands can be accomplished through burning, mowing, and grazing (Kantrud 1981, Faanes and Lingle 1995, Prescott and Murphy 1996). Continue the Conservation Reserve Program to preserve nesting habitat in the Great Plains (Bock et al. 1993, Klute 1994, Patterson 1994, Patterson and Best 1996).

Provide large blocks of grassland to reduce brood parasitism by Brown-headed Cowbirds (MOLOTHRUS ATER) and to reduce nest depredation (Johnson and Temple 1990, Klute 1994, Davis and Sealy in press).

Place any trails near forest or grassland edges to limit the fragmentation of large blocks of habitat (Miller et al. 1998).

Treat (burn, graze, or mow) portions of large areas on a rotational schedule to provide a mosaic of successional stages (Renken and Dinsmore 1987, Madden 1996, Prescott and Murphy 1996, Dale et al. 1997, Johnson 1997). Treat small, isolated areas as part of a larger mosaic, ensuring a variety of successional stages (Renken and Dinsmore 1987, Madden 1996, Johnson 1997).

In mixed-grass prairie, conduct prescribed burns at varying intervals of time (2-3 years, 4-7 years, or 8-10 years) to provide a mosaic of successional stages (Madden 1996). In tallgrass prairie, burn Conservation Reserve Program (CRP) fields every 3-5 years to reduce dense vegetation (King and Savidge 1995).

Burn or mow road rights-of-way in blocks on a 3-5 years rotational basis to maintain vegetation quality (Camp and Best 1993).

Control encroachment of woody vegetation (Faanes and Lingle 1995, Prescott and Murphy 1996). In order to increase nest productivity in tallgrass prairie fragments, remove woody vegetation to reduce edges and burn at least every 3 years (Johnson and Temple 1990).

Mow hayfields in late summer (after 15 July) on a 3-5 year rotational basis to maintain grass quality and improve habitat for the following year (Dale et al. 1997). Mowing of CRP fields should not be done more than every 3-5 years; should be done in late summer, and should be followed by raking to reduce and loosen litter (Hays and Farmer 1990).

On CRP fields that have been seeded to tallgrass species, use grazing to improve the breeding habitat by reducing vegetation height, and by increasing canopy and forb coverage and invertebrate biomass (Klute 1994). Within shortgrass prairie, protect dry areas from grazing, and graze wet areas to increase species diversity and patchiness (Ryder 1980).

Graze tame pastures in the spring to allow native pastures to recover from grazing (Prescott and Wagner 1996). Increase the amount of public rangeland from which livestock are excluded, especially in the National Grasslands (Bock et al. 1993).

To avoid destroying nests and nestlings, undercut wheat stubble in the spring instead of using surface tillage (Rodgers 1983). In wheat-stubble fields, the tightly woven nest of Western Meadowlarks often protected eggs from rolling out during tillage with undercutter blades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Western meadowlark

Not to be confused with Eastern meadowlark.

The western meadowlark (Sturnella neglecta) is a medium-sized icterid bird, about 8.5 in (22 cm) long. It nests on the ground in open country in western and central North America grassland. It feeds mostly on insects, but also seeds and berries. It has distinctive calls described as watery or flute-like, which distinguish it from the closely related eastern meadowlark.

Description[edit]

Adults have yellow underparts, with a black "V" on the breast, and white flanks which are streaked with black. Their upper parts are mostly brown, but also have black streaks. These birds have long pointed bills and their heads are striped with light brown and black.

Habitat and distribution[edit]

Their breeding habitats are grasslands, prairies, pastures, and abandoned fields, all of which may be found from across western and central North America to northern Mexico. Where their range overlaps with the eastern species, these birds prefer thinner, drier vegetation; the two types of birds generally do not interbreed but do defend territory against one another. Their nests are situated on the ground, and are covered with a roof woven from grass. There may be more than one nesting female in a male's territory. Their nests are sometimes destroyed by mowing operations with eggs and young in them.

Western meadowlarks are permanent residents throughout much of their range. Northern birds may migrate to the southern parts of their range; some birds also move east in the southern United States.

Diet[edit]

These birds forage on the ground or in low to semi-low vegetation. They sometimes search for food by probing with their bills. They mainly eat insects, although they will devour seeds and berries. In winter, these birds often feed in flocks.

Song[edit]

These birds have a flute-like warbled song. These calls contrast with the simple, whistled call of the eastern meadowlark.

History with eastern meadowlark[edit]

Western meadowlarks will interbreed with eastern meadowlarks where their ranges overlap; however, resulting young appear to have low fertility.[2]

These two species were considered to be the same species for some time; the western species, having been overlooked for some time, was given the species name neglecta.

State bird[edit]

The western meadowlark is the state bird of six states; being Montana, Kansas, Nebraska, North Dakota, Oregon and Wyoming. Only the northern cardinal is the state bird of more states (seven).

References[edit]

  1. ^ BirdLife International (2012). "Sturnella neglecta". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Jaramillo, Alvaro; Peter Burke (1999). New World Blackbirds: The Icterids. London: Christopher Helm. p. 305. ISBN 0-7136-4333-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Sturnella neglecta and S. magna Constitutes a superspecies; they rarely interbreed and hybrids are sterile (AOU 1998). Banks and Browning (1995) regarded the specific name S. ludovicianus as a nomen dubium and recommended that S. neglecta be retained as the proper name.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!