Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

The Eastern Meadowlark is found in the eastern United States and adjacent Canada south through Mexico (except for Baja California and northwestern Mexico) to central Panama and in South America from northern and eastern Colombia, Venezuela, Guyana, and Surinam south, east of the Andes, to Amazonian Brazil. Except in the most northern part of the range, Eastern Meadowlarks are year-round residents. The Eastern Meadowlark is a bird of open fields and pastures, meadows, and prairies and populations in the eastern United States have declined in recent decades as acreage of these habitats has declined.

The diet of the Eastern Meadowlark consists mainly of insects and seeds.

The male Eastern Meadowlark defends his territory by singing, often from a fencepost or other raised perch. In courtship, the male faces the female, puffs out his chest feathers and points his bill straight up, prominently displaying the black "V" on his bright yellow underparts, and flicks his wings, sometimes even jumping into the air. Males may mate with more than one female.

The nest is built by the female on the ground in a small depression in dense grass. It is a domed structure made of grass stems with the entrance on the side, often with narrow trails leading through the grass to the nest. The 3 to 5 (sometimes as many as 7) eggs, which are white and heavily spotted with brown and purple, are incubated by the female for 13 to 15 days. Both parents (but especially the female) feed the nestlings, which leave the nest around 11 to 12 days, at which point they are still unable to fly and are tended by parents for at least two more weeks. Two broods per year are typical.

The Eastern Meadowlark is extremely similar to the Western Meadowlark (Sturnella neglecta) in color and pattern, but has a very different song. The two generally do not interbreed where their ranges overlap and hybrids are largely sterile (Lanyon 1979), but they do actively defend their territories against members of the other species. Birds in the dry desert grasslands of the southwestern United States and adjacent Mexico may represent a distinct species, referred to as Lilian's Meadowlark (S. lilianae) (Barker et al. 2008).

(Kaufman 1996; AOU 1998)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Barker, F.K., A.J. Vandergon, and S.M. Lanyon. Assessment of Species Limits Among Yellow-Breasted Meadowlarks (Sturnella Spp.) Using Mitochondrial and Sex-Linked Markers. The Auk 125: 869-879.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
  • Lanyon, W.E. 1979. Hybrid sterility in meadowlarks, Nature 279: 557-558.
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: South Dakota and Minnesota east across southern Canada to New Brunswick and Nova Scotia, south through eastern United States and Middle America to central Panama and west to Nebraska, Colorado, Kansas, and Texas; Cuba; in South America from Colombia, Venezuela, Guyana, and Suriname south to Amazonian Brazil (Lanyon 1995, AOU 1998). NON-BREEDING: Texas, Kansas, Nebraska, Minnesota, Wisconsin, Michigan, Ontario, New York and New England south through breeding range (Lanyon 1995, AOU 1998). RESIDENT: central Arizona, central New Mexico, and western Texas south to Sonora and Chihuahua (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Sturnella_magna is found in the eastern United States, as well as parts of the southwest U.S. and Central America. The summer breeding range includes parts of southern Canada.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • 1992. Eastern Meadowlark. Pp. 345 in R Zeleny, ed. The World Book Encyclopedia, Vol. 13. Chicago: World Book Inc..
  • Campbell, B. 1973. Sturnella magna. Pp. 337 in R Holmes, ed. The Dictionary of Birds in Color. New York: The Viking Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Sturnella magna is found in the eastern United States, as well as parts of the southwest U.S. and Central America. The summer breeding range includes parts of southern Canada.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • 1992. Eastern Meadowlark. Pp. 345 in R Zeleny, ed. The World Book Encyclopedia, Vol. 13. Chicago: World Book Inc..
  • Campbell, B. 1973. Sturnella magna. Pp. 337 in R Holmes, ed. The Dictionary of Birds in Color. New York: The Viking Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eastern meadowlarks are medium-sized songbirds, with long, slender, light gray bills and dark brown eyes. The tails are short and have rigid rectrices. The legs and toes are long. Male S._magna have grayish heads with blackish stripes, a yellow “eyebrow”, and dark crowns with a median stripe. The wings and tail are streaked and barred with dark and light brown. Males have a broad white moustachial stripe and a yellow chin, which is divided from the underparts by a broad black breast band. The underparts turn off-white on the streaked flanks and under the tail coverts. The pale undertail coverts are streaked and spotted dusky black. Females are similar to males except that they are smaller, paler, and have a narrower breast band. Males are slightly larger than females, from 21 to 25 cm in length, females are from 19 to 23 cm. Juvenile eastern meadowlarks have masked black areas and the white areas are buffish. Juveniles also have more brown plumage in the winter. Eastern meadowlark eggs are white, speckled with reddish-brown. When these birds walk, the tail constantly jerks open. These birds fly by beating their wings vigorously and then gliding.

Range mass: 90 to 150 g.

Range length: 19 to 26 cm.

Range wingspan: 35 to 40 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Eastern meadowlarks are medium-sized songbirds, with long, slender, light gray bills and dark brown eyes. The tails are short and have rigid rectrices. The legs and toes are long. Male S. magna have grayish heads with blackish stripes, a yellow “eyebrow”, and dark crowns with a median stripe. The wings and tail are streaked and barred with dark and light brown. Males have a broad white moustachial stripe and a yellow chin, which is divided from the underparts by a broad black breast band. The underparts turn off-white on the streaked flanks and under the tail coverts. The pale undertail coverts are streaked and spotted dusky black. Females are similar to males except that they are smaller, paler, and have a narrower breast band. Males are slightly larger than females, from 21 to 25 cm in length, females are from 19 to 23 cm. Juvenile eastern meadowlarks have masked black areas and the white areas are buffish. Juveniles also have more brown plumage in the winter. Eastern meadowlark eggs are white, speckled with reddish-brown. When these birds walk, the tail constantly jerks open. These birds fly by beating their wings vigorously and then gliding.

Range mass: 90 to 150 g.

Range length: 19 to 26 cm.

Range wingspan: 35 to 40 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 24 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Eastern meadowlarks breed in native grasslands, pastures, savannas, alfalfa and hay fields, cropland borders, roadsides, orchards, golf courses, airports, reclaimed strip mines, overgrown fields, and other open areas. In the western range, the breeding range also consists of tall-grass prairies and desert grassland. In the winter they are generally found in open country, cultivated fields, feedlots, and marshes. Eastern meadowlarks are generally found in habitats that are more mesic than their close relative, western meadowlarks (S._neglecta).

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

  • Lanyon, W. 1995. Eastern Meadowlark: Sturnella magna. Washington D. C.: American Ornithologists' Union.
  • Elliott, L., M. Read. 1998. Common Birds And Their Tongs. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © International Union for Conservation of Nature and Natural Resources

    Source: IUCN

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Eastern meadowlarks breed in native grasslands, pastures, savannas, alfalfa and hay fields, cropland borders, roadsides, orchards, golf courses, airports, reclaimed strip mines, overgrown fields, and other open areas. In the western range, the breeding range also consists of tall-grass prairies and desert grassland. In the winter they are generally found in open country, cultivated fields, feedlots, and marshes. Eastern meadowlarks are generally found in habitats that are more mesic than their close relative, western meadowlarks (S. neglecta).

    Habitat Regions: temperate ; tropical ; terrestrial

    Terrestrial Biomes: savanna or grassland

    Other Habitat Features: suburban ; agricultural

    • Lanyon, W. 1995. Eastern Meadowlark: Sturnella magna. Washington D. C.: American Ornithologists' Union.
    • Elliott, L., M. Read. 1998. Common Birds And Their Tongs. Boston: Houghton Mifflin Company.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Comments: Grasslands, savanna, open fields, pastures, cultivated lands, sometimes marshes. In southeastern Arizona, avoided recently burned grassland habitats (Southwest. Nat. 37:73). Nests on the ground in concealing herbage.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Migration

    Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

    Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

    Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

    Populations in northern part of breeding range are migratory; return north to nesting areas usually in early April, males arrive about 2 weeks prior to females (Terres 1980).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Trophic Strategy

    Food Habits

    Eastern meadowlarks walk and run on the ground while foraging for food, they also forage by probing beneath the soil. Their diet varies with the season. In the spring they feed mainly on cutworms, grubs, and caterpillars. When summer comes they eat insects, primarily beetles and grasshoppers. In the winter they eat noxious weed seeds and waste grains as well as some wildfruits and occasional carrion from road-kill or predator-kills.

    Animal Foods: carrion ; insects

    Plant Foods: seeds, grains, and nuts; fruit

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Food Habits

    Eastern meadowlarks walk and run on the ground while foraging for food, they also forage by probing beneath the soil. Their diet varies with the season. In the spring they feed mainly on cutworms, grubs, and caterpillars. When summer comes they eat insects, primarily beetles and grasshoppers. In the winter they eat noxious weed seeds and waste grains as well as some wildfruits and occasional carrion from road-kill or predator-kills.

    Animal Foods: carrion ; insects

    Plant Foods: seeds, grains, and nuts; fruit

    Primary Diet: carnivore (Insectivore ); herbivore (Granivore )

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Comments: Eats mainly insects and other small invertebrates, also grain and seeds; forages on the ground (Terres 1980).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Associations

    Ecosystem Roles

    Eastern meadowlarks are prey for larger predators and they prey on a variety of insects, including grubs and caterpillars, which could damage the surrounding vegetation. They also act to disperse the sees of plants they eat. Sturnella_magna serves as a host for a variety of internal and external parasites, and for Molothrus ater. Brown-headed cowbirds are obligate parasites, which lay eggs in the nests of other species of birds.

    Ecosystem Impact: disperses seeds; biodegradation ; soil aeration

    Commensal/Parasitic Species:

    • Microtetrameres_sturnellae
    • Phthiraptera
    • Siphonaptera
    • brown-headed cowbirds (Molothrus_ater)
    • Hippoboscidae

    • Taylor, R. 1969. Histological study of host-parasite relations between meadowlarks (Sturnella) and Microtetrameres Sturnellae (Nematoda: Tetrameridae). Oklahoma: University of Oklahoma Graduate College.
    • Stark, F. 1940. A study of the animal parasites of Sturnella magna magna and Sturnella neglecta of southeastern Kansas. Pittsburg, Kansas: Kansas State Teachers College.
    • Cornell Lab of Ornithology. 2005. "Demography and Populations" (On-line). Birds of North America Online. Accessed November 19, 2005 at http://bna.birds.cornell.edu/BNA/account/Eastern_Meadowlark/DEMOGRAPHY_AND_POPULATIONS.html.
    • 2003. Western Meadowlark. Pp. 316 in M Hutchins, ed. Grzimek's Animal Life Encyclopedia, Vol. 11. Detroit: Gale Group Inc..
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Predation

    Eastern meadowlarks are preyed on by hawks and falcons and occasionally by owls. They are most likely to be preyed upon by owls during the owl’s breeding season. While the owls are raising their young, they are more likely to hunt during daylight hours, in order to catch enough prey to feed the chicks. Hawks and falcons are diurnal, and often hunt in similar habitats. During their nesting season, domestic cats, dogs, foxes, coyotes, and skunks prey upon the eggs and nestlings. Eastern meadowlark coloration helps them to blend in to their grassland surroundings, they can be difficult to spot unless they are on a high perch.

    Known Predators:

    • domestic cats (Felis_silvestris)
    • dogs (Canis_lupus_familiaris)
    • foxes (Vulpes)
    • skunks (Mephitidae)
    • hawks (Accipitridae)
    • falcons (Falconidae)
    • sometimes owls (Strigiformes)
    • coyotes (Canis_latrans)

    Anti-predator Adaptations: cryptic

    • Grossman, M., J. Hamlet. 1964. Birds of Prey of the World. New York: Bonanaza Books.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Ecosystem Roles

    Eastern meadowlarks are prey for larger predators and they prey on a variety of insects, including grubs and caterpillars, which could damage the surrounding vegetation. They also act to disperse the sees of plants they eat. Sturnella magna serves as a host for a variety of internal and external parasites, and for brown-headed cowbirds. Brown-headed cowbirds are obligate parasites, which lay eggs in the nests of other species of birds.

    Ecosystem Impact: disperses seeds; biodegradation ; soil aeration

    Commensal/Parasitic Species:

    • Taylor, R. 1969. Histological study of host-parasite relations between meadowlarks (Sturnella) and Microtetrameres Sturnellae (Nematoda: Tetrameridae). Oklahoma: University of Oklahoma Graduate College.
    • Stark, F. 1940. A study of the animal parasites of Sturnella magna magna and Sturnella neglecta of southeastern Kansas. Pittsburg, Kansas: Kansas State Teachers College.
    • Cornell Lab of Ornithology. 2005. "Demography and Populations" (On-line). Birds of North America Online. Accessed November 19, 2005 at http://bna.birds.cornell.edu/BNA/account/Eastern_Meadowlark/DEMOGRAPHY_AND_POPULATIONS.html.
    • 2003. Western Meadowlark. Pp. 316 in M Hutchins, ed. Grzimek's Animal Life Encyclopedia, Vol. 11. Detroit: Gale Group Inc..
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Predation

    Eastern meadowlarks are preyed on by hawks and falcons and occasionally by owls. They are most likely to be preyed upon by owls during the owl’s breeding season. While the owls are raising their young, they are more likely to hunt during daylight hours, in order to catch enough prey to feed the chicks. Hawks and falcons are diurnal, and often hunt in similar habitats. During their nesting season, domestic cats, dogs, foxes, coyotes, and skunks prey upon the eggs and nestlings. Eastern meadowlark coloration helps them to blend in to their grassland surroundings, they can be difficult to spot unless they are on a high perch.

    Known Predators:

    Anti-predator Adaptations: cryptic

    • Grossman, M., J. Hamlet. 1964. Birds of Prey of the World. New York: Bonanaza Books.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Population Biology

    Number of Occurrences

    Note: For many non-migratory species, occurrences are roughly equivalent to populations.

    Estimated Number of Occurrences: 81 to >300

    Comments: Number of occurrences has not been determined but considered common and widespread.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Global Abundance

    10,000 to >1,000,000 individuals

    Comments: Highest BBS density reported for Kentucky, Misouri, and Kansas south through Oklahoma and Arkansas to Texas (41-64 birds per route). Lowest density reported for Maritime Provinces and New England (1-3 birds per route; Lanyon 1995).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    General Ecology

    Breeding territory of male is about 3 ha (Terres 1980).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Life History and Behavior

    Behavior

    Communication and Perception

    The songs of S._magna are one of the first birdsongs of spring. Sturnella_magna have a variety of vocal communications. There are begging notes, location notes, dzert, whistle, chatter, weet, primary song, flight song, female song, zeree, and tee-tee-tee. Nestlings and recently fledged juveniles use begging and location notes, which are simple high-pitched notes. These notes enable the parents to find and feed their young. The dzert call indicates mild disturbance. The whistle indicates intense excitement in males or females, such as the presence of a predator, just before a flight song, or immediately after an aerial chase or copulation. Both sexes use the chatter call to indicate excitement such as the presence of a predator or intruder. Females also chatter after copulation and in response to their mates’ primary song. Only males use the primary song, which sounds like seee-yeee, seee-yer. In the courtship period, female S._magna use the female song, during early morning preening. The alarm call of the eastern meadowlark is a short buzzy, dzert.

    Posturing and aerial chases are used to attract and pursue possible mates. Jump-flights are used to ward off males that are intruding on another male’s territory. Bill-tilting and tail- and wing-flashing are used in territorial disputes, as is expansion posturing. Expansion posturing is when individuals extend their contour feathers, spread the tail, and draws the head close to the body. Female S._magna use expansion posturing to warn off its mate when the female is unreceptive. If expansion posturing does not succeed in warning off the male, the female will hold its feathers tight against its body and point its gaping bill at the male. Male eastern meadowlarks also use expansion posturing after the formation of the pair bond.

    Communication Channels: visual ; acoustic

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Communication and Perception

    The songs of S. magna are one of the first birdsongs of spring. Sturnella magna have a variety of vocal communications. There are begging notes, location notes, dzert, whistle, chatter, weet, primary song, flight song, female song, zeree, and tee-tee-tee. Nestlings and recently fledged juveniles use begging and location notes, which are simple high-pitched notes. These notes enable the parents to find and feed their young. The dzert call indicates mild disturbance. The whistle indicates intense excitement in males or females, such as the presence of a predator, just before a flight song, or immediately after an aerial chase or copulation. Both sexes use the chatter call to indicate excitement such as the presence of a predator or intruder. Females also chatter after copulation and in response to their mates’ primary song. Only males use the primary song, which sounds like seee-yeee, seee-yer. In the courtship period, female S. magna use the female song, during early morning preening. The alarm call of the eastern meadowlark is a short buzzy, dzert.

    Posturing and aerial chases are used to attract and pursue possible mates. Jump-flights are used to ward off males that are intruding on another male’s territory. Bill-tilting and tail- and wing-flashing are used in territorial disputes, as is expansion posturing. Expansion posturing is when individuals extend their contour feathers, spread the tail, and draws the head close to the body. Female S. magna use expansion posturing to warn off its mate when the female is unreceptive. If expansion posturing does not succeed in warning off the male, the female will hold its feathers tight against its body and point its gaping bill at the male. Male eastern meadowlarks also use expansion posturing after the formation of the pair bond.

    Communication Channels: visual ; acoustic

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Life Expectancy

    Lifespan/Longevity

    Eastern meadowlarks have an expected lifespan of five years in the wild, which is the same as the high end of its expected lifespan in captivity. The longest know lifespan in the wild is nine years.

    Range lifespan

    Status: wild:
    9 (high) years.

    Average lifespan

    Status: wild:
    5 years.

    Typical lifespan

    Status: captivity:
    3 to 5 years.

    Average lifespan

    Status: wild:
    151 months.

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Lifespan/Longevity

    Eastern meadowlarks have an expected lifespan of five years in the wild, which is the same as the high end of its expected lifespan in captivity. The longest know lifespan in the wild is nine years.

    Range lifespan

    Status: wild:
    9 (high) years.

    Average lifespan

    Status: wild:
    5 years.

    Typical lifespan

    Status: captivity:
    3 to 5 years.

    Average lifespan

    Status: wild:
    151 months.

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Lifespan, longevity, and ageing

    Maximum longevity: 12.6 years (wild)
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © Joao Pedro de Magalhaes

    Source: AnAge

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Reproduction

    Male eastern meadowlarks are polygynous, with most males having two to three mates. Female S._magna have only one mate per breeding season, provided that the male successfully defends the territory. Males establish their territories approximately two to four weeks before females arrive. Male S._magna display their territories with flight displays and by singing. Female eastern meadowlarks choose their mates by selecting territories, which are defended by males with conspecific vocalizations. Once the pair bond forms the pair remains close together while foraging and searching for nest sites. A male S._magna defends its territory against rivals by fluffing out its plumage and pointing its bill upwards. Males guard their mates from neighboring males by constantly guarding their mate.

    Males establish their territories in March, females arrive about two to four weeks later females. Male eastern meadowlarks rarely engage in body contact and fighting when defending their territories, however, when it does occur it can be quite severe. Pairing occurs immediately after females arrive. The "aerial chase" occurs within minutes of a female choosing a male. The female typically initiates the chase, although sometimes the chase includes two females and one male. The aerial chase consists of either a series of short flights or as brief flights interspersed with periods of posturing and rest. Additionally, the male is typically silent during the aerial chase. These chases usually carry the participants well beyond the boundaries of the male’s territory. When a female eastern meadowlark is receptive, she eventually assumes the receptive posture, at which time the male will approach, paw the female’s back and then mount. Afterwards the female remains in a semi-receptive position and flutters and shakes its plumage, chatters several times, then vigorously preens itself. The female receptive posture consists of the female elevating its bill and tail, holding its wings slightly drooped, and quivering, sometimes the female also chatters. Later on in the breeding season "jump-flights" and tee-tee-tee calls may accompany the receptive posture. However, if a male approaches when the female is not receptive, the female will use "expansion posturing" to warn off the male. Also, males and females make jump-flights before and during repeated copulation periods. A jump-flight consists of the bird jumping approximately one meter into the air and then flying several meters. Once the breeding season is over, male S. magna cease defending their territories.

    Mating System: polygynous

    Female eastern meadowlarks gather nest materials and build the nest. The nest consists of coarse grasses, lined with finer grasses and is constructed on the ground, typically in a shallow depression. The outside diameter of the nest ranges from 14-21 cm, the inside diameter ranges from 8-15 cm, and the inside depth ranges from 5-8 cm. Female S. magna land a distance away from the nest and then stealthily approach the nest.

    Breeding interval: Breeding first occurs in late May, with a second brood produced in late June to early July.

    Breeding season: Breeding occurs from late May to August.

    Range eggs per season: 6 to 14.

    Range time to hatching: 13 to 15 days.

    Range fledging age: 11 to 12 days.

    Range time to independence: 2 (low) weeks.

    Average age at sexual or reproductive maturity (female): 1 years.

    Average age at sexual or reproductive maturity (male): 1 years.

    Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

    Average eggs per season: 5.

    Females incubate the eggs for 13 to 15 days, when the altricial young hatch. After the eggs hatch both the female and her mate feed the hatchlings. However, females do most of the feeding. Nestlings typically fledge 11 to 12 days after hatching, but juveniles do not become independent for at least another two weeks. The parents continue to feed the fledglings until they become independent.

    Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female, Protecting: Female)

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Male eastern meadowlarks are polygynous, with most males having two to three mates. Female S. magna have only one mate per breeding season, provided that the male successfully defends the territory. Males establish their territories approximately two to four weeks before females arrive. Male S. magna display their territories with flight displays and by singing. Female eastern meadowlarks choose their mates by selecting territories, which are defended by males with conspecific vocalizations. Once the pair bond forms the pair remains close together while foraging and searching for nest sites. A male S. magna defends its territory against rivals by fluffing out its plumage and pointing its bill upwards. Males guard their mates from neighboring males by constantly guarding their mate.

    Males establish their territories in March, females arrive about two to four weeks later females. Male eastern meadowlarks rarely engage in body contact and fighting when defending their territories, however, when it does occur it can be quite severe. Pairing occurs immediately after females arrive. The "aerial chase" occurs within minutes of a female choosing a male. The female typically initiates the chase, although sometimes the chase includes two females and one male. The aerial chase consists of either a series of short flights or as brief flights interspersed with periods of posturing and rest. Additionally, the male is typically silent during the aerial chase. These chases usually carry the participants well beyond the boundaries of the male’s territory. When a female eastern meadowlark is receptive, she eventually assumes the receptive posture, at which time the male will approach, paw the female’s back and then mount. Afterwards the female remains in a semi-receptive position and flutters and shakes its plumage, chatters several times, then vigorously preens itself. The female receptive posture consists of the female elevating its bill and tail, holding its wings slightly drooped, and quivering, sometimes the female also chatters. Later on in the breeding season "jump-flights" and tee-tee-tee calls may accompany the receptive posture. However, if a male approaches when the female is not receptive, the female will use "expansion posturing" to warn off the male. Also, males and females make jump-flights before and during repeated copulation periods. A jump-flight consists of the bird jumping approximately one meter into the air and then flying several meters. Once the breeding season is over, male S. magna cease defending their territories.

    Mating System: polygynous

    Female eastern meadowlarks gather nest materials and build the nest. The nest consists of coarse grasses, lined with finer grasses and is constructed on the ground, typically in a shallow depression. The outside diameter of the nest ranges from 14-21 cm, the inside diameter ranges from 8-15 cm, and the inside depth ranges from 5-8 cm. Female S. magna land a distance away from the nest and then stealthily approach the nest.

    Breeding interval: Breeding first occurs in late May, with a second brood produced in late June to early July.

    Breeding season: Breeding occurs from late May to August.

    Range eggs per season: 6 to 14.

    Range time to hatching: 13 to 15 days.

    Range fledging age: 11 to 12 days.

    Range time to independence: 2 (low) weeks.

    Average age at sexual or reproductive maturity (female): 1 years.

    Average age at sexual or reproductive maturity (male): 1 years.

    Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

    Average eggs per season: 5.

    Females incubate the eggs for 13 to 15 days, when the altricial young hatch. After the eggs hatch both the female and her mate feed the hatchlings. However, females do most of the feeding. Nestlings typically fledge 11 to 12 days after hatching, but juveniles do not become independent for at least another two weeks. The parents continue to feed the fledglings until they become independent.

    Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female, Protecting: Female)

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Clutch size 3-7 in north (commonly 5); larger in north than in south). Usually 2 broods per year in north. Incubation 13-15 days, by female. Young tended mainly by female; male may take over feeding of fledged young while female renests. In Ontario, 2/3 of nesting females were polygynously mated (Knapton 1988). In pairs or family groups most of year (Stiles and Skutch 1989).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Molecular Biology and Genetics

    Molecular Biology

    Barcode data: Sturnella magna

    The following is a representative barcode sequence, the centroid of all available sequences for this species.


    There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

    NNNCTATACTTAATTTTTGGCGCATGGGCCGGAATAGTTGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGACAACCTGGAGCCCTTCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCTCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGATTCGGAAACTGACTAGTACCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTACTCCCCCCATCCTTCCTCCTCCTTCTAGCATCCTCCACAGTCGAAGCAGGAGTAGGAACAGGATGGACAGTGTACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTAGCAATTTTCTCCCTACATTTAGCCGGTATCTCCTCAATCCTAGGGGCAATCAACTTCATTACAACAGCAATTAACATAAAACCACCCGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACTGCAGTCCTTTTACTACTCTCCCTTCCAGTTCTTGCCGCAGGCATCACAATGCTCCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCCGCCGGAGGCGGAGATCCTGTATTATACCAACACCTTTTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTC
    -- end --

    Download FASTA File
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © Barcode of Life Data Systems

    Source: Barcode of Life Data Systems (BOLD)

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Statistics of barcoding coverage: Sturnella magna

    Barcode of Life Data Systems (BOLDS) Stats
    Public Records: 7
    Specimens with Barcodes: 8
    Species With Barcodes: 1
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © Barcode of Life Data Systems

    Source: Barcode of Life Data Systems (BOLD)

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Conservation

    Conservation Status

    According to the IUCN Red List, the U.S. Federal List, and the State of Michigan List, eastern meadowlarks have no special status. They are not threatened, likely to become threatened, or endangered. This agrees with the Audubon Society's assessment of S._magna. Eastern meadowlarks fall into the Audubon Society's green conservation status, which means that it is of low or no conservation concern. However, S._magna populations have been experiencing a significant population decline, declining by as much as 50% since 1966.

    IUCN Red List of Threatened Species: least concern

    US Migratory Bird Act: no special status

    US Federal List: no special status

    CITES: no special status

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    IUCN Red List Assessment


    Red List Category
    LC
    Least Concern

    Red List Criteria

    Version
    3.1

    Year Assessed
    2009

    Assessor/s
    BirdLife International

    Reviewer/s
    Symes, A., Butchart, S., Bird, J.

    Contributor/s

    Justification
    This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

    History
    • 2008
      Not Recognized
    • 2004
      Not Recognized
    • 2000
      Not Recognized
    • 1994
      Not Recognized
    • 1988
      Not Recognized
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © International Union for Conservation of Nature and Natural Resources

    Source: IUCN

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    According to the IUCN Red List, the U.S. Federal List, and the State of Michigan List, eastern meadowlarks have no special status. They are not threatened, likely to become threatened, or endangered. This agrees with the Audubon Society's assessment of S. magna. Eastern meadowlarks fall into the Audubon Society's green conservation status, which means that it is of low or no conservation concern. However, S. magna populations have been experiencing a significant population decline, declining by as much as 50% since 1966.

    US Migratory Bird Act: no special status

    US Federal List: no special status

    CITES: no special status

    IUCN Red List of Threatened Species: least concern

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    National NatureServe Conservation Status

    Canada

    Rounded National Status Rank: N4B - Apparently Secure

    United States

    Rounded National Status Rank: N5 - Secure

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    NatureServe Conservation Status

    Rounded Global Status Rank: G5 - Secure

    Reasons: Common and widely distributed residents of prairies, hayfields, pastures, fallow lands, and occasionally fields sown to winter wheat in the eastern half of North America (Roseberry and Klimstra 1970).

    Other Considerations: Expanding range westward to s. Kansas and central Texas panhandle. Also spreading in Central America.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Population

    Population
    The global population size has not been quantified.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © International Union for Conservation of Nature and Natural Resources

    Source: IUCN

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Global Short Term Trend: Decline of 10-30%

    Comments: Increased noticeably in the northeastern U.S. during the nineteenth century as a result of deforestation and the spread of agriculture (Andrle and Carroll 1988, Laughlin and Kibbe 1985). These population trends were reversed during the twentieth century, and now express some of the most consistent declines of any grassland bird covered by the North American Breeding Bird Survey (BBS). BBS data indicate a significant decline (averaging 2.53% per year) in North America, 1966-1993 (Peterjohn et al. 1994). Greatest rates of decline in the northeastern states. Increasing in some parts especially along western edge of the breeding range from western Kansas into central Texas. In Colombia and Costa Rica, now more widespread than formerly, due to deforestation (Hilty and Brown 1986, Stiles and Skutch 1989).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Threats

    Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

    Comments: Decline is generally attributed to loss of nesting habitat due to changes in land use and unusually heavy mortality during severe winters (Lanyon 1995). AGRICULTURAL PRACTICES: Mowing of hayfields during the breeding season and spring surface tillage for weed-control destroys nests, young, and incubating adults (Lanyon 1995). HABITAT: Declines are attributed reforestation of or succession from abandoned farmland into woodlots and conversion of grasslands into suburbs (Lanyon 1995). GRAZING: Nests may be trampled by livestock. PESTICIDES: Mortality reported from eating grain poisoned to control rodents or insects (Griffin 1959 cited in Lanyon 1995). PREDATION: Eggs and nestlings may be depredated by foxes, domestic cats and dogs, coyotes, snakes, skunks, raccoons, or other small mammals (Lanyon 1995). PARASITISM: Nests widely parasitized by brown-headed cowbird (Molothrus ater) but data on parasitism rates are not available.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Management

    Restoration Potential: Plant mixed-grass hayfields and restrict surface tilling (Jones and Vickery 1997).

    Preserve Selection and Design Considerations: Minimum grassland size 15-20 acres (Jones and Vickery 1997).

    Management Requirements: Mow every 1-3 years in no earlier than August. Tolerates light grazing (grass height > 5 inches), with rotational grazing to vary grass height and density. Will use sites 2-4 years after a burn (Jones and Vickery 1997).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

    Comments: Widespread and found in many protected areas.

    Needs: Protect large tracts (ideally 500+ acres) of suitable habitat.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Relevance to Humans and Ecosystems

    Benefits

    Economic Importance for Humans: Negative

    Sturnella species eat kernels of sprouting grain, which can destroy portions of newly planted crops.

    Negative Impacts: crop pest

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Economic Importance for Humans: Positive

    Sturnella_magna eat insects that are crop pests, therefore they act to control pest populations that impact crops.

    Positive Impacts: controls pest population

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Economic Importance for Humans: Negative

    Sturnella species eat kernels of sprouting grain, which can destroy portions of newly planted crops.

    Negative Impacts: crop pest

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Economic Importance for Humans: Positive

    Sturnella magna eat insects that are crop pests, therefore they act to control pest populations that impact crops.

    Positive Impacts: controls pest population

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Wikipedia

    Eastern Meadowlark

    The Eastern Meadowlark (Sturnella magna) is a medium-sized icterid bird, very similar in appearance to the Western Meadowlark. It occurs from eastern North America to South America, where it is also most widespread in the east.

    Contents

    Description

    The adult Eastern meadowlark measures from 19 to 28 cm (7.5 to 11 in) in length and spans 35–40 cm (14–16 in) across the wings.[2] Body mass ranges from 76 to 150 g (2.7 to 5.3 oz).[3][4] The extended wing bone measures 8.9–12.9 cm (3.5–5.1 in), the tail measures 5.3–8.6 cm (2.1–3.4 in), the culmen measures 2.8–3.7 cm (1.1–1.5 in) and the tarsus measures 3.6–4.7 cm (1.4–1.9 in). Females are smaller in all physicial dimensions.[5] Adults have yellow underparts with a black "V" on the breast and white flanks with black streaks. The upperparts are mainly brown with black streaks. They have a long pointed bill; the head is striped with light brown and black.

    The song of this bird is of pure, melancholy whistles, and thus simpler than the jumbled and flutey song of the Western Meadowlark; their ranges overlap across central North America. In the field, the song is often the easiest way to tell the two species apart, though plumage differences do exist, like tail pattern and malar coloration.

    The pale Lilian's Meadowlark of northern Mexico and the southwestern US is sometimes split off as a separate species.

    Taxonomy

    This species was first described by Linnaeus in his 1758 Systema naturae as Alauda magna.[6] The type locality is mistakenly given as "America, Africa"

    Linnaeus' error is explained by two facts: first, he did not distinguish between the Eastern and Western meadowlarks. The peculiar belief that this bird also occurred in Africa is due to confusion of the yellow-breasted meadowlarks with certain longclaws (Macronyx), quite unrelated African songbirds. Specifically the Cape Longclaw (M. capensis) and the Yellow-throated Longclaw (M. croceus) share similar habitat and habits, explaining the long hind toe; their plumage pattern however is all but identical, a striking example of convergent evolution. As this exact pattern provides no obvious adaptive benefit compared to that of other meadowlarks and longclaws, it seems to have arisen twice by sheer chance.

    Linnaeus recognized his error less than a decade later, separating the longclaws from their meadowlark look-alikes.

    The scientific name Sturnella magna is Latin for, rather confusingly, "large little starling", the generic name having been given due to the meadowlarks' behavior being similar to starlings.

    Ecology

    Their breeding habitat is grasslands and prairie, also pastures and hay fields. This species is a permanent resident throughout much of its range, though most northern birds migrate southwards in winter.[7] In Central and South America, they tend to be limited to the eastern (Atlantic) side of the continent also. In 1993 this species was first recorded in El Salvador however, and the discovery of a breeding pair in 2004 confirms that the species is a resident there.[8]

    These birds forage on the ground or in low vegetation, sometimes probing with its bill. They mainly eat arthropods, but also seeds and berries. In winter, they often feed in flocks.

    Nesting occurs throughout the summer months. The nest is also on the ground, covered with a roof woven from grasses. There may be more than one nesting female in a male's territory.

    The numbers of this species increased as forests were cleared in eastern North America. This species is ideally suited to farmland areas, especially where tall grasses are allowed to grow. Their numbers are now shrinking with a decline in suitable habitat.[9] On the other hand, its range is expanding in parts of Central America toward the Pacific (western) side of the continent, in agricultural-type areas.[8]

    Gallery

    References

    1. ^ BirdLife International (2012). "Sturnella magna". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
    2. ^ "FieldGuides: Species Detail". eNature. Retrieved 2013-04-01. 
    3. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0849342585.
    4. ^ "Eastern Meadowlark, Life History, All About Birds – Cornell Lab of Ornithology". Allaboutbirds.org. Retrieved 2013-04-01. 
    5. ^ Jaramillo, Alvaro and Burke, Peter (1999) New World Blackbirds: The Icterids, Christopher Helm Publishing, ISBN 978-0713643336
    6. ^ "[Alauda] subtus flava, fascia pectorali curva nigra : rectricibus tribus lateralibus albis. [...] Corpus scolopacinum, magnitudine Turdi, totum subtus flavissimum. Pectus macula magna nigricante lunari. Remiges fuscae: secundariae testaceo maculataa. Cauda rotundata: Rectrices 3 laterales maximum partam albae. Unguis posticus pedum major, sed magis curvus quam in reliquis. Rostrum rectum: Maxilla superior teretiuscula, basi nuda.": Linnaeus, Carl (1758): 93.9. Alauda magna. In: Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis (10th ed., vol.1): 167. Laurentius Salvius, Holmius (= Stockholm). PDF fulltext
    7. ^ Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bulletin 18 (2): 47–60. 
    8. ^ a b Herrera, Néstor; Rivera, Roberto; Ibarra Portillo, Ricardo & Rodríguez, Wilfredo (2006): Nuevos registros para la avifauna de El Salvador. ["New records for the avifauna of El Salvador"]. Boletín de la Sociedad Antioqueña de Ornitología 16(2): 1–19. [Spanish with English abstract] PDF fulltext
    9. ^ "All About Birds: Eastern Meadowlark". Cornell Laboratory of Ornithology. Retrieved 2008-08-13. 
    Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

     

    Source: Wikipedia

    Unreviewed

    Article rating from 0 people

    Average rating: 2.5 of 5

    Names and Taxonomy

    Taxonomy

    Comments: Composed of two groups: MAGNA (Eastern Meadowlark) and LILIANAE (Lilian's Meadowlark) (AOU 1998). Constitutes a superspecies with S. NEGLECTA; they rarely interbreed and hybrids are sterile (AOU 1998). Sibley and Monroe (1990) listed populations in Arizona, New Mexico, western and central Texas, eastern Sonora, and northwestern and central Chihuahua as a distinct species, S. LILIANAE, citing unpublished data on vocalizations, morphology, and genetics and a 1972 paper that suggested that LILIANAE might be a distinct species. See Dickerman (1989) for description of a new subspecies (S. M. QUINTA) from South America.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Disclaimer

    EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

    To request an improvement, please leave a comment on the page. Thank you!