Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Vireo olivaceus

A large (6 inches) vireo, the Red-eyed Vireo is most easily identified by its olive-green back and tail, pale breast, plain wings, and deep red eyes with white eye-stripes. This species may be separated from the Philadelphia Vireo (Vireo philadelphicus), which also has a pale breast and plain back, by that species’ smaller size and yellower breast. Male and female Red-eyed Vireos are similar to one another in all seasons. The Red-eyed Vireo breeds across the eastern United States and southern Canada. This species also occurs in western Canada and parts of the Pacific Northwest, although it is less widespread in those portions of its range. This species is a long-distance migrant, spending the winter in northern and central South America. Red-eyed Vireos breed in a number of woodland habitats with dense undergrowth. During the winter, this species may be found in similarly-structured habitats in and around humid tropical forests. Red-eyed Vireos primarily eat small insects during the summer, but mostly switches to fruits and berries during the winter. In appropriate habitat, Red-eyed Vireos may be seen foraging for food on leaves and branches in the tree canopy as well as in the undergrowth. Birdwatchers may also listen for this species’ song, a series of fluty notes vaguely recalling portions of American Robin songs. Red-eyed Vireos are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: British Columbia, probably southeastern Alaska, and Mackenzie to northern Saskatchewan and Newfoundland, south to northern Oregon, northern Idaho, eastern Colorado, Texas, Gulf Coast, and southern Florida; CHIVI group: South America from Colombia, Venezuela and adjacent islands, and Guianas south, west of Andes to western Ecuador and east of Andes to eastern Peru, Bolivia, and central Argentina, also on Fernando de Noronha off Brazil (AOU 1983, 1987). NORTHERN WINTER: South America (western Amazonia); eastern Colombia, southern Venezuela, eastern Ecuador, eastern Peru, and western Brazil; CHIVI group: northern part of breeding range south to Amazon basin (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Canada, w-central and e US; winters to Cuba and c S America.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Vireo olivaceus is a migratory species that inhabits the Nearctic and Neotropical regions. During the non-breeding season, this species inhabits northeastern South America and is found east of the Andes Mountains as far south as Uruguay. In early spring, Vireo olivaceus travels north through southern Central America, along the Gulf coast and across Cuba, Haiti and the Dominican Republic. Vireo olivaceus breeds across nearly all of the United States, excluding the southwest region. Red-eyed vireos are rarely found south of Oregon or west of Colorado. Their breeding range extends as far north as the Northwest Territories and stretches from nearly coast to coast across southern Canada. Some Vireo olivaceus populations remain in South America to breed and move as far south as northern Argentina, but stay east of the Andes Mountains.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Cimprich, D., F. Moore, M. Guilfoyle. 2000. "The Birds of North America Online" (On-line). Red-eyed Vireo (Vireo olivaceus). Accessed March 16, 2011 at http://bna.birds.cornell.edu/bna/species/527.
  • Dunford, W., D. Burke, E. Nol. 2002. Assessing edge avoidance and area sensitivity of red-eyed vireos in Southcentral Ontario. The Wilson Bulletin, 114/1: 79.
  • Sibley, D. 2000. The Sibley Guide to Birds. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Like all Vireo species, Vireo olivaceus is a small, perching songbird with relatively large, hooked bills. They measure 15.24 cm in length, feature a 25.4 cm wingspan, and weigh an average 18 g. Red-eyed vireos are recognized for their dark red irides that adults feature. However, this characteristic is rarely seen in the field as they are often at the tops of trees. They are olive-green across the nape, back, wings and tail. Throat, breast, and belly are bright white, while the under tail coverts and flanks are pale yellow. These vireos have a gray crown with a contrasting thick, white supercilium and a dark gray eye-line. Bills and legs are dark gray to black. Vireo olivaceus exhibits no sexual dimorphism and juveniles resemble adults, but are more gray-ish green overall.

Closely related species include Vireo flavoviridis and Vireo altiloquus. Their breeding ranges do not overlap, but they may overwinter in similar regions of South America. Vireo flavoviridis can be distinguished by brighter and more extensive yellow under tail coverts, flanks and cheeks. They also have a pale, larger bill as opposed to the dark smaller bill of Vireo olivaceus. Vireo altiloquus is overall brownish-green, with very pale yellow on the under tail coverts and flanks, as well as a defining black "whisker" or lateral stripe down the throat. Each of these species is best defined by song.

Average mass: 17 g.

Average length: 15.2 cm.

Average wingspan: 25.4 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 15 cm

Weight: 17 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Vireo olivaceus olivaceus
Catalog Number: USNM 525739
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female;
Preparation: Skin: Whole
Collector(s): H. Bailey
Year Collected: 1913
Locality: Mountain Lake, Giles, Virginia, United States, North America
  • Type: Bailey, H. H. April 1, 1930. Bailey Mus. Lib. Nat. Hist. Bull. 4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Vireo olivaceus olivaceus
Catalog Number: USNM 420939
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male;
Preparation: Skin: Whole
Collector(s): T. Burleigh
Year Collected: 1952
Locality: Moscow, Latah, Idaho, United States, North America
  • Type: Burleigh. April 20, 1960. Auk. 77 (1): 214.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Open deciduous (less frequently coniferous) forest (especially with sapling undergrowth), mixed forest with deciduous understory, second-growth woodland, scrub, thickets, gardens, mangroves. Most abundant in mature stands. In much of the range, prefers shady oak forests with a high, well-developed closed canopy and a fairly open understory with scanty ground cover (see Bushman and Therres 1988). Most common in forest tracts of at least 15-20 ha but may occur in patches as small as a few hectares (see Bushman and Therres 1988). Prefers closed canopy but tolerates a wide range of canopy closures. In Pennsylvania, more sensitive than other area-dependent birds to increased fragmentation via forest clear-cutting (Yahner 1993). In migration and winter in various open forest, forest edge, woodland, scrub, and brush habitats. Colombia: low to fairly high in shrubby clearings and forest borders (Hilty and Brown 1986).

Nests in fork of slender branch of shrub or low tree, 1-15 m (usually 1-3 m) above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vireo olivaceus prefers to breed in deciduous or mixed forest with dense canopy cover. In coniferous dominated stands they are most often found near riparian areas. They also breed in forested urban parks or cemeteries with old-growth trees that provide a dense canopy. They may be found anywhere from sea level to 2,000 m above in the Rocky Mountains.

In migration, Vireo olivaceus can be found in habitats similar to those used for breeding. They visit a slightly broader range of habitats during migration and may be found in forest edge, second growth forest, or citrus groves.

During the non-breeding season, red-eyed vireos prefer rain forests, second growth forests, plantations and forest edge habitats. They select habitats located from sea level to 3,000 m above.

These vireos are largely considered forest interior species but recent research is suggesting otherwise. Red-eyed vireos have been shown to select sites based on high levels of canopy cover and may be influenced very little by edge effect or fragmentation.

Range elevation: 0 to 3000 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; forest ; rainforest

Other Habitat Features: urban ; riparian

  • Siepielski, A., A. Rodewald, R. Yahner. 2001. Nest site selection and nesting success of the Red-eyed Vireo in Central Pennsylvania. The Wilson Bulletin, 113/3: 302.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward through the eastern U.S. March-May (Terres 1980). North American breeders winter mostly in Amazon basin (Hilty and Brown 1986). Colombia inhabited by resident populations, as well as migrants from temperate and tropical areas to the north and south (Hilty and Brown 1986). North American breeders migrate through Costa Rica mainly late August-early November and early April-late May (Stiles and Skutch 1989). Breeders in southern South America move to Amazonia and southern Venezuela for austral winter (mainly April-August) (Ridgely and Gwynne 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: In north, eats mostly insects, also eats small fruits and arillate seeds; forages in tree canopy, gleans insects from high deciduous foliage (Terres 1980, Bushman and Therres 1988). Notably frugivorous, almost totally so away from breeding areas (Hilty and Brown 1986, Ridgely and Gwynne 1989, Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Vireo olivaceus is primarily an insectivorous species, but also occasionally eats fruit. Diet changes seasonally from nearly exclusively insects during the spring and summer to nearly all fruit during the winter. Main food sources include butterfly larvae (Lepidoptera), beetles (Coleoptera), mosquitoes (Diptera), cicadas (Homoptera), wasps and ants (Hymenoptera), grasshoppers (Orthoptera) and dragonflies (Odonata). These vireos also consume snails (Mollusca) and spiders (Arachnida), although rarely. Red-eyed vireos are foliage gleaners and capture insects setting on leaves or stems while perched, flying or hanging upside-down. There have been a few observations of red-eyed vireos drinking water that had collected on leaves.

Fruits and trees often utilized by red-eyed vireos include dewberries (Rubus), elderberries (Sambucus canadensis), Virginia creeper (Parthenosisus quinquefolia), sassafras (Sassafras albidum), spicebush (Lindera benzoin), dogwood (Cornus), northern arrowwood (Viburnum recognitum), northern bayberry (Myrica pensylvanica), and southern magnolia (Magnolia grandiflora).

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

As primarily insectivores, Vireo olivaceus impact the insect populations they prey upon. Adults, young, and eggs may all be preyed upon and may support local predators. Red-eyed vireos also serve as hosts to parasites such as protozoan blood parasites, feather lice, mites, and hippoboscid flies. Red-eyed vireo nests are often parasitized by brown-headed cowbirds, usually resulting in nest failure. Vireos have on occasion buried the cowbird eggs and built a new nest over top, but this behavior is rare.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult Vireo olivaceus are occasionally preyed upon by sharp-shinned hawks. Eggs and nestlings are significantly more vulnerable than adults and are predated by many species including American crows, blue jays, common grackles, eastern chipmunks, and red squirrels. Red-eyed vireos employ aggressive swooping and pecking to deter predators. Some incubating females crouch into the nest, remain motionless, and rely on their olive coloration as camouflage. Both males and females produce catbird-like mews or "myaahs" when intruders near their nests.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Vireo olivaceus (red-eyed vireo) is prey of:
Accipiter striatus
Accipiter cooperii

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Vireo olivaceus (red-eyed vireo) preys on:
Insecta
Diptera
Auchenorrhyncha
Sternorrhyncha
Lepidoptera
Coleoptera
Arachnida

Based on studies in:
Canada: Manitoba (Forest)
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

45 territories averaged 0.7 ha per pair (Harrison 1979). In maple forests in Quebec, density averaged 1.2 pairs/ha (Darveau et al. 1992). In the Great Lakes region, populations were negatively affected by drought (Hagan and Johnston 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Vireo olivaceus is a vocal species that is frequently heard calling from the upper forest canopy. Their primary call is mostly two-note phrases that are mnemonically described as "Look up! See me? Over here! Do you hear me?" Male red-eyed vireos are one of the most persistent singers of all birds and have been recorded singing 10,000 songs in one day. These songs are used to delineate territory boundaries, and are only sung by males. Both sexes use a call described as a catbird-like mew usually used in aggressive encounters or when predators are near.

Vireo olivaceus also uses postures and body movements to visually communicate. These postures have been identified as Crest-erect Alert, Head-forward Threat, Tail-Fanning, and Gaping displays. All of these displays are used in aggressive encounters between either sexes and are usually followed by pecking if an individual does not retreat. Like all birds, red-eyed vireos perceive their environments through auditory, visual, tactile and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The annual adult survivorship for Vireo olivaceus is estimated at 0.58. Survival rates for chicks post-fledging is much lower, estimated at 0.28. The oldest known red-eyed vireo was banded as an adult in 1963 and recaptured in 1972, making the individual at least 10 years old. Vireo olivaceus is not kept in captivity. Causes of mortality are poorly understood but likely include parasites, brood parasitism, predation, and stress of long-distance migration. Many birds do not survive migration and perish in collisions with buildings or other tall objects during night journeys.

Range lifespan

Status: wild:
10 (high) years.

  • Klimkiewicz, M., R. Clapp, A. Futcher. 1983. Longevity records of North American birds: Remizidae through Parulinae. Journal of Field Ornithology, 54/3: 287-294.
  • Noon, B., J. Sauer. 1992. Populations models for passerine birds: Structure, Parameterization, and Analysis. Pp. 441–464 in D McCullough, R Barrett, eds. Wildlife 2001: Populations. New York, New York: Elsevier Applied Sciences. Accessed March 17, 2011 at http://gis.fs.fed.us/psw/publications/noon/noon8.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nests from mid-May to mid-August (peak late May to mid-July) in the mid-Atlantic region (see Bushman and Therres 1988). Clutch size 3-5 in north (usually 4). Occasionally 2 broods per year. Incubation 11-14 days, mostly or entirely by female. Young tended by both parents, leave nest at 10-14 days. One of commonest cowbird hosts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vireo olivaceus is a monogamous species, but the length of pair-bonds is currently unknown. Males arrive early at the breeding grounds to establish territory and pair formation occurs shortly after the females arrive. No courtship rituals have been observed, but males often chase potential mates and occasionally pin the females to the ground. Red-eyed vireos have been observed to perform a "swaying" display, but this is currently hypothesized to be used to appease individuals rather than court.

Mating System: monogamous

Males arrive on the breeding grounds from mid-March to early May and immediately establish territories. First year individuals are able to breed. Females arrive 3 to 15 days later and select a nesting site within a male's territory. Nests are generally constructed in the crook of a branch in the mid- to understory layer. The most successful nests are well concealed from above by foliage. Female red-eyed vireos build the cup-shaped nests using grasses, twigs, roots, bark strips, or spiderwebs. The females line their nests with softer materials such as grass, pine needles, and occasionally animal hair.

Once the nest is constructed, females lay an average clutch of 4 white, spotted eggs. Females perform all incubation which lasts between 11 and 14 days. After the young hatch, they are tended by both parents. The tiny hatchlings initially weigh between 1.5 and 1.8 g. The young fledge after 10 to 12 days and reach independence after an additional 25 days when the parents stop providing food.

Breeding interval: Red-eyed vireos breed once yearly.

Breeding season: The breeding season for red-eyed vireos occurs from mid-April to August.

Range eggs per season: 3 to 5.

Range time to hatching: 11 to 14 days.

Range birth mass: 1.5 to 1.8 g.

Range fledging age: 10 to 12 days.

Range time to independence: 35 to 37 days.

Average age at sexual or reproductive maturity (female): <1 years.

Average age at sexual or reproductive maturity (male): <1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Male Vireo olivaceus invest time and energy in establishing suitable nesting territories. Males frequently engage in chases and physical aggression to defend their territories. Once females arrive, they provide the majority of parental care. Females select suitable nesting sites and complete all nest construction. Incubation and subsequent brooding of the young is also performed solely by the female. Hatchlings are altricial at birth, which requires significant parental care to feed, protect, and warm the defenseless young. Both parents actively consume or remove egg shells from the nest, which likely reduces the chance of predation by removing the scent of eggs. Fecal sacs are also removed by both parents, mostly by females, and are consumed until the 7th day post-hatch. Males contribute to feeding the hatchlings, but females provide the majority of food. Parents continue to feed the young frequently until 15 or 16 days post-fledging, but then drastically decrease feeding until 25 days post-fledge when feeding ceases.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster.
  • Cimprich, D., F. Moore, M. Guilfoyle. 2000. "The Birds of North America Online" (On-line). Red-eyed Vireo (Vireo olivaceus). Accessed March 16, 2011 at http://bna.birds.cornell.edu/bna/species/527.
  • Nolan, V. 1962. The swaying display of the Red-eyed and other Vireos. The Condor, 64: 273 - 276.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vireo olivaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTCTCAACCAACCATAAAGATATCGGCACTCTGTACCTAATTTTCGGCGCATGAGCCGGAATGGTAGGTACCGCCCTAAGTCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCTCTACTGGGAGACGACCAAATCTATAACGTGGTCGTCACGGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATAATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATTGGGGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCACCATCATTCCTACTACTAATAGCCTCCTCAACAGTAGAAGCAGGCGTTGGAACAGGATGAACCGTATACCCACCACTAGCCGGAAACCTGGCCCATGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCCCTACACCTAGCAGGTATCTCTTCCATCCTAGGAGCAATCAACTTCATTACAACAGCAATCAACATAAAACCACCCGCCCTATCACAATACCAAACACCACTATTCGTATGATCCGTACTAATCACAGCCGTACTACTCCTCCTATCACTCCCAGTGCTAGCTGCTGGAATTACAATACTACTCACAGACCGCAACCTCAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTTTACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vireo olivaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range, common in many areas, stable or increasing populations in most regions, with significant declines in a few states.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently, Vireo olivaceus populations are stable and distributed across a wide geographic range. For these reasons, they are of least concern to conservation organizations. As migratory birds, red-eyed vireos are protected under the United States Migratory Bird Act. Although these birds are currently abundant and can tolerate low levels of habitat destruction, large-scale habitat changes can result in local extinctions. Red-eyed vireos have been shown to tolerate selective harvesting or small areas of clear-cutting that only cause small canopy openings. Any activity that significantly reduces canopy cover (extensive clear-cutting, strip mining, cultivating) can cause red-eyed vireos to abandon the area for 20 to 30 years. If these activities must occur, efforts should be made to leave adequate canopy cover and find a balance between human resource use and environmental protection.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Breeding Bird Survey data indicate a significant population increase in eastern North America, 1966-1989; for the U.S. and Canada overall, the increase averaged 1.5% per year (Droege and Sauer 1990, Sauer and Droege 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Removal and/or excessive fragmentation of mature forest is detrimental. May be negatively impacted by drought and brood parasitism by brown-headed cowbird.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Generally tolerant of a wide range of timber harvesting techniques, including selective logging, thinning "overmature" trees, and small or narrow clearcuts, though a decline with selective logging has been noted in Indiana (see Bushman and Therres 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Vireo olivaceus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

To some extent, Vireo olivaceus controls insect pest populations through it's insectivorous diet. Red-eyed vireos provide little economic benefit to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-eyed vireo

The red-eyed vireo (Vireo olivaceus) is a small American songbird, 13–14 cm (5.1–5.5 in) in length. It is somewhat warbler-like but not closely related to the New World warblers (Parulidae). Common across its vast range, this species is not considered threatened by the IUCN.[2]

Description and systematics[edit]

Chivi vireo at Registro (São Paulo, Brazil)

Adults are mainly olive-green on the upperparts with white underparts; they have a red iris and a grey crown edged with black. There is a dark blackish line through the eyes and a wide white stripe just above that line. They have thick blue-grey legs and a stout bill. They are yellowish on the flanks and undertail coverts (though this is faint in some populations).


Problems playing this file? See media help.

This bird, not always seen, may sing for long periods of time; it appears to be endlessly repeating the same question and answer. It holds the record for most songs given in a single day among bird species. More than 20,000 songs in one day.

The subspecies breeding in South America have a simpler song, a chestnut iris, and different remiges proportions. They are sometimes split as the Chivi vireo, V. chivi. Some of the races concerned are V. o. chivi, V. o. vividior, and V. o. tobagoensis, the last being a relatively large subspecies endemic to Tobago. Even within the Chivi Vireo, there are distinct variations in measurements, song and ecology, but the possible taxonomic significance of this remains unclear.

In the past, the yellow-green vireo (V. flavoviridis) and the Noronha vireo (V. gracilirostris) have been considered as subspecies of the red-eyed vireo.

Ecology[edit]

Bird in nest, Cook Forest State Park (Pennsylvania).
Photo by Vernon R. Martin

The breeding habitat is open wooded areas across Canada and the eastern and northwestern United States. These birds migrate to South America, where they spend the winter. The Latin American population occur in virtually any wooded habitat in their range. Most of these are residents, but the populations breeding in the far southern part of this species' range (e.g. most of its range in Argentina, Uruguay, Paraguay and Bolivia) migrate north as far as Central America.

This vireo is one of the more frequent American passerine vagrants to western Europe, with more than one hundred records, mainly in Ireland and Great Britain. In northern Ohio, it seems to return to breed at about the same time as one century ago; but it may leave for winter quarters one or two weeks earlier at present than it did in the past.[3]

Red-eyed vireos glean insects from tree foliage, favouring caterpillars and aphids and sometimes hovering while foraging. In some tropical regions, they are commonly seen to attend mixed-species feeding flocks, moving through the forest higher up in the trees than the bulk of such flocks.[4]

They also eat berries, especially before migration, and in the winter quarters, where trees bearing popular fruit like Tamanqueiro (Alchornea glandulosa) or Gumbo-limbo (Bursera simaruba) will even attract them to parks and gardens.[5] Fruit are typically not picked up from a hover, but the birds often quite acrobatically reach for them, even hanging upside down.[6]

The nest is a cup in a fork of a tree branch. The red-eyed vireo suffers from nest parasitism by the brown-headed cowbird (Molothrus ater) in the north of its range, and by the shiny cowbird (M. bonariensis) further south. Parasitism by Haemoproteus[7] and trypanosomans might affect these birds not infrequently, as was noted in studies of birds caught in Parque Nacional de La Macarena and near Turbo (Colombia): though only three red-eyed vireos were examined, all were infected with at least one of these parasites.[8]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Vireo olivaceus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ BLI (2008)
  3. ^ Henninger (1906), OOS (2004)
  4. ^ Machado (1999)
  5. ^ Foster (2007). Cymbopetalum mayanum (Annonaceae) is visited far less frequently.
  6. ^ Pascotto (2006)
  7. ^ Haemoproteus vireonis (Basto et al., 2006) and perhaps some other species (Londono et al., 2007).
  8. ^ Basto et al. (2006), Londono et al. (2007)

References[edit]

  • Basto, Natalia; Rodríguez, Oscar A.; Marinkelle, Cornelis J.; Gutierrez, Rafael & Matta, Nubia Estela (2006). Haematozoa in birds from la Macarena National Natural Park (Colombia). Caldasia 28(2): 371-377 [English with Spanish abstract]. PDF fulltext
  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991). A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y. ISBN 0-8014-9792-2
  • Foster, Mercedes S. (2007). The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico. Bird Conservation International 17(1): 45-61. doi:10.1017/S0959270906000554
  • Henninger, W.F. (1906). A preliminary list of the birds of Seneca County, Ohio. Wilson Bull. 18(2): 47-60. DjVu fulltext PDF fulltext
  • Hilty, Steven L. (2003). Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Londono, Aurora; Pulgarin-R., Paulo C. & Blair, Silva (2007). Blood Parasites in Birds From the Lowlands of Northern Colombia. Caribb. J. Sci. 43(1): 87-93. PDF fulltext
  • Machado, C.G. (1999). A composição dos bandos mistos de aves na Mata Atlântica da Serra de Paranapiacaba, no sudeste brasileiro [Mixed flocks of birds in Atlantic Rain Forest in Serra de Paranapiacaba, southeastern Brazil]. Revista Brasileira de Biologia 59(1): 75-85 [Portuguese with English abstract]. doi:10.1590/S0034-71081999000100010 PDF fulltext
  • Ohio Ornithological Society (OOS) (2004). Annotated Ohio state checklist. Version of April 2004. PDF fulltext
  • Pascotto, Márcia Cristina (2006). Avifauna dispersora de sementes de Alchornea glandulosa (Euphorbiaceae) em uma área de mata ciliar no estado de São Paulo [Seed dispersal of Alchornea glandulosa (Euphorbiaceae) by birds in a gallery forest in São Paulo, southeastern Brazil]. Revista Brasileira de Ornitologia 14(3): 291-296 [Portuguese with English abstract]. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Species limits in this complex are uncertain; some authors separate V. FLAVOVIRIDIS and V. GRACILIROSTRIS as distinct species. The CHIVI group (Chivi Vireo) is closely related to the OLIVACEUS group and presumably conspecific with it (AOU 1998). V. FLAVOVIRIDIS was recognized as a distinct species by AOU (1987), based in part on genetic distinctness (Johnson and Zink 1985). May constitute a superspecies with V. GRACILIROSTRIS, V. FLAVOVIRIDIS, V. ALTILOQUUS, and V. MAGISTER (AOU 1998). See Banks and Browning (1995) for information on the use of the specific name OLIVACEUS over VIRESCENS. See Johnson et al. (1988) and Murray et al. (1994) for analyses of the phylogenetic relationships among vireos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!