Articles on this page are available in 1 other language: Chinese (Simplified) (9) (learn more)

Overview

Comprehensive Description

Longueur 14,5 cm, envergure 23-26 cm, poids moyen 16 g.

Ce petit passereau était à l’origine inféodé aux habitats naturels de rochers, falaises et éboulis, en particulier en montagne. Il a su s’adapter à des habitats artificiels tels que les carrières et les constructions humaines, d’où à l’heure actuelle une vaste distribution en plaine également y compris dans les grands centres urbains.

Le Rougequeue noir se nourrit de toutes sortes d’insectes et d’invertébrés. A l’automne en particulier, il recherche aussi les fruits et les baies.

L’espèce est migratrice partielle, envoyant à l’automne des contingents dans la péninsule ibérique voire jusqu’en Afrique du Nord, alors même que certains individus hivernent chez nous, rejoints par des migrateurs nordiques. La migration d’automne est sensible en octobre notamment, celle de printemps a lieu en mars-avril, parfois dès la fin de février. Le chant du mâle est un gazouillis précipité suivi d’un étrange bruit de papier froissé et de quelques notes finales.

La saison de nidification commence en avril, parfois dès la fin de mars, et s’achève en juillet. Le nid est édifié dans un trou de rocher ou dans un mur, les cavités à large ouverture étant préférées. Les matériaux utilisés sont les herbes sèches, feuilles et autres matières végétales, la coupe interne étant garnie de plumes ou de poils. La ponte comprend 4 à 6 œufs couvés par la femelle. Les oisillons éclosent au bout de deux semaines (13 à 17 jours), et sont activement nourris par les deux parents. Ils prennent leur envol au bout de deux semaines (12 à 19 jours). Il peut y avoir deux (voire trois) nichées successives.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phoenicurus ochruros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACCCTCTACTTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTGGGCCAACCTGGCGCCCTACTGGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCATGCTTTTGTCATAATCTTCTTCATAGTTATGCCAATCATAATCGGAGGGTTTGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTTCTTCCCCCATCCTTTCTACTCCTCCTAGCCTCTTCCACCGTTGAAGCAGGGGCAGGAACAGGCTGAACTGTATATCCTCCTCTCGCCGGTAACTTAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTTCACCTAGCAGGTATCTCCTCCATCCTGGGCGCTATCAACTTCATCACCACAGCAATTAACATAAAACCACCCGCCCTTTCACAATACCAAACCCCCCTGTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTCCTCCTATCCTTACCAGTTCTTGCCGCTGGCATTACCATGCTTCTTACAGACCGTAACCTAAACACTACCTTCTTCGACCCTGCAGGAGGAGGAGACCCTGTACTTTACCAGCATCTTTTCTGATTCTTCGGACACCCAGAAGTGTATATCCTAATTCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phoenicurus ochruros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5