Articles on this page are available in 1 other language: Chinese (Simplified) (9) (learn more)

Overview

Comprehensive Description

Longueur 14,5 cm, envergure 23-26 cm, poids moyen 16 g.

Ce petit passereau était à l’origine inféodé aux habitats naturels de rochers, falaises et éboulis, en particulier en montagne. Il a su s’adapter à des habitats artificiels tels que les carrières et les constructions humaines, d’où à l’heure actuelle une vaste distribution en plaine également y compris dans les grands centres urbains.

Le Rougequeue noir se nourrit de toutes sortes d’insectes et d’invertébrés. A l’automne en particulier, il recherche aussi les fruits et les baies.

L’espèce est migratrice partielle, envoyant à l’automne des contingents dans la péninsule ibérique voire jusqu’en Afrique du Nord, alors même que certains individus hivernent chez nous, rejoints par des migrateurs nordiques. La migration d’automne est sensible en octobre notamment, celle de printemps a lieu en mars-avril, parfois dès la fin de février. Le chant du mâle est un gazouillis précipité suivi d’un étrange bruit de papier froissé et de quelques notes finales.

La saison de nidification commence en avril, parfois dès la fin de mars, et s’achève en juillet. Le nid est édifié dans un trou de rocher ou dans un mur, les cavités à large ouverture étant préférées. Les matériaux utilisés sont les herbes sèches, feuilles et autres matières végétales, la coupe interne étant garnie de plumes ou de poils. La ponte comprend 4 à 6 œufs couvés par la femelle. Les oisillons éclosent au bout de deux semaines (13 à 17 jours), et sont activement nourris par les deux parents. Ils prennent leur envol au bout de deux semaines (12 à 19 jours). Il peut y avoir deux (voire trois) nichées successives.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phoenicurus ochruros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACCCTCTACTTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTGGGCCAACCTGGCGCCCTACTGGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCATGCTTTTGTCATAATCTTCTTCATAGTTATGCCAATCATAATCGGAGGGTTTGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTTCTTCCCCCATCCTTTCTACTCCTCCTAGCCTCTTCCACCGTTGAAGCAGGGGCAGGAACAGGCTGAACTGTATATCCTCCTCTCGCCGGTAACTTAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTTCACCTAGCAGGTATCTCCTCCATCCTGGGCGCTATCAACTTCATCACCACAGCAATTAACATAAAACCACCCGCCCTTTCACAATACCAAACCCCCCTGTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTCCTCCTATCCTTACCAGTTCTTGCCGCTGGCATTACCATGCTTCTTACAGACCGTAACCTAAACACTACCTTCTTCGACCCTGCAGGAGGAGGAGACCCTGTACTTTACCAGCATCTTTTCTGATTCTTCGGACACCCAGAAGTGTATATCCTAATTCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phoenicurus ochruros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 4,000,000-8,800,000 breeding pairs, equating to 12,000,000-26,400,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 24,500,000-106,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black redstart

Immature European black redstart
Levantine black redstart Phoenicurus ochruros semirufus

The black redstart (Phoenicurus ochruros) is a small passerine bird in the redstart genus Phoenicurus. Like its relatives, it was formerly classed as a member of the thrush family (Turdidae), but is now known to be an Old World flycatcher (Muscicapidae).

Taxonomy and systematics[edit]

This species belongs to a Eurasian clade which also includes the Daurian redstart, Hodgson's redstart, the white-winged redstart, and maybe the Ala Shan redstart. The present species' ancestors diverged from about 3 mya (Late Pliocene) onwards and spread throughout much of Eurasia from 1.5 mya onward.[2] It is not very closely related to the common redstart. As these are separated by different behaviour and ecological requirements and have not evolved fertilisation barriers, the two European species can nonetheless produce apparently fertile and viable hybrids.[3][4]

There are a number of subspecies which differ mainly in underpart colours of the adult males; different authorities accept between five and seven subspecies. They can be separated into three major groups, according to morphology, biogeography, and mtDNA cytochrome b sequence data.[2][4][5][6]

P. o. phoenicuroides group. basal central and eastern Asian forms which diverged from the ancestral stock as the species slowly spread west (c.3-1.5 mya). Females and juveniles light grey-brown.

  • Phoenicurus ochruros phoenicuroides. Tian Shan eastwards to Mongolia. Small; adult males have lower breast, belly and flanks deep rufous, pale wing-patch absent, sometimes white forehead. Overall quite similar to a much darker common redstart with black chest. Females and juveniles are similar to common redstart but have an overall sandier, paler colour and often a distinct buff eye-ring.
  • Phoenicurus ochruros rufiventris. Turkmenistan eastwards through Pamir and Alay Mountains to Himalaya. Usually large; adult males like P. o. phoenicuroides, but darker overall, with black back and rufous-chestnut underside. Females with rufous tinge to underside. Exact limits with P. o. phoenicuroides unresolved.
    • Phoenicurus ochruros xerophilus. China east of and between ranges of preceding two. Large; colour pattern like P. o. phoenicuroides but paler. Included in P. o. rufiventris by many authorities.[5]

P. o. ochruros group. Western Asian forms, whose lineage separated from the gibraltariensis group c.1.5-0.5 mya. Females and juveniles intermediate.

  • Phoenicurus ochruros ochruros. Eastern Turkey, Alborz, and Caucasus. Small, somewhat intermediate between P. o. phoenicuroides and P. o. gibraltariensis. Generally like latter, but rufous underside, pale wing patch weakly developed.
  • Phoenicurus ochruros semirufus. Levant. Small; adult males somewhat similar to rufiventris except in size. Black areas extensive.

P. o. gibraltariensis group. European population, which formed as a distinct subspecies probably during the last ice age. Females and juveniles dark grey.

  • Phoenicurus ochruros gibraltariensis. Western Europe east to the Crimea and western Turkey. Neck, upper back and shoulders dark slate grey to black in adult males, lighter than face and neck, pale wing patch strongly developed.
    • Phoenicurus ochruros aterrimus. Iberia and Morocco. :Neck, upper back and shoulders black in adult males. Wide intergradation with P. o. gibraltariensis and treated as a synonym of it by many authorities.[5]

Description[edit]

The black redstart is 13–14.5 cm in length and 12–20 g in weight, similar to the common redstart. The adult male is overall dark grey to black on the upperparts and with a black breast; the lower rump and tail are orange-red, with the two central tail feathers dark red-brown. The belly and undertail are either blackish-grey (western subspecies; see Systematics, below) or orange-red (eastern subspecies); the wings are blackish-grey with pale fringes on the secondaries forming a whitish panel (western subspecies) or all blackish (eastern subspecies). The female is grey (western subspecies) to grey-brown (eastern subspecies) overall except for the orange-red lower rump and tail, greyer than the common redstart; at any age the grey axillaries and underwing coverts are also distinctive (in the common redstart these are buff to orange-red). One-year old males are similar to females but blacker; the whitish wing panel of the western subspecies does not develop until the second year.[5][6]

Distribution and habitat[edit]

It is a widespread breeder in south and central Europe and Asia and northwest Africa, from Great Britain and Ireland (where local) south to Morocco, east to central China. It is resident in the milder parts of its range, but northeastern birds migrate to winter in southern and western Europe and Asia, and north Africa. It nests in crevices or holes in buildings.[5][6]

In Britain it is most common in as a passage and winter visitor, with only 20–50 pairs breeding.[7] On passage it is fairly common on the east and south coasts, and in winter on the coasts of Wales and western and southern England, with a few also at inland sites. Migrant Black Redstarts arrive in Britain in October or November and either move on or remain to winter, returning eastward in March or April. They also winter on the south and east coasts of Ireland.[6]

The species originally inhabited stony ground in mountains, particularly cliffs, but since about 1900 has expanded to include similar urban habitats including bombed areas during and after World War II, and large industrial complexes that have the bare areas and cliff-like buildings it favours; in Great Britain, most of the small breeding population nests in such industrial areas. It will catch passing insects in flight, and migrants often hunt in coastal tide-wrack for flies or tiny crustaceans. Its quick ducks of head and body are robin-like, and its tail is often flicked. The male has a rattling song and a tick call.

Eastern race birds are very rare vagrants in western Europe.[3]

References[edit]

  1. ^ BirdLife International (2012). "Phoenicurus ochruros". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Ertan, K. T. (2006). The Evolutionary History of Eurasian Redstarts, Phoenicurus. Acta Zoologica Sinica 52 (Supplement): 310–313. PDF fulltext
  3. ^ a b Steijn, Laurens B. (2005) Eastern Black Redstarts at IJmuiden, the Netherlands, and on Guernsey, Channel Islands, in October 2003, and their identification, distribution and taxonomy Dutch Birding 27(3):171-194
  4. ^ a b Grosch, K. (2004). Hybridization Between Redstart Phoenicurus phoenicurus and Black Redstart P. ochruros, and the Effect on Habitat Exploitation. J. Avian Biol. 35 (3): 217-223 doi:10.1111/j.0908-8857.2004.03128.x (HTML abstract)
  5. ^ a b c d e Hoyo, J. del, et al., eds. (2005). Handbook of the Birds of the World, vol. 10. Barcelona: Lynx Edicions. pp. 770–771. ISBN 84-87334-72-5. 
  6. ^ a b c d Snow, D. W., & Perrins, C. M. (1998). The Birds of the Western Palearctic (Concise Edition ed.). Oxford: Oxford University Press. ISBN 0-19-854099-X. 
  7. ^ Holling, M. et al. (2010). Rare breeding birds in the United Kingdom in 2008. British Birds 103: 482–538.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!