Articles on this page are available in 2 other languages: Chinese (Simplified) (10), Dutch (1) (learn more)

Overview

Brief Summary

Everyone knows the bird on the English Christmas card. European robins may look cute but they are not very tolerant. They can be very aggresive when defending their large territory. They will stick out their chests, shake their body back and forth and eventually assault their competitor with their beaks. They mark off their territory by singing. Their pearly song can be heard throughout the year: a kind of tinkling waterfall of whistled tones. It's not just the males that mark the territory while singing, the females sing just as loudly.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Although the robin has been recorded feeding on a very wide range of food, the majority of the diet consists of invertebrates, soft fruit and seeds (3). As most of the food is taken from the ground, snowfall can cause huge numbers of deaths (3). Robins are very territorial birds throughout the year; in winter both males and females defend their own territory, and males often hold the same territory throughout their lives (3). Territories are defended by means of singing from a prominent perch, and by aggressively driving intruders away (5). During the breeding season, a female is allowed into a male's territory; she makes the cup-shaped nest of dead leaves and moss with a lining of hair (5). The nest is often located in unusual places, such as in old teapots, jacket pockets, and on shelves in buildings, as well as in more 'natural' locations such as amongst ivy (5). After the end of March, between 4 and 6 white or faintly bluish, speckled eggs are laid (7), and incubated by the female for up to 15 days. After hatching the young are fed by the female on items of food brought to the nest by the male (5). Two broods are usually produced each year, although a pair may occasionally go on to rear a third (5). Not surprisingly, there is much folklore surrounding the robin, and it has featured in many poems and fables. Furthermore, in Britain the robin is closely associated with Christmas. The first postmen wore bright red waistcoats, and were popularly known as 'Robins'; this may explain not only why robins are often featured on Christmas cards, but also why they are frequently depicted holding a letter in the beak, delivering the mail (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Robin is undoubtedly one of Britain's most dearly loved birds (3). It is instantly recognisable due to the rusty-red breast; indeed, 'Robin redbreast' and simply 'redbreast' are well-known alternative names (4). The sexes are very similar, but juveniles lack the red breast and are mottled with browns and buffs (5). The robin is one of the few birds to sing throughout the winter; its melodious, liquid song is a further feature that has endeared this species to the public (5). A short 'tick' call is also produced (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Widely distributed throughout Britain, with the exception of islands and the higher hills of Scotland (5). It also occurs throughout much of Europe, reaching as far east as central Siberia, as well as parts of North Africa and Turkey (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

0

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Anna Blume

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.705 - 10.083
  Nitrate (umol/L): 1.327 - 6.274
  Salinity (PPS): 6.218 - 35.157
  Oxygen (ml/l): 6.360 - 8.325
  Phosphate (umol/l): 0.240 - 0.497
  Silicate (umol/l): 1.816 - 10.160

Graphical representation

Temperature range (°C): 7.705 - 10.083

Nitrate (umol/L): 1.327 - 6.274

Salinity (PPS): 6.218 - 35.157

Oxygen (ml/l): 6.360 - 8.325

Phosphate (umol/l): 0.240 - 0.497

Silicate (umol/l): 1.816 - 10.160
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in a range of habitats, but typically requires the presence of both dense vegetation and open areas. It breeds in woodlands, gardens, forest edges, parks (2), and even city centres (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / parasite / ectoparasite / blood sucker
nymph of Ixodes ricinus sucks the blood of Erithacus rubecula

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 17.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Erithacus rubecula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 70
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Erithacus rubecula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTTTACCTAATCTTTGGCGCATGAGCCGGAATGGTAGGCACCGCCCTAAGCCTCCTAATCCGAGCAGAACTGGGTCAACCAGGCGCCCTACTAGGAGACGACCAAGTATATAATGTTGTAGTAACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATCGGCGGATTCGGAAATTGACTGGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTTCTTCTCCTAGCCTCCTCTACAGTTGAAGCCGGAGCCGGGACAGGCTGAACCGTATATCCACCTCTAGCCGGCAACCTGGCCCACGCCGGAGCCTCAGTAGATCTGGCCATCTTCTCCCTCCACCTAGCAGGTATTTCCTCAATCCTAGGTGCCATCAATTTCATCACAACCGCCATTAACATAAAACCACCCGCTCTCTCACAATACCAAACACCCCTATTCGTCTGATCTGTCCTAATTACTGCAGTCCTACTTCTCCTCTCCCTCCCTGTCCTTGCTGCCGGCATCACAATGCTCCTCACCGACCGTAACTTAAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCGGTACTATATCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATTCTACCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Widespread and common species (3). Included in the Birds of Conservation Concern Green List (low conservation concern) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 43,000,000-83,000,000 breeding pairs, equating to 129,000,000-249,000,000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 137,000,000-332,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European robin

The European robin (Erithacus rubecula), most commonly known in Anglophone Europe simply as the robin, is a small insectivorous passerine bird, specifically a chat, that was formerly classed as a member of the thrush family (Turdidae), but is now considered to be an Old World flycatcher. Around 12.5–14.0 cm (5.0–5.5 in) in length, the male and female are similar in colouration, with an orange breast and face lined with grey, brown upperparts and a whitish belly. It is found across Europe, east to Western Siberia and south to North Africa; it is sedentary in most of its range except the far north.

The term robin is also applied to some birds in other families with red or orange breasts. These include the American robin (Turdus migratorius), which is a thrush, and the Australian red robins of the genus Petroica, members of a family whose relationships are unclear.

Taxonomy and systematics[edit]

The European robin was one of the many species originally described by Linnaeus in his 18th century work, Systema Naturae, under the name of Motacilla rubecula.[2] Its specific epithet rubecula is a diminutive derived from the Latin ruber 'red'.[3] The genus Erithacus was created by French naturalist Georges Cuvier in 1800, giving the bird its current binomial name of E. rubecula.[4]

The distinctive orange breast of both sexes contributed to the European robin's original name of redbreast (orange as the name of a colour was unknown in English until the sixteenth century, by which time the fruit of that name had been introduced). In the fifteenth century, when it became popular to give human names to familiar species, the bird came to be known as robin redbreast, which was eventually shortened to robin.[5] Other older English names for the bird include ruddock and robinet. In American literature of the late 19th century, this robin was frequently called the English robin.[6] The Frisian robyntsje or robynderke is similar to the English name,[7] while Dutch roodborstje and French rouge-gorge both refer to the distinctively coloured front.[8] In German the bird is called "Rotkehlchen", literally a diminutive of "Red Throat".

The robin belongs to a group of mainly insectivorous birds that have been variously assigned to the thrushes or "flycatchers", depending on how these groups were perceived taxonomically. Eventually, the flycatcher-thrush assemblage was re-analysed and the genus Erithacus assigned to a group of thrush-like true flycatchers, the tribe Saxicolini, that also includes the common nightingale and the Old World chats.[9]

Two Eastern Palearctic species are usually placed in the genus Erithacus, the Japanese robin (E. akahige) and the Ryūkyū robin (E. komadori), the latter being a restricted-range island species. Biogeography and mtDNA cytochrome b sequence data indicate that these might better be classified with some Far Eastern "nightingales", leaving only the European species in Erithacus.[10]

Subspecies[edit]

The British subspecies, Erithacus rubecula melophilus, differs only slightly from Continental birds.

In its large continental Eurasian range, robins vary somewhat, but do not form discrete populations that might be considered subspecies.[11][12] Thus, robin subspecies are mainly distinguished by forming resident populations on islands and in mountainous areas. The robin found in the British Isles and most of western Europe, Erithacus rubecula melophilus, also occurs as a vagrant in adjacent regions. E. r. witherbyi from Northwestern Africa, Corsica, and Sardinia closely resembles melophilus but for a shorter wing length.[13] The northeasternmost birds, large and fairly washed-out in colour are E. r. tataricus. In the southeast of its range, E. r. valens of the Crimean Peninsula, E. r. caucasicus of the Caucasus and N Transcaucasia, and E. r. hyrcanus southeastwards into Iran are generally accepted as significantly distinct.[13]

On Madeira and the Azores, the local population has been described as E. r. microrhynchos, and although not distinct in morphology, its isolation seems to suggests the subspecies is valid (but see below).

Canary Islands robin[edit]

Adult and juvenile exemplaries of Gran Canaria's robin.

The most distinct birds are those of Gran Canaria (E. r. marionae) and Tenerife (E. r. superbus), which may be considered two distinct species or at least two different subspecies. It is readily distinguished by a white eye-ring, an intensely coloured breast, and a grey line that separates the orange-red from the brown colouration. Its belly is entirely white.[14]

Cytochrome b sequence data and vocalisations[15] indicate that the Gran Canaria/Tenerife robins are indeed very distinct and probably derived from colonisation by mainland birds some 2 million years ago.[16] In addition, Gran Canaria and Tenerife birds are well distinct genetically between each other.

Christian Dietzen, Hans-Hinrich Witt and Michael Wink published in 2003 in Avian Science a study called "The phylogeographic differentiation of the European robin Erithacus rubecula on the Canary Islands revealed by mitochondrial DNA sequence data and morphometrics: evidence for a new robin taxon on Gran Canaria?".[11] In it they concluded that Gran Canaria's robin diverged genetically from their European relatives as far back as 2.3 million years, while the Tenerife ones took half a million years to make this leap, 1.8 million years ago. The reason would be a different colonization of the Canaries by this bird, which arrived to the oldest island first (Gran Canaria) and subsequently passed to the neighboring island (Tenerife).[17]

A thorough comparison between marionae and superbus is pending to confirm that the first one is effectively a different subspecies. Initial results suggest that birds from Gran Canaria have wings about 10% shorter than those on Tenerife.[11]

The west Canary Islands populations are younger (Middle Pleistocene) and only beginning to diverge genetically. Robins from the western Canary Islands: El Hierro, La Palma and La Gomera (E. (r.) microrhynchus) are similar to the European (Erithacus rubecula).[13]

Finally, the robins which can be found in Fuerteventura are the European ones, which is not surprising as the species does not breed either in this island or in the nearby Lanzarote, they are wintering exemplaries or just passing through during their long migrations between Africa and Europe.[17]

Other robins[edit]

The larger American robin (Turdus migratorius) is named for its similarity to the European robin, but the two birds are not closely related. The similarity lies largely in the orange chest patch in both species. This American species was incorrectly shown "feathering its nest" in London in the film Mary Poppins,[18] but it only occurs in the UK as a very rare vagrant.[19] Some South and Middle American Turdus thrushes are also named as robins such as the rufous-collared robin. The Australian "robin redbreast", more correctly the scarlet robin (Petroica multicolor), is more closely related to the crows and jays than it is to the European robin. It belongs to the family Petroicidae, commonly called "Australasian robins". The red-billed leiothrix (Leiothrix lutea) is sometimes named "Pekin robin" by aviculturalists. Yet another group of Old World Flycatchers, this time from Africa and Asia is the genus Copsychus; its members are known as magpie-robins, one of which, the Oriental magpie robin (C. saularis), is the national bird of Bangladesh.[20]

Description[edit]

Juvenile in West Sussex, England

The adult European robin is 12.5–14.0 cm (5.0–5.5 in) long and weighs 16–22 g (9/16–13/16 oz), with a wingspan of 20–22 cm (8–9 in). The male and female bear similar plumage; an orange breast and face (more strongly coloured in the otherwise similar British subspecies E. r. mesophilus), lined by a bluish grey on the sides of the neck and chest. The upperparts are brownish, or olive-tinged in British birds, and the belly whitish, while the legs and feet are brown. The bill and eyes are black. Juveniles are a spotted brown and white in colouration, with patches of orange gradually appearing.[21]

Distribution and habitat[edit]

The robin occurs in Eurasia east to Western Siberia, south to Algeria and on the Atlantic islands as far west as the Azores and Madeira. It is not found in Iceland.[21] In the south east, it reaches the Caucasus range. British robins are largely resident but a small minority, usually female, migrate to southern Europe during winter, a few as far as Spain. Scandinavian and Russian robins migrate to Britain and western Europe to escape the harsher winters. These migrants can be recognised by the greyer tone of the upper parts of their bodies and duller orange breast. The European robin prefers spruce woods in northern Europe, contrasting with its preference for parks and gardens in the British Isles.[22]

Attempts to introduce the European robin into Australia and New Zealand in the latter part of the 19th century were unsuccessful. Birds were released around Melbourne, Auckland, Christchurch, Wellington and Dunedin by various local Acclimatisation societies, with none becoming established. There was a similar outcome in North America as birds failed to establish after being released in Long Island, New York in 1852, Oregon in 1889–92, and the Saanich Peninsula in British Columbia in 1908–10.[23]

Behaviour and ecology[edit]

Feeding from a hand

The robin is diurnal, although has been reported to be active hunting insects on moonlit nights or near artificial light at night.[12] Well known to British and Irish gardeners, it is relatively unafraid of people and likes to come close when anyone is digging the soil, in order to look out for earthworms and other food freshly turned up. Indeed, the robin is considered to be a gardener's friend and for various folklore reasons the robin would never be harmed. In continental Europe on the other hand, robins were hunted and killed as with most other small birds, and are more wary.[21] Robins also approach large wild animals, such as wild boar and other animals which disturb the ground, to look for any food that might be brought to the surface. In autumn and winter, robins will supplement their usual diet of terrestrial invertebrates, such as spiders, worms and insects, with berries and fruit.[22] They will also eat seed mixtures placed on bird-tables.[21]

Male robins are noted for their highly aggressive territorial behaviour. They will attack other males that stray into their territories, and have been observed attacking other small birds without apparent provocation. Such attacks sometimes lead to fatalities, accounting for up to 10% of adult robin deaths in some areas.[24]

Because of high mortality in the first year of life, a robin has an average life expectancy of 1.1 years; however, once past its first year it can expect to live longer and one robin has been recorded as reaching 12 years of age.[25] A spell of very low temperatures in winter may also result in significant mortality.[24] This species is parasitised by the moorhen flea, Dasypsyllus gallinulae[26]

Breeding[edit]

Nest with five eggs
A single egg

Robins may choose a wide variety of sites for building a nest, in fact anything which can offer some shelter, like a depression or hole may be considered. As well as the usual crevices, or sheltered banks, odder objects include pieces of machinery, barbecues, bicycle handlebars, bristles on upturned brooms, discarded kettles, watering cans, flower pots and even hats. The nest is composed of moss, leaves and grass, with finer grass, hair and feathers for lining. Two or three clutches of five or six eggs are laid throughout the breeding season, which commences in March in Britain and Ireland. The eggs are a cream, buff or white speckled or blotched with reddish-brown colour, often more heavily so at the larger end.[27] When juvenile birds fly from the nests they are mottled brown in colour all over. After two to three months out of the nest, the juvenile bird grows some orange feathers under its chin and over a similar period this patch gradually extends to complete the adult appearance.

Vocalisations[edit]

Song 1
Song 2
Singing near Doolin, Ireland

The robin has a fluting, warbling About this sound song  in the breeding season, when they often sing into the evening, and sometimes into the night, leading some to confuse them with the common nightingale (Luscinia megarhynchos). Nocturnal singing in urban robins occurs in places that are noisy during the day, suggesting that they sing at night because it is quieter, and their message can propagate through the environment more clearly. Daytime noise outperformed night-time light pollution as a predictor of nocturnal singing activity in urban robins in Sheffield, England.[28] Both the male and female sing during the winter, when they hold separate territories, the song then sounding more plaintive than the summer version.[21] The female robin moves a short distance from the summer nesting territory to a nearby area that is more suitable for winter feeding. The male robin keeps the same territory throughout the year.

Magnetoreception[edit]

The avian magnetic compass of the robin has been extensively researched and uses Vision-Based Magnetoreception, in which the robin's ability to sense the magnetic field of the earth for navigation is affected by the light entering the bird's eye. The physical mechanism of the robin's magnetic sense is not fully understood, but may involve quantum entanglement of electron spins.[29]

Cultural depictions[edit]

1880 Engraving

The robin features prominently in British folklore, and that of northwestern France, but much less so in other parts of Europe.[30] It was held to be a storm-cloud bird and sacred to Thor, the god of thunder, in Norse mythology.[31] Robins also feature in the traditional children's tale, Babes in the Wood; the birds cover the dead bodies of the children.[32] More recently, the robin has become strongly associated with Christmas, taking a starring role on many Christmas cards since the mid 19th century.[32] The robin has also appeared on many Christmas postage stamps. An old British folk tale seeks to explain the robin's distinctive breast. Legend has it that when Jesus was dying on the cross, the robin, then simply brown in colour, flew to his side and sang into his ear in order to comfort him in his pain. The blood from his wounds stained the robin's breast, and thereafter all robins got the mark of Christ's blood upon them.[31][33] An alternative legend has it that its breast was scorched fetching water for souls in Purgatory.[32] The association with Christmas, however, more probably arises from the fact that postmen in Victorian Britain wore red jackets and were nicknamed "Robins"; the robin featured on the Christmas card is an emblem of the postman delivering the card.[34]

In the 1960s, in a vote publicised by The Times newspaper, the robin was adopted as the unofficial national bird of the UK.[35] The robin was then used as a symbol of a Bird Protection Society.[36]

Several English and Welsh sports organisations are nicknamed "The Robins". These include the professional football clubs Bristol City, Swindon Town, Cheltenham Town (whose home colours are red) and, traditionally, Wrexham FC, as well as the English Rugby League team Hull Kingston Rovers (whose home colours are white with a red band).[37] A small bird is an unusual choice, though it is thought to symbolise agility in darting around the field.[38] Moreover, the Swindon Robins is the full name of the local Speedway promotion.

References[edit]

Notes[edit]

  1. ^ BirdLife International (2012). "Erithacus rubecula". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. (in Latin). Holmiae. (Laurentii Salvii). p. 188. "M. grisea, gula pectoreque fulvis." 
  3. ^ Simpson, D.P. (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd. p. 883. ISBN 0-304-52257-0. 
  4. ^ (French) Cuvier, G. (1800) Lecons d'Anatomie Comparée Paris.
  5. ^ Lack, D. (1950). Robin Redbreast. Oxford: Oxford, Clarendon Press. p. 44. 
  6. ^ Sylvester, Charles H. (2006). Journeys Through Bookland. BiblioBazaar, LLC. p. 155. ISBN 1-4264-2117-6. 
  7. ^ J. Simpson, E. Weiner (eds), ed. (1989). "Robin". Oxford English Dictionary (2nd ed.). Oxford: Clarendon Press. ISBN 0-19-861186-2. 
  8. ^ Holland J (1965). Bird Spotting. London: Blandford. p. 225. 
  9. ^ Monroe Jr. BL, Sibley CG (1993). A World Checklist of Birds. New Haven and London: Yale University Press. p. 228. ISBN 0-300-05549-8. 
  10. ^ Seki, Shin-Ichi (2006): The origin of the East Asian Erithacus robin, Erithacus komadori, inferred from cytochrome b sequence data. Molecular Phylogenetics and Evolution 39(3): 899–905. doi:10.1016/j.ympev.2006.01.028 PMID 16529957
  11. ^ a b c Dietzen, C.; Witt, H.-H. & Wink, M. (2003): The phylogeographic differentiation of the robin Erithacus rubecula on the Canary Islands revealed by mitochondrial DNA sequence data and morphometrics: evidence for a new robin taxon on Gran Canaria? Avian Science 3(2-3): 115-131.
  12. ^ a b (German)Pätzold R (1995). Das Rotkehlchen Erithacus rubecula. Neue Brehm-Bücherei. Magdeburg/Heidelberg: Westarp Wissenschaften/Spektrum. ISBN 3-89432-423-6. 
  13. ^ a b c Lack D (1946). "The Taxonomy of the Robin, Erithacus rubecula (Linnaeus)". Bulletin of the British Ornithologists' Club 66: 55–64. 
  14. ^ Cramp S (ed.) (1988). Handbook of the Birds of Europe, the Middle East and North Africa. The Birds of the Western Palearctic. Volume V. Tyrant Flycatchers to Thrushes. Oxford: Oxford University Press. ISBN 0-19-857508-4. 
  15. ^ Bergmann, H. H. & Schottler, B. (2001): Tenerife robin Erithacus (rubecula) superbus - a species of its own? Dutch Birding 23: 140–146.
  16. ^ Although Dietzen et al. (2003) conclude that both Tenerife and Gran Canaria populations are independently derived from mainland populations and should constitute two species or all be placed in E. rubecula as subspecies, their data does not allow for a definite conclusion. The alternative explanation – that Tenerife was colonised by already-distinct Gran Canaria robins – has not been explored and the proposed model relies only on probabilistic inference. Likewise, the seemingly exact molecular dating is doubtful as it assumes a molecular clock that may or may not be correct, and of course the assumption that the ancestor of all robins was similar in colouration to superbus and not the continental birds is, being inferred from their model of colonisation, entirely conjectural.
  17. ^ a b César-Javier Palacios, Hallazgo en Gran Canaria de una especie de petirrojo única en el mundo (Discovery in Gran Canaria of a unique robin species in the world). Newspaper Canarias 7, 6/10/2006. Las Palmas de Gran Canaria
  18. ^ "Mary Poppins (1964)". IMDb. Retrieved 2008-01-21. 
  19. ^ "Village braced for invasion of twitchers as rare visitor flies in", John Roberts, Yorkshire Post, 26 January
  20. ^ "National Icons of Bangladesh". Bangla2000. Retrieved 5 August 2010. 
  21. ^ a b c d e Hume R (2002). RSPB Birds of Britain and Europe. London: Dorling Kindersley. p. 263. ISBN 0-7513-1234-7. 
  22. ^ a b Jonsson, Lars (1976). Birds of Wood, Park and Garden. Middlesex, England: Penguin. p. 90. ISBN 0-14-063002-3. 
  23. ^ Long, John L. (1981). Introduced Birds of the World: The worldwide history, distribution and influence of birds introduced to new environments. Terrey Hills, Sydney: Reed. p. 309. ISBN 0-589-50260-3. 
  24. ^ a b "The RSPB-Robin:Territory". RSPB website. Retrieved 2008-05-17. 
  25. ^ "British garden birds - lifespan". garden-birds.co.uk. Retrieved 2007-04-07. 
  26. ^ Rothschild, Miriam; Clay, Theresa (1957). Fleas, Flukes and Cuckoos. A study of bird parasites. New York: Macmillan. p. 113. 
  27. ^ Evans G (1972). The Observer's Book of Birds' Eggs. London: Warne. p. 85. ISBN 0-7232-0060-2. 
  28. ^ Fuller RA, Warren PH, Gaston KJ (2007). "Daytime noise predicts nocturnal singing in urban robins". Biology Letters 3 (4): 368–70. doi:10.1098/rsbl.2007.0134. PMC 2390663. PMID 17456449. 
  29. ^ "Cryptochrome and Magnetic Sensing". Theoretical and Computational Biophysics Group. 
  30. ^ Ingersoll, p. 167
  31. ^ a b Cooper, JC (1992). Symbolic and Mythological Animals. London: Aquarian Press. p. 194. ISBN 1-85538-118-4. 
  32. ^ a b c de Vries, Ad (1976). Dictionary of Symbols and Imagery. Amsterdam: North-Holland Publishing Company. pp. 388–89. ISBN 0-7204-8021-3. 
  33. ^ Goodall, Simon (November 2013). "European robin (Erithacus rubecula)" (in English). Greater Manchester Local Record Centre. Retrieved 17 May 2014. "In Christian folklore the robin got its red breast because it plucked a thorn from Jesus’ crown-of-thorns during His crucifixion. A drop of Jesus’ blood fell on to the bird and thereafter they had a red breast – for Christians the robin has long been associated with charity and piety." 
  34. ^ "BBC Science & Nature:Animals". bbc.co.uk. Retrieved 2008-01-03. 
  35. ^ "Robin". BBC. Retrieved 24 September 2010. 
  36. ^ Public Petition Committee of the Scottish Parliament. National Bird (PE783). 10 November 2004. The Enterprise and Culture Committee of the Scottish Parliament Agenda (25th Meeting, session 2) on 31 Oct 2006
  37. ^ Hull Kingston Rovers RLFC. "Hull Kingston Rovers: History". Official Website. Hull Kingston Rovers RLFC. Retrieved 2012-02-22. 
  38. ^ Morris, Desmond (1981). The Soccer Tribe. London: Jonathan Cape. p. 210. ISBN 0-224-01935-X. 

Cited text[edit]

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!