Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

There is no other bird that sings so deeply, so full of ecstacy as the nightingale. The melody is endlessly varied. Nightingales are therefore best known for their singing talent. In the spring, they sing during the day as well as at night, however their songs are often drowned by disturbing noises. Nightingales live mostly in thick vegetation from shrubs with lots of stinging nettle and blackberries. In the Netherlands, the majority of the nightingales make their nests in the dunes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Common nightingales (Luscinia megarhynchos) have a large geographic range. They are native to, and widely distributed in, central and southern Europe and central Asia. Locally distributed in the British Isles, they are more commonly seen in France, Italy, and Spain during the summer when they nest. Common nightingales prefer milder and warmer climates than their close relatives, thrush nightingales (Luscinia luscinia). During the winter, common nightingales migrate to the tropics of northern and central Africa, including western Sahara, Egypt, Cote d'Ivoire, Kenya, Cameroon, and Nigeria, among others.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Common nightingales are rather plain in appearance compared to their remarkable singing abilities. They are slightly larger than European robins (Erithacus rubecula) and their body is brown in color except on the underside, where the feathers become lighter. They have broad, chestnut colored tails, and large, black eyes which are adorned with a white ring around each eye. Males and females are similar in appearance, except that males tend to be slightly larger, with larger wingspans. However, females sometimes weigh more because males have higher metabolic rates due to their tendency to sing.

Range mass: 18 to 23 g.

Average mass: 21 g.

Range length: 14 to 17 cm.

Average length: 16.5 cm.

Range wingspan: 20 to 24 cm.

Average wingspan: 22.5 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common nightingales typically prefer habitats with mild to warm climates. They can be found in areas with dense, low thicket growth or woodlands with young trees and bare ground underneath. They prefer habitats with coppiced tree species, and are most often found in hazel trees. This is ideal for Luscinia megarhynchos because it provides a good hiding place from predators while allowing them to search for food and make nests safely. Due to the recent decline in the population of common nightingales in England, researchers have investigated whether a cutback of suitable habitats may have caused the decline. Various factors, including climate change, changes in the quality of habitats, the introduction of Reeve's muntjacs (Muntiacus reevesi), and the re-introduction of roe deer (Capreolus capreolus) have all contributed to population declines in Britain. Reeve's muntjacs and roe deer graze in the woods typically inhabited by common nightingales, which reduces the density of shrubs.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common nightingales are primarily insectivores, preying on insects such as beetles, ants, worms, and spiders found on the ground. They also eat insect larvae. In the autumn common nightingales sometimes eat berries and other fruits.

Animal Foods: insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: fruit

Primary Diet: carnivore (Insectivore , Vermivore); herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Common nightingales, like many songbirds, play an important role in the ecosystem by eating insects that may damage leaves and the growth of trees. Tawny owls prey on common nightingales.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The major known predators of common nightingales are tawny owls, Strix aluco. In order to decrease their risk of predation, common nightingales tend to reduce the amount and volume of night time singing when not actively attracting mates.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Common nightingales communicate with others by singing whistle and non-whistle songs. Whistle songs are used during breeding season. The number of whistle songs decrease when males successfully mate. When trying to attract a female, a male will sing for up to 50% of the night. Males lose weight each night when they sing (Thomas, 2002). There are several metabolic consequences to singing at night, one of which is that common nightingales must spend time during the day looking for food in order to build up a larger body reserve, thereby giving up the time that it could take to sing and increasing the chance of being seen by predators.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Common nightingale typical lifespan ranges from one to five years. The oldest recorded age is at 8 years and 4 months old. Although little is known about what typically limits the lifespan of common nightingales, there is no doubt that predation and habitat reduction contribute to the relatively short lifespan. There has been no recorded lifespan of a nightingale in captivity.

Range lifespan

Status: wild:
1 to 8 years.

Average lifespan

Status: wild:
5 years.

Typical lifespan

Status: wild:
1 to 5 years.

Average lifespan

Status: wild:
3.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

One of the most notable characteristics of common nightingales is their beautiful singing ability, especially by male birds. Common nightingales are well known for singing during the night, hence their name. Older males have improved mating success due to their larger song repertoire and territory, which attracts females better. They are reported to have a 53% larger song repertoire than younger males, and the repertoire is reported to consist of approximately 180 to 260 song variations. Researchers have not discovered yet why song repertoire increases so dramatically in older males. Upon mating successfully, males change the types of their songs by reducing their whistle songs, which are used to attract females, and ceasing their nocturnal songs until their mate lays eggs.

The mating season is a highly competitive time for common nightingales. It takes a tremendous amount of energy to sing and male songs may reflect their body condition, resulting in female selection of the best singers (Schmidt et al., 2005). More aggressively singing males will have a better chance of mating success. Up to 49% of males may not successfully find a mate. Males defend their nest territory very aggressively, fighting and chasing away trespassing birds.

Common nightingales are seasonally monogamous.

Mating System: monogamous

Breeding in common nightingales takes place around mid-May each year. Nests are usually set up by the female among the twigs found in dense shrubs, using dried leaves and grass. Incubation lasts approximately thirteen to fourteen days by the female. Each egg is 21 by 16 mm, weighing 2.7 g, of which 6% is the shell. Common nightingales reach sexual maturity at the age of one.

Breeding interval: Common nightingales breed from May through June. First clutches can be expected around May 13th.

Breeding season: Breeding typically occurs between May 5th and June 6th.

Range eggs per season: 4 to 5.

Average eggs per season: 4.63.

Range time to hatching: 13 to 14 days.

Average time to hatching: 13.75 days.

Range fledging age: 11 to 13 days.

Average fledging age: 11.98 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Before the eggs hatch, the female incubates the eggs, and both parents project the eggs from predators. When the eggs hatch, both parents take care of the offspring by feeding and nurturing them until they can survive on their own. The fledgling period lasts between 11 to 13 days.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Luscinia megarhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCAGGCGCCTTACTAGGGGACGACCAAATTTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGTTTCGGAAACTGACTGGTTCCACTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCCCCATCTTTCCTTCTCCTTCTGGCTTCTTCCACAGTTGAAGCAGGAGCGGGAACAGGATGAACTGTTTACCCACCCCTTGCAGGAAACTTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATTTTTTCCCTTCACCTAGCAGGCATTTCCTCAATCCTAGGCGCTATTAACTTCATCACAACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACCCCTCTATTCGTCTGATCAGTCCTAATCACTGCAGTGCTCCTCCTCCTATCTCTCCCCGTCCTTGCCGCTGGCATCACTATGCTCCTCACTGACCGCAACCTAAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCTGTCCTCTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTATACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Luscinia megarhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Changes in common nightingale habitat quality and quantity in Britain has resulted in a decline in the local population over the last two decades. The decline is also affected by predation pressure and introduction of non-native species such as roe deer (Capreolus capreolus) which graze in nightingale habitat. Also, while common nightingales prefer a mild climate, Britain's climate has recently become colder and wetter, which also contributes to the population decline. There has been speculation that these birds are facing problems in their wintering grounds due to changes in climate and habitat as well. According to The State of Europe’s Common Birds 2007 report, common nightingales experienced a 63% population decline in Europe between 1980 and 2005. Due to their importance in Britain, common nightingales have been placed on the Amber List.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 4200000-12000000 breeding pairs, equating to 12600000-36000000 individuals (BirdLife International 2004). Europe forms 50-74% of the global range, so a very preliminary estimate of the global population size is 17000000-72000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Luscinia megarhynchos on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Many people are fans of common nightingale songs. These birds are important in western European culture. Perhaps one of the most famous roles is in the John Keats poem, "Ode to a Nightingale," in which the poet describes the beauty of a nightingale's song. Tchaikovsky was said to be inspired by the nightingale's song while composing "The Nightingale", op. 60 no. 4. Stravinsky also composed a piece referring to the nightingale's song in "Song of the Nightingale and Chinese March". Including research and education, common nightingales are important for birdwatchers and people who appreciate the beauty of their songs.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Nightingale

The Common Nightingale or simply Nightingale (Luscinia megarhynchos), also known as Rufous Nightingale, is a small passerine bird that was formerly classed as a member of the thrush family Turdidae, but is now more generally considered to be an Old World flycatcher, Muscicapidae. It belongs to a group of more terrestrial species, often called chats.

Contents

Description [edit]

Nightingale

The Common Nightingale is slightly larger than the European Robin, at 15–16.5 cm (5.9–6.5 in) length. It is plain brown above except for the reddish tail. It is buff to white below. Sexes are similar. The eastern subspecies L. m. hafizi and L. m. africana have paler upperparts and a stronger face-pattern, including a pale supercilium.

Distribution and habitat [edit]

It is a migratory insectivorous species breeding in forest and scrub in Europe and south-west Asia, but is not found naturally in the Americas. The distribution is more southerly than the very closely related Thrush Nightingale Luscinia luscinia. It nests on the ground within or next to dense bushes. It winters in southern Africa. At least in the Rhineland (Germany), the breeding habitat of nightingales agrees with a number of geographical parameters.[2]

Behaviour and ecology [edit]

Common Nightingales are named so because they frequently sing at night as well as during the day. The name has been used for well over 1,000 years, being highly recognizable even in its Anglo-Saxon form – 'nightingale'. It means 'night songstress'. Early writers assumed the female sang when it is in fact the male. The song is loud, with an impressive range of whistles, trills and gurgles. Its song is particularly noticeable at night because few other birds are singing. This is why its name includes "night" in several languages. Only unpaired males sing regularly at night, and nocturnal song is likely to serve to attract a mate. Singing at dawn, during the hour before sunrise, is assumed to be important in defending the bird's territory. Nightingales sing even more loudly in urban or near-urban environments, in order to overcome the background noise. The most characteristic feature of the song is a loud whistling crescendo, absent from the song of Thrush Nightingale. It has a frog-like alarm call.

Relationship with humans [edit]

The Common Nightingale is an important symbol for poets from a variety of ages, and has taken on a number of symbolic connotations. Homer evokes the Nightingale in the Odyssey, suggesting the myth of Philomela and Procne (one of whom, depending on the myth's version, is turned into a nightingale[3] ).[4] This myth is the focus of Sophocles' tragedy, Tereus, of which only fragments remain. Ovid, too, in his Metamorphoses, includes the most popular version of this myth, imitated and altered by later poets, including Chrétien de Troyes, Geoffrey Chaucer, John Gower, and George Gascoigne. T.S. Eliot's "The Waste Land" also evokes the Common Nightingale's song (and the myth of Philomela and Procne).[5] Because of the violence associated with the myth, the nightingale's song was long interpreted as a lament.

The Common Nightingale has also been used as a symbol of poets or their poetry.[6] Poets chose the nightingale as a symbol because of its creative and seemingly spontaneous song. Aristophanes's Birds and Callimachus both evoke the bird's song as a form of poetry. Virgil compares the mourning of Orpheus to the “lament of the nightingale”.[7]

In Sonnet 102 Shakespeare compares his love poetry to the song of the Common Nightingale (Philomel):

"Our love was new, and then but in the spring,
When I was wont to greet it with my lays;
As Philomel in summer's front doth sing,
And stops his pipe in growth of riper days:"

During the Romantic era the bird's symbolism changed once more: poets viewed the nightingale not only as a poet in his own right, but as “master of a superior art that could inspire the human poet”.[8] For some romantic poets, the nightingale even began to take on qualities of the muse. Coleridge and Wordsworth saw the nightingale more as an instance of natural poetic creation: the nightingale became a voice of nature. John Keats' "Ode to a Nightingale" pictures the nightingale as an idealized poet who has achieved the poetry that Keats longs to write. Invoking a similar conception of the nightingale, Shelley wrote in his “A Defense of Poetry":

"A poet is a nightingale who sits in darkness and sings to cheer its own solitude with sweet sounds; his auditors are as men entranced by the melody of an unseen musician, who feel that they are moved and softened, yet know not whence or why.”[9]

Cultural depictions [edit]

References [edit]

  1. ^ BirdLife International (2012). "Luscinia megarhynchos". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ (German) Wink, Michael (1973): " Die Verbreitung der Nachtigall (Luscinia megarhynchos) im Rheinland". Charadrius 9(2/3): 65-80. (PDF)
  3. ^ Salisbury, Joyce E. (2001), Women in the ancient world, ABC-CLIO, p. 276, ISBN 978-1-57607-092-5 
  4. ^ Chandler, Albert R. (1934), "The Nightingale in Greek and Latin Poetry", The Classic Journal (The Classical Association of the Middle West and South, Inc.) XXX (2): 78–84 
  5. ^ Eliot, T.S. (1964), The Waste Land and Other Poems (Signet Classic ed.), New York, NY: Penguin Group, pp. 32–59, ISBN 978-0-451-52684-7 
  6. ^ Shippey, Thomas (1970), "Listening to the Nightingale", Comparative Literature (Duke University Press) XXII (1): 46–60 
  7. ^ Doggett, Frank (1974), "Romanticism's Singing Bird", Studies in English Literature 1500-1900 (Rice University) XIV (4): 568 
  8. ^ Doggett, Frank (1974), "Romanticism's Singing Bird", Studies in English Literature 1500-1900 (Rice University) XIV (4): 570 
  9. ^ Bysshe Shelley, Percy (1903), A Defense of Poetry, Boston, MA: Ginn & Company, p. 11 
  10. ^ Stedman, Edmund C. (1884), "Keats", The Century, XXVII: 600 
  11. ^ Swinburne, Algernon Charles (1886), "Keats", Miscellanies, New York: Worthington Company, p. 221, retrieved 2008-10-08 . Reprinted from the Encyclopædia Britannica.
  12. ^ "The Rose and nightingale in Persian literature". Archived from the original on 2008-01-22. 
  13. ^ The Nightingale
  14. ^ 1 Kuna Coin. – Retrieved on 31 March 2009.
  15. ^ Ragtime Nightingale
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!