Articles on this page are available in 2 other languages: Dutch (1), Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

There is no other bird that sings so deeply, so full of ecstacy as the nightingale. The melody is endlessly varied. Nightingales are therefore best known for their singing talent. In the spring, they sing during the day as well as at night, however their songs are often drowned by disturbing noises. Nightingales live mostly in thick vegetation from shrubs with lots of stinging nettle and blackberries. In the Netherlands, the majority of the nightingales make their nests in the dunes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Common nightingales (Luscinia megarhynchos) have a large geographic range. They are native to, and widely distributed in, central and southern Europe and central Asia. Locally distributed in the British Isles, they are more commonly seen in France, Italy, and Spain during the summer when they nest. Common nightingales prefer milder and warmer climates than their close relatives, thrush nightingales (Luscinia luscinia). During the winter, common nightingales migrate to the tropics of northern and central Africa, including western Sahara, Egypt, Cote d'Ivoire, Kenya, Cameroon, and Nigeria, among others.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Physical Description

Morphology

Common nightingales are rather plain in appearance compared to their remarkable singing abilities. They are slightly larger than European robins (Erithacus rubecula) and their body is brown in color except on the underside, where the feathers become lighter. They have broad, chestnut colored tails, and large, black eyes which are adorned with a white ring around each eye. Males and females are similar in appearance, except that males tend to be slightly larger, with larger wingspans. However, females sometimes weigh more because males have higher metabolic rates due to their tendency to sing.

Range mass: 18 to 23 g.

Average mass: 21 g.

Range length: 14 to 17 cm.

Average length: 16.5 cm.

Range wingspan: 20 to 24 cm.

Average wingspan: 22.5 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common nightingales typically prefer habitats with mild to warm climates. They can be found in areas with dense, low thicket growth or woodlands with young trees and bare ground underneath. They prefer habitats with coppiced tree species, and are most often found in hazel trees. This is ideal for Luscinia megarhynchos because it provides a good hiding place from predators while allowing them to search for food and make nests safely. Due to the recent decline in the population of common nightingales in England, researchers have investigated whether a cutback of suitable habitats may have caused the decline. Various factors, including climate change, changes in the quality of habitats, the introduction of Reeve's muntjacs (Muntiacus reevesi), and the re-introduction of roe deer (Capreolus capreolus) have all contributed to population declines in Britain. Reeve's muntjacs and roe deer graze in the woods typically inhabited by common nightingales, which reduces the density of shrubs.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common nightingales are primarily insectivores, preying on insects such as beetles, ants, worms, and spiders found on the ground. They also eat insect larvae. In the autumn common nightingales sometimes eat berries and other fruits.

Animal Foods: insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: fruit

Primary Diet: carnivore (Insectivore , Vermivore); herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Common nightingales, like many songbirds, play an important role in the ecosystem by eating insects that may damage leaves and the growth of trees. Tawny owls prey on common nightingales.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The major known predators of common nightingales are tawny owls, Strix aluco. In order to decrease their risk of predation, common nightingales tend to reduce the amount and volume of night time singing when not actively attracting mates.

Known Predators:

  • tawny owls (Strix aluco)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Common nightingales communicate with others by singing whistle and non-whistle songs. Whistle songs are used during breeding season. The number of whistle songs decrease when males successfully mate. When trying to attract a female, a male will sing for up to 50% of the night. Males lose weight each night when they sing (Thomas, 2002). There are several metabolic consequences to singing at night, one of which is that common nightingales must spend time during the day looking for food in order to build up a larger body reserve, thereby giving up the time that it could take to sing and increasing the chance of being seen by predators.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Common nightingale typical lifespan ranges from one to five years. The oldest recorded age is at 8 years and 4 months old. Although little is known about what typically limits the lifespan of common nightingales, there is no doubt that predation and habitat reduction contribute to the relatively short lifespan. There has been no recorded lifespan of a nightingale in captivity.

Range lifespan

Status: wild:
1 to 8 years.

Average lifespan

Status: wild:
5 years.

Typical lifespan

Status: wild:
1 to 5 years.

Average lifespan

Status: wild:
3.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

One of the most notable characteristics of common nightingales is their beautiful singing ability, especially by male birds. Common nightingales are well known for singing during the night, hence their name. Older males have improved mating success due to their larger song repertoire and territory, which attracts females better. They are reported to have a 53% larger song repertoire than younger males, and the repertoire is reported to consist of approximately 180 to 260 song variations. Researchers have not discovered yet why song repertoire increases so dramatically in older males. Upon mating successfully, males change the types of their songs by reducing their whistle songs, which are used to attract females, and ceasing their nocturnal songs until their mate lays eggs.

The mating season is a highly competitive time for common nightingales. It takes a tremendous amount of energy to sing and male songs may reflect their body condition, resulting in female selection of the best singers (Schmidt et al., 2005). More aggressively singing males will have a better chance of mating success. Up to 49% of males may not successfully find a mate. Males defend their nest territory very aggressively, fighting and chasing away trespassing birds.

Common nightingales are seasonally monogamous.

Mating System: monogamous

Breeding in common nightingales takes place around mid-May each year. Nests are usually set up by the female among the twigs found in dense shrubs, using dried leaves and grass. Incubation lasts approximately thirteen to fourteen days by the female. Each egg is 21 by 16 mm, weighing 2.7 g, of which 6% is the shell. Common nightingales reach sexual maturity at the age of one.

Breeding interval: Common nightingales breed from May through June. First clutches can be expected around May 13th.

Breeding season: Breeding typically occurs between May 5th and June 6th.

Range eggs per season: 4 to 5.

Average eggs per season: 4.63.

Range time to hatching: 13 to 14 days.

Average time to hatching: 13.75 days.

Range fledging age: 11 to 13 days.

Average fledging age: 11.98 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Before the eggs hatch, the female incubates the eggs, and both parents project the eggs from predators. When the eggs hatch, both parents take care of the offspring by feeding and nurturing them until they can survive on their own. The fledgling period lasts between 11 to 13 days.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Luscinia megarhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCAGGCGCCTTACTAGGGGACGACCAAATTTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGTTTCGGAAACTGACTGGTTCCACTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCCCCATCTTTCCTTCTCCTTCTGGCTTCTTCCACAGTTGAAGCAGGAGCGGGAACAGGATGAACTGTTTACCCACCCCTTGCAGGAAACTTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATTTTTTCCCTTCACCTAGCAGGCATTTCCTCAATCCTAGGCGCTATTAACTTCATCACAACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACCCCTCTATTCGTCTGATCAGTCCTAATCACTGCAGTGCTCCTCCTCCTATCTCTCCCCGTCCTTGCCGCTGGCATCACTATGCTCCTCACTGACCGCAACCTAAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCTGTCCTCTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTATACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Luscinia megarhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5