Overview

Brief Summary

Biology

Flycatchers get their family name from their method of catching insects on the wing. The birds choose a prominent perch from which they make rapid forays after their insect prey. Pied flycatchers arrive in the UK in April and establish their nests in tree holes or nest boxes. The nest can be anywhere between one and fifteen metres above the ground. Up to eight pale greeny-blue eggs are laid and both sexes carry out the job of incubation. The eggs hatch after 13 days and the chicks are fed by the parent birds for another two weeks, before the young leave the nest. The birds start their return migration in October.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The pied flycatcher is a summer visitor to the UK. They are not easily seen as they tend to keep to the upper branches of trees. The males have a striking plumage consisting of a white underside and black back, black head mask and black primary wing feathers. There is a noticeable white patch on the upper wing and a less conspicuous one on the forehead at the base of the upper part of the bill. Females have a brown back and head mask, while the upper wings and tail are darker grey-brown. The underside is more buff in colour than the striking white of the male. Juvenile birds have similar markings to the female. The birds can vary somewhat in their plumage depending on the local race of the species. There is a closely related bird found in central Europe, Asia Minor and North West Africa called the collared flycatcher (Ficedula albicollis). They are very similar in appearance to the pied flycatcher and, where the two species' ranges overlap, hybrids have been known to occur. The call of the pied flycatcher is a sharp, metallic-sounding 'pik-pik-pik' and the song is a melodious high-pitched warble.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Pied flycatchers breed all over Europe, extending into the subalpine regions. They arrive on their breeding grounds in May and migrate to the tropical west African coast, between the equator and 15 degrees north, for the winter.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Coppack, T., I. Tindemans, M. Czisch, A. Van der Linden, P. Berthold, F. Pulidos. 2006. Can long-distance migratory birds adjust to the advancement of spring by shortening migration distance? The response of the pied flycatcher to latitudinal photoperiodic variation. Global Change Biology, 14: 2516-2522.
  • Siilkamaki, P., O. Ratti, M. Hovi, G. Bennett. 1997. Association between haematozoan infections and reproduction in the Pied Flycatcher. Functional Ecology, 11: 176-183.
  • Lampe, H., Y. Espmark. 2003. Mate choice in Pied Flycatchers Ficedula hypoleuca: can females use song to find high-quality males and territories?. IBIS, 145 (online): E24-E33.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Pied flycatchers range across most of Europe and into Russia. They winter in southern Europe and West Africa. In the UK, their breeding areas are concentrated in Wales and north-west England. The birds are not recorded as breeding in south-east England.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pied flycatchers are small passerines, weighing about 13 grams. They are darker dorsally and lighter ventrally, with white bars on the dorsal sides of their wings. They often hold their wing tips lower than their tails, which is normal for flycatchers. Females and immature males are light brown ventrally and dark brown dorsally. The plumage of males darkens as they age, until they reach a jet black color. Male plumage reflects ultraviolet light. During nesting, brooding females have an incubation patch which can be used to determine sex.

Male birds have white spots on their foreheads, just above their beaks. The size of these spots directly correlates with a male’s attractiveness to a female. The size also indicates the male’s immune competence, and larger patches are correlated with fewer trypanosome infections. Usually males are the only ones with white forehead patches, but in some populations females may have them as well. These populations are generally in the southern parts of their range, and the patch is a sign of ageing, rather than health.

Insectivores, like pied flycatchers, generally have intermediate basal metabolic rates when compared to similar birds eating different diets. Temperate species average higher basal metabolic rates (BMR) than tropical species, and flighted birds are higher than flightless ones. There are other factors influencing the BMRof a species, including plumage color. Pied flycatchers average about 0.84 kJ/h in BMR.

Average mass: 13 g.

Average length: 13 cm.

Average wingspan: 22 cm.

Average basal metabolic rate: 0.84 kJ/h cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

  • McNab, B. 2009. Ecological factors affect the level and scaling of avian BMR. Comparative Biochemistry and Physiology, Part A 152: 22-45.
  • BirdGuides Ltd. 2009. "Pied Flycatcher Ficedula hypoleuca" (On-line). BirdGuides. Accessed January 07, 2009 at http://www.birdguides.com/species/species.asp?sp=137055.
  • Morales, J., J. Moreno, S. Merino, J. Sanz, G. Tomas, E. Arriero, E. Lobato, J. Martinez-de la Puente. 2007. Female ornaments in the Pied Flycatcher Ficedula hypoleuca: associations with age, health and reproductive success. IBIS, 149: 245-254.
  • Robinson, R. 2005. "BirdFacts: profiles of birds occurring in Britain & Ireland" (On-line). Pied Flycatcher Ficedula hypoleuca. Accessed January 07, 2009 at http://blx1.bto.org/birdfacts/results/bob13490.htm.
  • Roskaft, E., T. Jarvi. 1982. Male plumage colour and mate choice of female Pied Flycatchers Ficedula hypoleuca . IBIS, 125: 396-400.
  • Sanz, J. 2001. Experimentally reduced male attractiveness increases parental care in the pied flycatcher Ficedula hypoleuca . Behavioral Ecology, 12 (2): 171-176.
  • Siitari, H., J. Honkavaara, E. Huhta, J. Viitala. 2002. Ultraviolet reflection and female mate choice in the pied flycatcher, Ficedula hypoleuca . Animal Behavior, 63: 97-102.
  • Winkel, W. 1998. Monoterritorial bigyny in the Pied Flycatcher Ficedula hypoleuca . IBIS, 140: 178-180.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pied flycatchers winter on the tropical coast of west Africa. In the breeding seasons pied flycatchers are found in forests, and forest composition varies by region. In central Europe, pied flycatchers prefer high altitude beech and spruce forests. They are also found at middle altitude levels, where beech and spruce mix with deciduous forest. Breeding in the middle altitude zone brings them in contact with collared flycatchers (Ficedula albicollis), which prefer low altitudes and deciduous trees. These sister species are normally separated by altitude, tree species preference, and foraging strategy; pied flycatchers prefer foraging near the ground, while collared flycatchers prefer the canopy. However, these two species still produce hybrids at a rate of 2.6% where they co-occur.

In Finland, pied flycatchers prefer large patches of dense, old-growth forest containing deciduous trees and Scots pine (Pinus sylvestris). Territories with deciduous trees proved better in this case, since they provided more food.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; mountains

Aquatic Biomes: coastal

  • Adamik, P., S. Bures. 2007. Experimental evidence for species-specific habitat preferences in two flycatcher species in the hybrid zone. Naturwissenschaften, 94: 859-863.
  • Huhta, E., J. Jokimaki, P. Rahko. 1998. Distribution and reproductive success of the Pied Flycatcher Ficedula hypoleuca in relation to forest patch size and vegetation characteristics; the effect of scale. IBIS, 140: 214-222.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.275 - 10.275
  Nitrate (umol/L): 7.182 - 7.182
  Salinity (PPS): 33.744 - 33.744
  Oxygen (ml/l): 6.451 - 6.451
  Phosphate (umol/l): 0.514 - 0.514
  Silicate (umol/l): 4.619 - 4.619
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the UK, pied flycatchers are usually found in upland open mixed deciduous woodland, but are particularly fond of mature oak woods as these trees tend to support rich insect populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Pied flycatchers often catch their prey in the air. They are insectivorous and eat many types of invertebrates, including beetles, spiders, and caterpillars. They also eat flies, ants, bees, and wasps, moths and their larvae. Individuals in populations in polluted areas eat more larvae and fewer moths and spiders than in populations in less polluted areas.

Interestingly, pied flycatchers are not fooled by eyespots on butterfly wings. They will attack butterflies with and without eyespots at equal frequencies.

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

  • Marchetti, C., D. Locatelli, A. Van Noordwijk, N. Baldaccini. 1998. The effects of prey size on diet differentiation of seven passerine species at two spring stopover sites. IBIS, 140: 25-34.
  • Eeva, T., M. Ryoma, J. Riihimaki. 2005. Pollution-related changes in diets of to insectivorous passerines. Oecologia, 145: 629-639.
  • Lyytinen, A., P. Brakefield, J. Mappes. 2003. Significance of butterfly eyespots as an anti-predator device in ground-based and aerial attacks. Oikos, 100: 373-379.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Pied flycatchers are subject to a range of parasitic infections. The white patches on their foreheads and wings lack the protection of melanin, so those areas are more prone to breakage, bacterial infection, and lice infestations. Pied flycatchers carry infestations of mites and fleas.

Nestlings are parasitized by blow fly larvae (Protocaliphora azurea). Well-fed nestlings are more resistant to parasitism. Blood parasite infections increase in parents with large clutches. Haemoproteus balmorali affects males more, while Haemoproteus pallidus affects females. The increased infection rate is probably due to the birds spending their energy on feeding their young at a cost to their immune systems.

Pied flycatchers have a varying relationship with northern wood ants (Formica aquilonia). When they nest in trees containing these ants, their nests are at risk of predation from the ants. However, when there is another predator which may eat the nestlings, like Eurasian jays (Garrulus glandarius), pied flycatchers may choose to nest in trees with wood ants because they help to defend against jays.

Mutualist Species:

Commensal/Parasitic Species:

  • Merino, S., J. Potti. 1998. Growth, nutrition, and blow fly parasitism in nestling Pied Flycatcchers. Canadian Journal of Zoology, 76: 936-941.
  • Haemig, P. 1999. Predation risk alters interactions among species: competition and facilitation between ants and nesting birds in a boreal forest. Ecology Letters, 2: 178-184.
  • Merino, S., J. Potti. 1996. Weather dependent effects of nest ectoparasites on their bird hosts. Ecography, 19: 107-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Groups of pied flycatchers respond to predators by mobbing them. Whichever bird spots the intruder will send out a mobbing call to alert the other flycatchers. If the intrusion is serious enough, several pied flycatchers will group together and harass the predator until it leaves. While this is a good strategy for large groups with many possible recruits for the mob, it can be dangerous for birds in less dense living situations. Predators like martens (Martes) may learn the mobbing call and respond to it, coming to attack the nests of birds while they are busy attacking the original intruder.

Stoats (Mustela erminea), least weasels (Mustela nivalis), and martens (Martes) raid nests. Goshawks (Accipiter gentilis), Eurasian sparrowhawks (Accipiter nisus), and tawny owls (Strix aluco) prey on fledgling and adult pied flycatchers.

Mobbing is reciprocal. When a bird hears the mobbing call, it may choose to assist or not. Assisting in mobbing behavior is dangerous, so some birds choose not to help their neighbors. However, birds who do not help in mobbing are significantly less likely to be helped if their nests are threatened.

Known Predators:

  • Selas, V., C. Steel. 1998. Large brood sizes of pied flycatcher, sparrowhawk and goshawk in peak microtine years: support for the mast depression hypothesis. Oecologia, 116: 449-455.
  • Krama, T., I. Krams. 2004. Cost of mobbing call to breeding pied flycatcher, Ficedula hypoleuca . Behavioral Ecology, 16 (1): 37-40.
  • Krams, I., T. Krama, K. Iguane. 2006. Mobbing behavior: reciprocity-based co-operation in breeding Pied Flycatchers Ficedula hypoleuca . IBIS, 148: 50-54.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Pied flycatchers can see in the ultraviolet spectrum and females use this ability to choose mates. Males also use ultraviolet reflection to visually inspect the eggs his mate has laid. Eggs that reflect in the ultraviolet spectrum receive more parental investment from male parents. Pied flycatchers also use song, plumage color, and egg color to send signals to each other.

Communication Channels: visual ; acoustic

Perception Channels: ultraviolet; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Pied flycatchers can reproduce until they are 6 years old, few birds reproduce after that age. The oldest recorded bird was found in Finland, aged 10 years and 11 months old.

Range lifespan

Status: wild:
131 (high) months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both monogamy and polygyny occur in this species. When a male has two mates, he usually keeps two separate territories, but sometimes both females will coexist in one territory, sometimes even on the same nest. Single females lay 5 to 7 eggs, two females laying together can produce double the eggs. Despite having so many eggs, however, females that nest together only average 1.1 more offspring than monogamous females. In bigynous systems with two territories, the primary female fares better than the secondary female, who may have been tricked into mating with an already paired male. The male usually provides more for his primary mate than the secondary mate, and sometimes he abandons his secondary mate altogether.

Polygyny may also represent a cost to males. Polygynous males are more likely to have unhatched eggs. They are also more likely to be cheated on by one or both mates, causing them to expend energy raising chicks that aren’t theirs.

Secondary female mates may receive a benefit from mating with an already paired male in the form of good genes. This is consistent with the “sexy son” hypothesis and suggests that sons inherit their father’s attractiveness and get more mates, resulting in the same number of grandchildren as the primary female. There is no evidence of this "sexy son" hypothesis in pied flycatchers. Huk and Winkel (2006) found sons of polygynous males were more reproductively successful, but this was true only for sons of primary females, not secondary female mates.

Males use songs to attract females. Bright plumage and complex songs indicate better fitness, so they are preferred by females. Their plumage is even ultraviolet reflective to make it bright to the females’ eyes. One of the best and quickest ways to judge males in an area is to listen to their songs, since the best males arrived first and got the best territories.

Males arrive first in breeding areas and set up their territories. They nest in holes or in nest boxes. They must defend their locations from other males, so they stay near the nest hole. Since they can’t move far from the nest hole without risking the loss of their spot, females are the ones who peruse available males and choose mates. Females generally choose older males first, who are identified by their jet black and white plumage instead of the brown, grey, grayish brown, and light black plumage of younger males. Older males are most likely to become polygamous.

Mating System: monogamous ; polygynous

It appears pied flycatchers not only prefer to nest in boxes, but are more successful when they do. Females begin laying eggs one or two days earlier and lay more eggs when in nest boxes. Larger clutch size is probably due to greater space, since clutch size is correlated with the area of the bottom of the nest. They experience less predation, possibly because the entrance to the box is higher than the actual nest. In natural holes, the entrance may be closer to the nest, making contents easier to access. If given enough nest boxes, these birds will nest at densities up to 200 pairs per square kilometer. In natural nests with optimal settings, they will only nest at densities at a quarter of that level. Breeding success in nest boxes ranges from 72% to over 80%, whereas in natural nests success is usually 54%.

Pied flycatchers lay 6 to 7 eggs which are 17 mm long and 13 mm wide. Eggs weigh about 1.7 grams, about 5% of that is the mass of the shell. The female incubates for 13 to 15 days. Young are altricial at hatching, with a thin covering of down. They fledge 16 to 17 days later.

Breeding interval: Pied flycatchers mate once a year, beginning in May.

Breeding season: Pied flycatchers breed from May into July.

Range eggs per season: 6 to 7.

Range time to hatching: 13 to 15 days.

Range fledging age: 16 to 17 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Some females will lay their eggs in another female’s nest. Intraspecific nest parasitism is rare for pied flycatchers, and females guard their nests vigorously to avoid having to raise a chick that is not their own. Females are most aggressive toward each other in the nest building and egg laying phases of their reproductive cycles.

Some females reduce their clutch sizes by removing an egg. They place the egg on the rim of the nest, where it cools until the embryo is dead. Ejections most commonly occur after a particularly cold day. Females who eject eggs are more likely to overlap reproduction and moulting, two processes which require a lot of energy and are usually performed separately. Combining reproduction and moulting may indicate the female in question simply isn’t interested in reproduction as much as non-ejecting females. Other females who eject their eggs are either old (over four years) or have poor immune systems, both of which are physiological factors which make females less-than-ideal mothers.

Brood size affects parental investment by determining how much food parents need to supply. Parents often can’t supply enough when they have too many young. Parents with large clutches make more visits to the nest, but they make fewer visits per nestling than parents with smaller clutches. They don’t bring more food per visit, so each nestling gets less to eat than nestlings in smaller clutches. When presented with too little food, nestlings invest their nutrients in growing muscle and bone, because deficits in these areas are hard to make up later, and they will neglect proper gut development, which can be made up later. Neglecting gut development results in a shorter gut and less absorption abilities, which worsens their undernourishment.

The eggs are blue-green, a color caused by biliverdin, a pigment and an anti-oxidant. The more biliverdin is present in the egg shell, the brighter the egg and the more maternal antibodies it contains. This is important because the better the hatchling's immune system is, the more likely it will grow up healthy and able to reproduce. Laying bright eggs is the female’s way of signaling to her mate that she is healthy and producing good eggs. Deeply colored eggs have young with better immune systems. Eggshells with high levels of immunoglobins even move into the ultraviolet spectrum. Males visit the nest and assess the color of eggs. Males spend more time provisioning young hatched from eggs with good coloring. Male contributions relieve some of the burden on females, allowing her to recover and regain her health after incubation.

Sanz (2001) performed an experiment in which he reduced the size of the white patch on mated males. He found males with smaller white patches (therefore, less attractive males) spent more energy bringing food to their young. The young grew larger than those of unaltered fathers, which shows a clear benefit from the extra provisioning. Females did not change their feeding habits regardless of the males’ attractiveness or effort. The extra effort could be caused by the male being aware he is less attractive and therefore less able to successfully solicit extra-pair copulations, so he invests his time more in parenting.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male)

  • Morales, J., J. Sanz, J. Moreno. 2006. Egg colour reflects the amount of yolk maternal antibodies and fledging success in a songbird. Biology Letters, 2: 334-336.
  • Moller, A., T. Mousseau. 2007. Birds prefer to breed in sites with low radioactivity in Chernobyl. Proceedings of the Royal Society, 274: 1443-1448.
  • Huk, T., W. Winkel. 2006. Polygyny and its fitness consequences for primary and secondary female pied flycatchers. Proceedings of the Royal Society, 273: 1681-1688.
  • Lampe, H., Y. Espmark. 2003. Mate choice in Pied Flycatchers Ficedula hypoleuca: can females use song to find high-quality males and territories?. IBIS, 145 (online): E24-E33.
  • Lobato, E., J. Moreno, S. Merino, J. Sanz, E. Arriero, J. Morales, G. Tomas, J. Martinez-de la Puente. 2006. Maternal clutch reduction in the pied flycatcher Ficedula hypoleuca: an undescribed clutch size adjustment mechanism. Journal of Avian Biology, 37: 637-641.
  • Lubjuhn, T., W. Winkel, J. Epplen, J. Brun. 2000. Reproductive success of monogamous and polygynous pied flycatchers (Ficedula hypoleuca). Behav. Ecol. Sociobiol., 48: 12-17.
  • Moreno, J., J. Morales, E. Lobato, S. Merino, G. Tomas, J. Martinez-de la Puente. 2005. Evidence for the signalling function of egg color in the pied flycatcher Ficedula hypoleuca . Behavioral Ecology, 16: 931-937.
  • Moreno, J., J. Morales, E. Lobato, S. Merino, G. Tomas, J. Martinez-de la Puente. 2006. More colourful eggs induce a higher relative paternal investment in the pied flycatcher Ficedula hypoleuca: a cross-fostering experiment. Journal of Avian Biology, 37: 555-560.
  • Nilsson, S. 1984. Clutch size and breeding success of the Pied Flycatcher Ficedula hypoleuca in natural tree-holes. IBIS, 126: 407-410.
  • Robinson, R. 2005. "BirdFacts: profiles of birds occurring in Britain & Ireland" (On-line). Pied Flycatcher Ficedula hypoleuca. Accessed January 07, 2009 at http://blx1.bto.org/birdfacts/results/bob13490.htm.
  • Roskaft, E., T. Jarvi. 1982. Male plumage colour and mate choice of female Pied Flycatchers Ficedula hypoleuca . IBIS, 125: 396-400.
  • Sanz, J. 2001. Experimentally reduced male attractiveness increases parental care in the pied flycatcher Ficedula hypoleuca . Behavioral Ecology, 12 (2): 171-176.
  • Siitari, H., J. Honkavaara, E. Huhta, J. Viitala. 2002. Ultraviolet reflection and female mate choice in the pied flycatcher, Ficedula hypoleuca . Animal Behavior, 63: 97-102.
  • Winkel, W. 1998. Monoterritorial bigyny in the Pied Flycatcher Ficedula hypoleuca . IBIS, 140: 178-180.
  • Wright, J., C. Hinde, J. Fazey, C. Both. 2002. Begging signals more than just short-term need: cryptic effects of brood size in the pied flycatcher (Ficedula hypoleuca). Behavioral Ecology Sociobiology, 52: 74-83.
  • Yom-Tov, Y., J. Wright, C. Both. 2000. Intraspecific nest parasitism and nest guarding in the Pied Flycatcher Ficedula hypoleuca . IBIS, 142: 331-332.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ficedula hypoleuca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAAGACATTGGCACCCTTTTCCTTATCTTTGGTGCATGAGCCGGGATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGACAACCAGGCGCCCTACTGGGAGACGACCAAGTCTACAATGTAGTCGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGGGGGTTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCCCGAATGAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTACTCCTCCTAGCCTCTTCTACAGTCGAAGCAGGGGTGGGAACAGGATGAACCGTGTACCCACCACTTGCCGGAAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTATTTCCTCAATCCTAGGGGCCATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCAGTACTAATCACTGCAGTCCTACTCCTCCTGTCCCTCCCCGTACTCGCCGCCGGCATCACCATGCTCCTCACTGACCGCAACCTAAACACCACCTTCTTCGACCCTGCAGGGGGAGGTGATCCAGTGCTCTACCAACACCTTTTCTGATTCTTCGGACACCCAGAAGTATACATCTTAATCCTACCAGGATTTGGAATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ficedula hypoleuca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pied flycatchers have a massive range extending to about 10,000,000 square kilometers. Their population levels are also large, around 24,000,000 to 39,000,000 birds in Europe. Population trends haven't been carefully studied, but BirdLife International does not believe they are declining at a significant rate. Therefore, they are listed as "Least Concern" by the IUCN Red List.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act (as mended) in the UK. Listed as a species of conservation concern under the UK Biodiversity Action Plan. Included in the Birds of Conservation Concern Green list (low conservation concern).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 12,000,000-20,000,000 breeding pairs, equating to 36,000,000-60,000,000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 38,300,000-80,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Pied flycatchers have an uncertain status in the UK. Having extended their British range since the 1940s, their populations are now thought to be stable. However, figures are uncertain as their preferred breeding habitat is not sufficiently well monitored for an accurate population census to be carried out. The initial increase in the population was thought to be the result of more nestboxes being made available, but the bird's numbers show a slight downward trend based on figures from Welsh sites.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The pied flycatcher is a species that appears to be managing to maintain its numbers but which might also prove to be vulnerable. The birds are regular users of nestboxes where these are provided, but they also show a tendency to suffer egg and chick losses due to adverse weather conditions. Where information is available on bird numbers, the populations seem to be fairly stable. However, their upland breeding sites are not being monitored with sufficient regularity to enable an accurate census of the species to take place. As it stands, the bird is currently listed as a species of conservation concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of pied flycatchers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Pied flycatchers eat the larvae of moths and other pests, including Eugraphe subrosa, Syngrapha interrogationis, Cerastis rubricosa, and Polia hepatica, which feed on plants in the genus Vaccinium, such as bilberry, cowberry, cranberry, and blueberry. Pied flycatchers also eat many other insects and spiders.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European pied flycatcher

European pied flycatchers, 2010 in Texel, Netherlands

The European pied flycatcher (Ficedula hypoleuca) is a small passerine bird in the Old World flycatcher family. One of the four species of Western Palearctic black-and-white flycatchers, it hybridizes to a limited extent with the collared flycatcher.[2] It breeds in most of Europe and western Asia. It is migratory, wintering mainly in western Africa.[1][3] It usually builds its nests in holes on oak trees.[4] This species practices polygyny, usually bigamy, with the male travelling large distances to acquire a second mate. The male will mate with the secondary female and then return to the primary female in order to help with aspects of child rearing, such as feeding.[2][5]

The European pied flycatcher is mainly insectivorous, although its diet also includes other arthropods. This species commonly feeds on spiders, ants, bees and similar prey.[6]

The European pied flycatcher has a very large range and population size and so it is of least concern according to the International Union for Conservation of Nature (IUCN).[1]

Taxonomy[edit]

The European pied flycatcher is an Old World flycatcher, part of a family of insectivorous songbirds which typically feed by darting after insects.[7] There was an argument to break the species into two species, hypoleuca and speculigera, however this was rejected because speculigera was classified to be more closely related to species iberia.[1] Subspecies include Ficedula hypoleuca hypoleuca, Ficedula hypoleuca iberiae, and Ficedula hypoleuca sibirica.[8]

The Latin word ficedula means “small fig-eating bird”. The term hypoleuca comes from two Greek roots, hupo and “lukos. Hupo means “below”, and lukos means “white”.[3]

Description[edit]

Adult female in Sweden.

This is a 12–13.5 centimetres (4.7–5.3 in) long bird. The breeding male is mainly black above and white below, with a large white wing patch, white tail sides and a small forehead patch. The Iberian subspecies iberiae (known as Iberian pied flycatcher) has a larger forehead patch and a pale rump. Non-breeding males, females and juveniles have the black replaced by a pale brown, and may be very difficult to distinguish from other Ficedula flycatchers, particularly the collared flycatcher, with which this species hybridizes to a limited extent.[9]

The bill is black, and has the broad but pointed shape typical of aerial insectivores. As well as taking insects in flight, this species hunts caterpillars amongst the oak foliage, and will take berries. It is therefore a much earlier spring migrant than the more aerial spotted flycatcher, and its loud rhythmic and melodious song is characteristic of oak woods in spring.

European pied flycatcher vocalization

They are birds of deciduous woodlands, parks and gardens, with a preference for oak trees. They build an open nest in a tree hole, and will readily adapt to an open-fronted nest box. 4–10 eggs are laid.[4]

The very similar Atlas pied flycatcher, of the mountains of north west Africa was formerly classed as subspecies of the European pied flycatcher.

Distribution and habitat[edit]

The European pied flycatcher has a very large range and population size, and is thus deemed to be of least concern by the IUCN. This species occupies areas of many different countries in Europe, very commonly found in countries of the Iberian peninsula. The species is noted as a vagrant species in places in Northeast Africa and South Asia, such as Sudan and Afghanistan.[1] The population is noted to This flycatcher typically spends winter in tropical Africa.[3]

The European pied flycatcher is a terrestrial bird,[1] typically inhabiting open forests, woodlands, and towns. In 2005, the European population was listed to hold 3–7 million pairs.[3]

Mating systems[edit]

The European pied flycatcher predominately practices a mixed mating system of monogamy and polygyny. Their mating system has also been described as successive polygyny.[5] Within the latter system, the males leave their home territory once their primary mates lays their first eggs. Males then create a second territory, presumably in order to attract a secondary female to breed. Even when they succeed at acquiring a second mate, the males typically return to the first female to exclusively provide for her and her offspring.[2] Males will sometimes care for both mates if the nests of the primary and secondary female are close together. The male may also care for both mates once the offspring of the primary female have fledged. The male bird usually does not exceed two mates, practicing bigamy. Only two cases of trigyny had been observed.[10]

Gender difference in mating behavior[edit]

The male mating behavior has two key characteristics: desertion of the primary female and polyterritoriality. The males travel large distances, an average of 200–3,500 metres (660–11,480 ft), to find his second mate. After breeding with the secondary female, the males return to their first mate. The males of this species are polyterritorial; the males will acquire multiple nest sites to attract a female. Upon breeding with this first female, the male will procure more nesting sites, typically some distance from the site of the primary female, in order to attract a second female for mating. The males that have better success at polygyny are typically larger, older and more experienced at arriving earlier to the mating sites.[11]

Polygyny threshold model graph

The female behaviour has also been studied in depth, especially due to the fact that some females accept polygyny while others are able to maintain monogamous relationships. The first female in a polygynous relationship does not suffer much in comparison to females in monogamous situations. These primary females gain greater reproductive success because they are able to secure full-time help from the male once he returns from his search for a second mate. The second female, however, often suffers from polygyny. These females have 60% less offspring than females that are in a monogamous relationship.[12] These findings are consistent with the polygyny threshold model, which is depicted at the left. Additionally, the secondary female lays a smaller clutch which she is more likely to be able to rear on her own.

Another behavior that is relatively frequent in European pied flycatchers is the practice of extra-pair copulations (EPC). Thus, the male practicing EPC will have a group of offspring raised successfully without any parental investment on his part. The female may benefit from EPC if the second male is judged to have superior genes to the original male. Another benefit that EPC adds is that there is an increase in genetic variability. However, females are not typically very welcoming of EPC. A female that is being pursued for an EPC will either passively allow the male to copulate with her, or will resist it and risk injury due to the male’s aggression.[13]

Breeding dispersal[edit]

In an experiment conducted from 1948 to 1964 in the Forest of Dean in Gloucestershire, two hundred and fifty nest boxes were carefully recorded for their locations and then analyzed for their inhabitance.[14] The median breeding dispersal of the European pied flycatcher ranges from about 52–133 metres (171–436 ft), with the average distance between nest sites being about 45 metres (148 ft). This distance typically depended on the breeding density in each year. The study found little evidence to suggest a difference in breeding dispersal between years or between monogamous and polygynous males. As a result, the data for the separate categories could be combined. The breeding dispersal over longer distances could result in both mate fidelity as well as mate change, the latter of which occurs either while the previous mate is still alive, or following the death of the mate. The breeding dispersal distances of birds that survive more than three breeding seasons were studied, and the results showed that the site fidelity increased with more successive breeding attempts. The same long-term study also found that older European pied flycatchers, both male and female, were more likely to move shorter distances between breeding seasons than younger birds were. When mates were observed to re-establish their pair bond, they tended to occupy certain areas that were near the nest site established in the previous breeding season. In addition, female birds were less likely to return to a former breeding site following the death of, or divorce from, their former partner. When a pair divorces, the females have been observed to move greater distances away than the males. As a result, females that keep the same mates from year to year end up moving shorter distances for each mating period than those that divorce. Divorce has little influence on the likelihood of males moving away from their original nest site. The study found that males that keep the same mate do not move significantly smaller distances than males that divorce.[14]

Evolution of polygyny[edit]

Since most bird species exhibit monogamous mating behaviors, the polygynous behavior of the European pied flycatcher has sparked much research. There are three main hypotheses that seek to explain why females settle polygynously when it lowers their overall fitness and reproductive success compared to a monogamous relationship.[15]

"Sexy son" hypothesis[edit]

Adult male in Finland
Adult female in Finland

The first hypothesis is the "sexy son" hypothesis which asserts that although females experience an initial reproductive loss with their first generation, the reproductive success of the second generation compensates for the initial loss. The second generation of males is thought to be privileged because it will inherit the increased mating ability, or attractiveness, from their fathers and thus will have high success in procuring mates upon maturation. Since these "sexy sons" are projected to have heightened reproductive success, the secondary female’s reproductive success in turn improves.[16] Some researchers, however, have refuted this theory, stating that offspring born to secondary females suffered from poor nutrition, which resulted in shorter tarsi and lower weights than the progeny of primary and monogamous females. These phenotypic traits contribute to lesser success in mate acquisition, rejecting the “sexy son” hypothesis.[10]

Deception hypothesis[edit]

The second hypothesis claims that deception from the male flycatcher explains a female's choice to mate with an already-mated male despite the relative decrease in reproductive success.[11] The deception arises from the polyterritoriality of the males, meaning that the males are able to deceive the females through the use of separate territories. This hypothesis attempts to describe why males have developed polyterritorial behavior. The typical long distances between nest sites suggest that males acquire multiple nest sites to facilitate the deception of the secondary female.[10] A study showed that females leave the male upon discovering that he is already mated, as long as she discovers this fact before laying season.[11] However, another experiment with European pied flycatchers in Norway produced results that refute the deception hypothesis.[17] The secondary female birds in their study raised larger clutches than primary females. The study also showed that deception is not an evolutionarily stable strategy for males, because secondary females would notice the frequent visits to the primary females and then elect to choose another mate. According to the deception hypothesis, already-mated males display polyterritorial behavior that increases their chances of acquiring another mate. Unmated males were shown to display mating behavior, consisting mostly of singing, at their nest site. On the other hand, already-mated males would need to disrupt their singing at their secondary territories in order to return to their primary nest. This can occur both before and after the time of their second mating.[18] As a result, it decreases the chance that females would be deceived, leading to an evolutionarily unstable strategy.[19]

Female aggression hypothesis[edit]

Adult female at the Kochelsee, Schlehdorf, Germany

The third hypothesis asserts that females settle for polygyny because it is hard to find unmated males.[17][20] This theory assumes that there is aggression between females to find mates and asserts that polyterritoriality actually helps to alleviate this aggression, allowing the second female a place to settle and breed peacefully.[21] Although the deception hypothesis suggests that males are more successful at farther secondary territories because they can hide their marital status, the female-female aggression suggests that males occupy distant secondary territories to reduce aggression between the primary and secondary females. Primary females display aggression and prevent other females from settling near the initial nest to ensure that they acquire the male parental care.[22] Primary females were seen in experiments to visit the second territory and behave aggressively towards the secondary female. The number of such visits decreased with increasing distance between the nests. It is also important for the primary female to be able to detect an intruding female as soon as possible, because the longer the intruder has been present in a territory, the more difficult it will be to evict the female. Female flycatchers are known to have the capacity to identify the songs of their own mates and check if they establish a second territory. The primary male was also shown to spend less time in the second territories during incubation periods than before they acquired a secondary mate, especially with greater distances between the two territories.[23][24]

Parental care[edit]

Male flycatcher returning to nest

Studies were also done to examine the amount of contribution the male European pied flycatcher provided in parental care as well as why some females choose to mate with mated males.[25] When older and younger monogamous males were compared, there was no difference in feeding rate between each nest. When females were studied, scientists found that monogamous and primary females benefited significantly more from the male in terms of parental care than polygynous females did. The latter group could only partially compensate for the absence of a male, leading to secondary females and widows raising fewer offspring than the monogamous pairs did. In the study, differences in mates and the qualities of the territories were slight and therefore not considered, since they lead to no advantages for females to choose between the territories belonging to monogamous or already-mated males. The results of the study suggest that the males can control multiple territories and are thus able to deceive females into accepting polygyny, while the females do not have enough time to discover the marital status of the males.

In terms of male parental care to clutches, the rate of male incubation feeding was directly related to the physical condition of the males, and negatively correlated with the ambient temperature. Polygynously mated females also received far less feeds than monogamously mated females, despite having no difference in the food delivery rates by the male. The reduction in delivery rate to the polygynously mated females led to a negative effect on their incubation efficiency, because the females needed to spend more time away from the nest acquiring food. This also prolonged the incubation period when compared to monogamous females. The male feeding behavior is related to the reproductive value as represented by the nests, as well as to the costs and benefits of incubation feeding.[26]

Feeding[edit]

The main diet of the European pied flycatcher is insects. In fact, their name comes from their habit of catching flying insects, but they also catch insects or arthropods from tree trunks, branches, or from the ground.[27] Studies have found that the majority of food catches were made from the ground. It was also found that airborne prey were captured more during the early part of the season (May to June) than in the later part (August to September); the converse trend appeared in prey taken from trees. There are also many overlaps in the foraging techniques with the collared flycatcher, the spotted flycatcher, and the redstart.[6][28]

Courtship feeding, or incubation feeding, occurs when the male feeds the female in the pairing, egglaying stages, and incubation. An interpretation of this behavior is that it strengthens the pair bond between mates.[29]

Diet[edit]

Pied flycatcher chicks

The diet of the European pied flycatcher is composed nearly entirely of insects. One study analyzed the stomach contents of birds during the breeding season and found that ants, bees, wasps and beetles made up the main diet.[6] Ants made up approximately 25% of the diet.[30] Food given to nestlings include spiders, butterflies, moths, flies, mosquitoes, ants, bees, wasps, and beetles. For Lepidoptera and Hymenoptera, larvae appear to be consumed more than adult insects; the opposite is true for other insect species.[28] There is also variation between the proportions of larvae and adult insects between different habitats. Nestlings were also found to consume more spiders, butterfly, and moth larvae, while adult flycatchers consume more ants.[6]

Status[edit]

It has on average decreased in population by 25% within the last 25 years. It has ceased to breed in several parts of its former range within Britain. (It is a very rare and irregular breeder in Ireland.) Records of its location can be found on that National Biodiversity Network.[31]

Lifecycle[edit]

Female in a nestbox in Finland
  • mid-September to mid-April: lives in sub Saharan Africa
  • mid April to end of May: migrates and arrives in countries such as the United Kingdom
  • June to August: breeding season, one brood only
  • August to mid September: flies back to sub Saharan Africa

Management and conservation[edit]

They breed in upland broadleaf woodland. This means that in Britain they are limited due to geography to the North and West. They prefer mature oak woodland, but also breed in mature upland ash and birch woods.

They require very high horizontal visibility - a low abundance of shrub and understorey, but with high proportion of moss and grass. Grazing needs to be managed to maintain this open character, but also allow the occasional replacement trees.

They will sometimes use mature open conifer woodland where natural tree holes occur. Generally they prefer trees that have tree holes, i.e. dead trees, or dead limbs on healthy trees. They also like lichens that grow on trees.

Nest boxes are not likely to be required.[4]

Grant funding for conservation[edit]

The Forestry Commission offers grants under a scheme called England's Woodland Improvement Grant (EWIG); as does Natural England's Environmental Stewardship Scheme.

References[edit]

  1. ^ a b c d e f BirdLife International (2012). "Ficedula hypoleuca". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c Silverin, Bengt (1980). "Effects of long-acting testosterone treatment on freeliving pied flycatchers, Ficedula hypoleuca, during the breeding period". Animal Behaviour 28 (3): 906–912. doi:10.1016/s0003-3472(80)80152-7. ISSN 0003-3472. 
  3. ^ a b c d Robinson, R.A. (2005) BirdFacts: profiles of birds occurring in Britain & Ireland (BTO Research Report 407). BTO, Thetford (http://www.bto.org/birdfacts, accessed on 19 Dec. 2012)
  4. ^ a b c "RSPB Pied Flycatcher Information Page". RSPB. Retrieved 24 September 2013. 
  5. ^ a b von Haartman, Lars (1951). "Successive Polygamy". Behavior 3 (4): 256–274. doi:10.1163/156853951x00296. 
  6. ^ a b c d Silverin, B.; G. Andersson (1984). "Food composition of adult and nestling Pied Flycatchers, Ficedula hypoleuca, during the breeding period (in Swedish with English summary)". Var Fagelvarld 43 (3): 517–524. 
  7. ^ "Flycatcher". The Columbia Encyclopedia, 6th ed. 2012. Encyclopedia.com. Retrieved December 19, 2012. 
  8. ^ "European pied flycatcher (Ficedula hypoleuca).". Avibase.bsc-eoc.org. Retrieved 19 December 2012. 
  9. ^ Parkin, David T. (2003). "Birding and DNA: species for the new millennium". Bird Study 50 (3): 223–242. doi:10.1080/00063650309461316. 
  10. ^ a b c Alatalo, Rauno V.; Arne Lundberg (1984). "Polyterritorial polygyny in the pied flycatcher Ficedula hypoleuca - evidence for the deception hypothesis". Annales Zoologici Fennici 21: 217–228. 
  11. ^ a b c Alatalo, Rauno V.; Carlson, Allan; Lundberg, Arne; Ulfstrand, Staffan (1981). "The Conflict Between Male Polygamy and Female Monogamy: The Case of the Pied Flycatcher Ficedula hypoleuca". The American Naturalist 117 (5): 738–753. doi:10.1086/283756. 
  12. ^ Lundberg, Arne; Rauno V. Alatalo; Allan Carlson; Staffan Ulfstrand (1981). "Biometry, habitat distribution and breeding success in the pied flycatcher ficedula hypoleuca". Ornis Scandinavica 12 (1): 68–79. doi:10.2307/3675907. 
  13. ^ Alatalo, Rauno V.; Karin Gottlander; Arne Lundberg (1987). "Extra-pair copulations and mate-guarding in the polyterritorial pied flycatcher, Ficedula hypoleuca". Behaviour. 1 101 (3): 139–155. doi:10.1163/156853987X00404. 
  14. ^ a b Harvey, P.H.; P.J. Greenwood, B. Campbell, M.J. Stenning (1984). "Breeding dispersal of the pied flycatcher (Ficedula hypoleuca)". Journal of Animal Ecology 2 (3): 727–736. 
  15. ^ Orians, G. H. (1969). "On the evolution of mating systems in birds and mammals". The American Naturalist 12 (3): 163. doi:10.1086/282628. 
  16. ^ Weatherhead, Patrick J.; R.J. Robertson (1979). "Offspring quality and the polygyny threshold: the sexy son hypothesis". The American Naturalist 113 (2): 201–208. doi:10.1007/s10709-007-9162-5. 
  17. ^ a b Stenmark, Geir; Tore Slagsvold; Jan T. Lifjeld (1988). "Polygyny in the pied flycatcher, Ficedula hypoleuca: a test of the deception hypothesis". Animal Behaviour 36 (6): 1646–1657. doi:10.1016/s0003-3472(88)80105-2. ISSN 0003-3472. 
  18. ^ Lampe, H.M.; T. Slagsvold (1994). "Individual recognition based on male song in a female bird". Ornithology 13 (2): 163–164. 
  19. ^ Dale, S; T. Slagsvold (1994). "Polygyny and deception in the pied flycatcher: can females determine male mating status?". Animal Behavior 32 (2): 1207–1217. ISSN 0003-3472. 
  20. ^ Dale, Svein; T. Amundsen, J.T. Lifjeld, T. Slagsvold (1990). "Mate Sampling Behaviour of Female Pied Flycatchers: Evidence for Active Mate Choice". Behavioral Ecology and Sociobiology 27 (2): 87–91. doi:10.1007/BF00168450. 
  21. ^ Davies, Nicholas B., John R. Krebs, and Stuart A. West. An Introduction to Behavioural Ecology. 4th ed. John Wiley & Sons, 2012. Print. ISBN 978-1-4051-1416-5
  22. ^ Kilpimaa, J.; R.V. Alatalo, O. Ratti, P. Siikamaki (1995). "Do pied flycatcher females guard their monogamous status?". Animal Behavior 23 (2): 573–578. ISBN 978-1-4051-1416-5. 
  23. ^ Slagsvold, T; T. Amundsen; S. Dale; H. Lampe (1992). "Female-female aggression explains polyterritoriality in male pied flycatchers". Animal Behavior 32 (3): 397–407. doi:10.1016/s0003-3472(05)80100-9. ISSN 0003-3472. 
  24. ^ Slagsvold, T.; S. Dale (1995). "Polygyny and female aggression in the pied flycatcher: a comment on Ratti et al". Animal Behavior 23 (3): 167–175. doi:10.1016/0003-3472(95)80144-8. 
  25. ^ Alatalo, R.V.; A. Lundberg; K. Stahlbrandt (1982). "Why do pied flycatcher females mate with already-mated males?". Animal Behavior 30 (2): 585–593. doi:10.1016/s0003-3472(82)80072-9. ISSN 0003-3472. 
  26. ^ Lifjeld, J.T.; T. Slagsvold (1990). "Manipulations of male parental investment in polygynous pied fly-catchers". Behavioral Ecology 23 (5): 171–181. doi:10.1093/beheco/1.1.48. 
  27. ^ Lundberg, Arne (2010). The Pied Flycatcher. A&C Black. pp. 55–59. ISBN 1408137801. 
  28. ^ a b von Haartman, L. (1954). "Der Traeurfliegenschnaaper". Die Nahrungsbiologic 83 (1): 1–96. 
  29. ^ Lack, D. (1940). "Courtship feeding in birds". The Auk 57 (2): 169–178. doi:10.2307/4078744. 
  30. ^ Bibby, C.J.; R.E. Green (1980). "Foraging behaviour of migrant pied flycatchers, Ficedula hypoleuca, on temporary territories". Animal Ecology 49 (2): 507–521. doi:10.2307/4260. 
  31. ^ "Grid map of records on the Gateway for Pied Flycatcher (Ficedula hypoleuca)". NBN Gateway. Retrieved 24 September 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!