Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Setophaga ruticilla

A medium-sized (5 inches) wood warbler, the male American Redstart is most easily identified by its black body, white belly, and conspicuous orange patches on the wings, flanks, and tail. Female American Redstarts are olive-green above and pale below with yellow on the wings, flanks, and tail. In particular, this species’ tail sets it apart from all other North American wood warblers as no other species has such large, brightly-colored tail patches. The American Redstart breeds across southern Canada and much of the United States. While this species is fairly widespread in the northeast and interior south, it is more local elsewhere, and is almost entirely absent as a breeding bird in the desert southwest. Most American Redstarts spend the winter from northern Mexico and the Bahamas south to Brazil, although a few winter in coastal California, along the southern Colorado River, and in south Florida. American Redstarts breed in a number of deciduous forest habitats, particularly those near water. In winter, this species may be found a number of shrubby habitats, such as mangroves, thickets, and tropical forests with dense undergrowth. American Redstarts primarily eat small invertebrates, including insects and spiders. In appropriate habitat, American Redstarts may be observed foraging for food in the forest canopy, where their habit of frequently flashing their bright tails makes them more conspicuous than they might otherwise be. Birdwatchers may also listen for this species’ song, a high “tsee” repeated three or four times in quick succession. American Redstarts are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Alaska to s US; winters s US to n South America and West Indies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Commonly known as American redstarts, Setophaga ruticilla is a Neotropical migrant warbler that spends portions of the year in both the Nearctic and the Neotropical regions. During the spring and summer, Setophaga ruticilla breeds across much of Canada and the United States. It inhabits the southern regions of Canada from the east to west coast. In the United States, Setophaga ruticilla may be found in limited regions of the northern Midwest, and most states east of the Mississippi River. Exclusions include portions of Kentucky, Tennessee, Florida, Georgia, and North and South Carolina. This species migrates biannually across much of the United States and Central America to reach its wintering grounds in southern Central and northwestern South America. Setophaga ruticilla also overwinters on many Caribbean islands including Jamaica and Cuba.

Biogeographic Regions: nearctic (Introduced ); neotropical (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: southern Alaska and southern Yukon across Canada to southern Labrador and Newfoundland, south to eastern Oregon, northwestern California, Idaho, northern Utah, east-central Arizona, eastern Oklahoma, eastern Texas, northern Gulf Coast, the Carolinas, and southern Virginia. Absent from most of the Great Plains (AOU 1983). NON-BREEDING: extremely widespread, in Mexico along both coasts, on the Pacific from southern Baja California and Sinaloa south and on the Atlantic from southern Texas (rarely) and more typically from Veracruz and Yucatan peninsula south; less common in highlands. Common throughout the West Indies (Pashley 1988, Pashley 1988, Pashley and Hamilton 1990) and Central America. In South America, common in Colombia and Venezuela east into Guyana and Suriname, south through Ecuador, rarely into Peru and northwestern Brazil; Trinidad and Tobago (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Setophaga ruticilla is a smaller warbler measuring 13.3 cm in length and weighing 8.3 g. Adult males have mostly black upperparts with bold patches of orange. The sides of breast, bases of wing feathers, and bases of the outer tail feathers feature large patches of bright orange. The belly and undertail coverts are white. Adult females feature the same pattern, but have mostly gray upperparts with patches of bright yellow or orange in older females. They have olive-colored backs and the wings and tail feathers are a darker gray than the head. Throat, belly, and undertail coverts are pale gray to white. First year males closely resemble females and will obtain adult male plumage after the first breeding season. Females and young males may also feature a slight white eye-ring and pale supercillium. All sexes and ages have black legs, feet and bills. The short bill is very similar to insect-eating flycatchers in being relatively flat and surrounded by rictal bristles.

Range mass: 6 to 9 g.

Average mass: 8.3 g.

Range length: 11 to 14 cm.

Average length: 13.3 cm.

Average wingspan: 19.7 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

  • 2006. National Geographic Complete Birds of North America. Washington, D.C.: National Geographic Society.
  • Sibley, D. 2000. The Sibley's Guide to Birds. New York: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Weight: 9 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults are easily distinguished from other species. Nest is similar to that of yellow warbler (Dendroica petechia) but has neater construction and thinner walls. Also similar is the nest of American goldfinch (Carduelis tristis), but this is wider than high, whereas the redstart's is higher than wide (Harrison 1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Setophaga ruticilla selects varying habitats depending on the season and geographic location. During the breeding season, this warbler inhabits open-canopy, mostly deciduous forests, second growth, and forest edge across much of the United States and southern Canada. This insectivorous bird often shares its foraging habitats with other warblers, and is found feeding in the mid to lower regions of a tree or shrub. Setophaga ruticilla prefers to build its nest well within dense shrubs or the fork of a low tree, and males will select territories that contain several of these potential nest sites.

During migration, Setophaga ruticilla stopover in dense shrubby habitats where food is abundant. On their wintering grounds in Central and South America, this warbler may be found in nearly all woody habitats but tend to avoid non-forested agricultural areas. It is often found in shade-grown coffee plantations which provide native trees and shrubs, as well as coffee trees. Elevations occupied vary by location, as this species may be found at elevations up to 3,000 m in South America, but only up to 1,500 in Jamaica. During the non-breeding season, Setophaga ruticilla is influenced by strong dominance hierarchies that result in sexual habitat segregation. Older males exhibit the most dominant behavior and will occupy preferred, resource-abundant habitats (mangroves). Females and other subordinate individuals are thus restricted to lower quality habitats (scrub), which results in greater mass loss and lower survivorship rates during the non-breeding season. Studies have shown that in preferred habitats, sex ratio is 3:2 (mostly males) while in lower quality the ratio is 1:3 (mostly females).

Range elevation: 3,000 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: agricultural

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York, NY: Simon and Schuster.
  • Marra, P., R. Holmes. 2001. Consequences of dominance-mediated habitat segregation in American redstarts during the nonbreeding season. The Auk, 118/1: 92-104.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Various mature and second-growth wooded habitats. Deciduous and mixed deciduous-coniferous second-growth forests, alder swamps, old growth forests with regenerating trees (e.g., around tree-fall gaps), willow thickets, small groves; low, damp, second-growth deciduous and mixed floodplain forests and river swamps; most abundant in mature deciduous forest stands, but also may occur in young woods less than 15 years old; requires closed canopy and prefers dense midstory and understory and well-developed undergrowth; use of pole-stage stands apparently varies geographically (Cruickshank 1979, Crawford et al. 1981, Harrison 1984, DeGraaf 1985, Bushman and Therres 1988, Sherry and Holmes 1997). Nests usually are placed in an upright fork of a deciduous understory sapling, shrub, or tree, occasionally in a vine tangle or old vireo nest; nest usually is about 1-6 m above ground, sometimes as high as 28 m.

Southeastern U.S.: Primary breeding habitats in the Piedmont and Coastal Plain are bottomland hardwoods and swamps, especially in extensive stands. In the mountains this species occurs in hardwoods along streams, usually where it is open and not heavily wooded. Birds are less frequent in medium-growth hardwood forests away from water. Hamel et al. (1982) described the key habitat requirements for breeding as hardwood forests near water. They provided the following details on habitat use and suitability in Virginia, North Carolina, South Carolina, Georgia, and Florida. The following five vegetation types used by this species in five physiographic provinces (Mountains, Sandhills, Piedmont, Inner Coastal Plain, and Outer Coastal Plain) are considered in order of suitability: elm-ash-cottonwood is suitable at the sapling-poletimber stage, optimal at the late-successional sawtimber stage; southern mixed mesic hardwoods and oak-gum-cypress are suitable at both the sapling-poletimber stage and sawtimber stage; oak-hickory and cove-hardwoods are marginal habitat at the sapling-poletimber stage and suitable at the sawtimber stage. In all cases, shrubs and midstory are used for all activities (feeding/foraging, nesting, perching, roosting, and singing), whereas the overstory is used for feeding/foraging, perching, roosting, and singing, but not nesting. No specific vegetation sizes were given. Yellow birch is significantly preferred for nesting, and fledging success is significantly higher in yellow birch than beech or sugar maple; this result is especially true for large, old trees. Nest concealment from predators accounts for these patterns (Crew and Sherry, unpubl. data).

Northeastern and north-central U.S.: In New York, breeders use low, damp woods and have been found in mixed woodland with a considerable growth of pine and hemlock; in the Adirondacks, nest sites often occur where spruces predominate. In Ohio, Michigan, and other sections of the Midwest, this species inhabits the maple, elm, ash, and pine-oak association of the larger, more mature swamp forests, although it is sometimes found among similar trees and brush in the larger upland woods. In the far Northwest, it shows a decided preference for willow trees and alder thickets. In Maine, the bird is found in hardwood or mixed deciduous and coniferous woodlands; these may be low, damp situations but birds are also often found in the second-growth of trees and brush of the dry sandy plains. Alder and willow thickets bordering streams and ponds are used here also (Bent 1953). In New Hampshire, redstarts are especially abundant in second-growth edge and in old-age northern hardwood forests, but they also occur in other moist woodlands, mixed hardwood-conifer woods, and alder and willow thickets. Here, this species breeds from near sea level to above 3000 ft (910 m), where the highest elevation hardwoods grade into conifers in the White Mountains (Sherry and Holmes 1994).

Quantitative habitat measures have been documented in a few studies. Sabo (1980) measured habitat selection in the White Mountains of New Hampshire and listed the following parameters: mean elevation - 830 m, canopy height - 10.4 m, canopy coverage - 74%, conifer foliage volume - 38%, conifer foliage cover (0-2 m) - 20%, broad leaf foliage volume (>5 m) - 92%, and dbh of live trees - 11 cm. Collins et al. (1982) quantified habitat in north-central Minnesota: ground cover - 67.7%, shrub cover - 70.7%, canopy cover - 66.3%, canopy height - 14.5 m, conifers - 4.7%, and numbers of species of trees per 0.04 ha circle - 4. In addition, Collins et al. (1982) surveyed vegetation and recorded the numbers of trees in different size classes: 10.7 (7.5-15 cm), 10.7 (15.1-23 cm), 8.2 (23.1-30 cm), 4.6 (30.1-38 cm), 1.1 (38.1-53 cm), 0.3 (53.1-68 cm), and 0.1 (>68.1 cm). Sherry and Holmes (1985, unpubl. data) documented significant preferences for deciduous stands of trees along a deciduous-coniferous gradient.

NON-BREEDING: In winter and migration, habitats include various kinds of forests, woodlands, scrublands, and thickets, including mangroves; uses a wide variety of agricultural habitats (e.g., cacao, citrus, pine plantations, mango, and sun and shade coffee plots) (Robbins et al. 1992). Primary wintering habitats are mainly in broadleaf evergreen woods and thickets, such as hammocks and mangroves (Hamel et al. 1982). In Venezuela, mangroves were a transitory habitat, used primarily in the middle of the wintering period by a low number of females (Lefebvre et al. 1992). In Jamaica, widespread in various habitats and are regularly found in drought-deciduous dry limestone forest, citrus, wet limestone forest (evergreen), gardens, and residential areas (Holmes et al. 1989, Holmes and Sherry 1992); they tend to be most abundant at lower elevations (Sherry, pers. comm.). Redstarts in Jamaica segregated by sex, with males in mangroves and females mainly in contiguous scrub habitat (Parrish and Sherry 1994). In the Dominican Republic, habitats include strand vegetation, mangroves, scrub, disturbed dry forest, riparian, urban, disturbed wet forest, mesic forest, and wet forest (Arendt 1992). In the Yucatan Peninsula, redstarts prefer moist forest, but also inhabit dry forest, wet forest, field and pasture, and acahual; late-successional forest stages are clearly preferred (Lynch 1992); redstarts were the third most common species found in mature semi-evergreen forest (after hooded [Wilsonia citrina] and magnolia warblers [Dendroica magnolia]); were also found in mid-successional Acahual although less commonly so, and were rarely found in field/pasture habitat (Lynch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in Puerto Rico and the Virgin Islands in September (sometimes as early as August), departs by April or as late as early May (Raffaele 1983). Begins arriving in Jamaica in late August, with main influx mid- to late September (Holmes et al. 1989). Migration in Costa Rica is from mid-August, rarely late July, through late October and April-early May (Stiles and Skutch 1989). Present in South America mostly September-April (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Setophaga ruticilla is nearly exclusively insectivorous, but will occasionally consume berries or seeds during the fall when insect abundance decreases. Morphologically, the flattened beak and rictal bristles are similar to old and new world flycatchers (Muscicapidae and Tyrannidae, respectively) and thus these species share similar foraging behaviors and diets. Setophaga ruticilla employs the foliage gleaning method to capture prey and often flicks its brightly-patterned tail to flush stationary prey. Flying prey is then pursued and caught aerially, after which the bird lands on a different perch than it alighted from. Setophaga ruticilla is known for highly energetic foraging habits and is often seen rapidly hopping through all heights of vegetation. It prefers to forage from twigs and branches versus tree trunks or limbs. Overall, this species is a very flexible, opportunistic feeder that can easily adapt to varying habitat, season, insect community, vegetation structure, and time of day. Diet consists largely of caterpillars, moths, flies, leafhoppers and planthoppers, small wasps, beetles, aphids, stoneflies, and spiders. Few berries and seeds are consumed, but are most often from barberry (Berberis), serviceberry (Amelanchier), and magnolia (Magnolia).

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mostly forest tree insects, also spiders and some fruits and seeds (Terres 1980). In Jamaica in winter, takes almost all insect prey from air, usually within a few centimeters of vegetation (Lack 1976). Searches for insects below the canopy on trunks, limbs, twigs, and leaves, captures prey during aerial sallies (Bushman and Therres 1988, Stiles and Skutch 1989). In winter in Mexico, preferred foliage density is open; often hawks prey, also gleans and hovers (Rappole and Warner 1980). In mangroves in Venezuela, feeds on insects captured in foliage and in the air (Lefebvre et al. 1992). See Keast et al. (1995, Auk 112:310-325) for information on adaptations for aerial feeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As an insectivore, Setophaga ruticilla consumes significant amounts of insects and likely has an impact on local insect communities. This species also consumes small amounts of fruits and seeds during the fall which may contribute to seed distribution for the plant species it feeds upon. Eggs, nestlings, and adults are consumed by a wide variety of predators. Like many birds, this species is host to several ectoparasites including three lice species and one tick. Setophaga ruticilla is a common host for brown-headed cowbirds and currently will accept and successfully raise cowbird chicks. Populations of Setophaga ruticilla that are exposed to Molothrus ater will react more aggressively to adults than populations that have encountered them less often.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Setophaga ruticilla is vulnerable to both terrestrial and aerial predators. Highest rates of predation occur during the breeding season when eggs and helpless nestlings are abundant and easy prey for terrestrial predators. Females mostly brood during this period and thus often fall prey to nest predators. Common terrestrial predators include red squirrels, fishers, eastern chipmunks, black bears, flying squirrels, fox snakes, and domestic cats. Aerial predators take nestlings, eggs, or even adults in flight. Possible aerial predators include jaegers, blue jays, common ravens, northern saw-whet owls, common grackles, northern goshawks, and sharp-shinned hawks, and Cooper's hawks.

Known Predators:

  • McCallum, C., S. Hannon. 2001. Accipiter predation of American redstart nestlings. The Condor, 103/1: 192-194.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Setophaga ruticilla is prey of:
Accipiter striatus
Otus nudipes
Diptera
Secernentia nematodes

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Setophaga ruticilla preys on:
Araneae
Coleoptera
Diptera
Hymenoptera
Auchenorrhyncha
Sternorrhyncha
Lepidoptera

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Common in many areas. Breeding Bird Survey data indicate relatively high abundance in New Brunswick, Nova Scotia, and Maine.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

BREEDING POPULATION DENSITY: Published information on bird densities from breeding bird censuses in the southeastern U.S. between 1947 and 1979 were summarized by Hamel et al. (1982). Mean (standard error) density was listed as 8.7 (2.8) pairs per 40 ha with a density range of 2.7-87 pairs per 40 ha. In northern New Hampshire (White Mountains), Sabo (1980) recorded average densities of 40 pairs per sq km in subalpine habitats, and 9 pairs per sq km in virgin spruce groves. Sherry and Holmes (1988) reported a range of 2.5-6.75 male territories on 10-ha sites at the Hubbard Brook Experimental Forest, New Hampshire. When population trends for the month of June (mid-breeding period) at Hubbard Brook were analyzed for the period 1969-1986, Holmes and Sherry (1988) found the mean (standard deviation) number of adult to be 28.67 (8.84) birds per 10 ha. In Maryland, Whitcomb et al. (1981) reported territorial densities to be 71 males per sq km.

Two studies of bottomland hardwood forests provide data from similar censusing techniques: Mitchell and Lancia (1990) found densities to be the highest in edge habitat (an average 0.14 birds per 25 m radius 10-min point count) in South Carolina. On the Roanoke River National Wildlife Refuge in North Carolina, R. Sallabanks (unpubl. data) found densities to be highest in the interior of wide levee forest patches (an average 0.57 birds per unlimited radius 10-min point count). Between 1986 and 1988, Sherry and Holmes (1989) found the number of yearling males to be low (0-1 males per 5 ha) compared with older males (6-8 males per 5 ha).

WINTERING POPULATIONS: Solitary in winter (Stiles and Skutch 1989). Defends winter territory (Jamaica, Holmes et al. 1989, Marra et al. 1993; Mexico, Rappole and Warner 1980); individuals commonly return to the same territory in successive years. Density in winter in Jamaica was 10-51 per 10 ha, comparable to breeding densities reported for eastern U.S., but greater than densities reported for other sites in the Caribbean and Mexico (0-17 per 10 ha) (Holmes et al. 1989; see also Bennett 1980). Winter densities were listed by Hamel et al. (1982) as a mean (standard error) of 2.5 (1.5) pairs per 40 ha with a density range of 1-4 pairs per 40 ha.

TERRITORY SIZE: Little information exists on territory size. Freemark and Merriam (1986) listed territory size as less than 2 ha near Ottawa, Canada. Based upon 14 birds, Sabo (1980) found territory size to be 0.6 ha.

COMPETITION: Several studies have addressed habitat selection and territory occupancy in response to both intra- and inter-specific competition (Ficken and Ficken 1967, Sherry 1979, Sherry and Holmes 1988, 1989, Secunda and Sherry 1991). In New Hampshire, Sherry and Holmes (1988) found the density of redstart territories to be slightly higher when a dominant competitor, the least flycatcher (Empidonax minimus), was absent (approximately 4.4 territories per 4 ha) than when present (approximately 4.0 territories per 4 ha). Least flycatchers locally excluded after second year redstarts from best patches of habitat within a heterogeneous array of such patches (Sherry and Holmes 1988).

MORTALITY FACTORS: Weather accounted for most nest losses during the building stage and caused starvation of nestlings in some years at Hubbard Brook (Sherry and Holmes 1994). Widespread starvation in 1984 was probably caused by a series of heavy rainstorms during the nestling period that depressed insect abundances, or reduced foraging time or success, or both (Sherry and Holmes 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Setophaga ruticilla primarily uses vocal and visual forms of communication. Male Setophaga ruticilla give distinctive songs which are used to defend territory or attract mates. Songs of this species are highly variable but are generally rapid and high pitched. Songs may repeat the same 1 or 2 phrases or have 2 to 8 different phrases given in rapid succession. Some songs end in an accented, terminal note while others simply end unaccented. Setophaga ruticilla uses these different song types to communicate in different situations. Repeated songs with accented endings are typically used for attracting mates, or while males are in close proximity to their mates. Unmated males usually use only this song type. After males secure a mate, they then switch to singing serial songs to defend their territories against neighboring birds. Like many birds, a significant amount of song variation is due to local dialects. Many Setophaga ruticilla individuals can be identified by distinct characteristics of their song such as pattern, frequency, or distinctive syllables. Males of this species can quickly learn the songs of neighboring rivals and incorporate them into their own songs, leading to unique neighborhood dialects.

Setophaga ruticilla also uses body postures and movements as communication. During courtship, males will often chase potential mates in a somewhat aggressive manner and interested females will respond by flying a short distance, then giving a tail-spreading display. Males often give two types of displays towards females: fluff displays and bows. Fluff displays consist of fluffing the body feathers, particularly the bright orange flanks. There is evidence that brighter orange flanks correlate to higher levels of male parental investment, and raising these feathers may serve to advertise parental quality. Bow displays are typically given later in courtship, when a male sleeks his feathers, lowers his breast to the ground, and holds his head vertically.

This species is highly territorial year-round and employs song, body postures, and aerial attacks to deter intruders. As discussed above, males often advertise territory boundaries through singing, but females also give a variety of chips and short notes towards intruders. Both males and females assume threatening body postures including head-forward displays with drooping wings and bill agape, and tail-spreading displays with tail held near vertically. Males also give a wings-out display where they raise and spread their wings, likely to display the orange wing patches. Males also make distinctive circling flights during territorial disputes. Two neighboring males (occasionally females) will alternate short, deliberate, circling flights in pursuit of each other.

Like most birds, Setophaga ruticilla perceives the environment through auditory, visual, tactile, and chemical stimuli.

Communication Channels: visual ; acoustic

  • Ficken, M. 1962. Agonistic behavior and territory in the American Redstart. The Auk, 79: 607-632.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest Setophaga ruticilla on record was a male banded in adult plumage (making it at least 2 years old) which was re-captured approximately 9 years later, making it at least 10 years old. There is evidence that many females live to be at least 5. Setophaga ruticilla is not kept in captivity and thus there is no data for captive lifespan. Annual survival rates are estimated to be between 50 and 60%. Females are thought to suffer a slightly higher mortality rate as they spend significantly more time on the nest (brooding) and are often consumed by nest predators.

Range lifespan

Status: wild:
10 (high) years.

Typical lifespan

Status: wild:
5 to 10 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Like most warblers, Setophaga ruticilla is predominantly monogamous with rare cases of polygamy. Three stages of courtship have been described: pair-formation, pre-nest building, and nest building. Pair-formation typically begins immediately after females arrive on the breeding grounds. Males aerially chase potential mates, who will only fly a short distance and then perform a tail-spreading display and give harsh chip notes. Once established, pairs will visit potential nest sites within the male's territory. Nest sites are selected by females, and males will closely follow females during this period, presumably to guard them from other males. Males give two main types of displays during nest-building: fluff displays and bow displays. Fluff displays involve raising the feathers on the head and back, while feathers are sleek for bow displays and the male will lower his body to the ground while keeping his head vertical and tail spread.

Mating System: monogamous

Setophaga ruticilla is a Neotropical migrant that travels to North America to breed in the spring. Courtship and pair-formation begins within a week of the arrival of females, which occurs from mid- to late May. After a pair has formed, the female alone selects the nest site which is typically up against a tree trunk, hidden in dense vegetation. The cup-shaped nest consists of tightly-woven, fine materials such as grass, feathers, roots, birch bark, or animal hair. Once the nest is complete, the female lays between 2 and 5 white or cream-colored eggs which are speckled with varying amounts of brown. The clutch is incubated by the female for 10 to 13 days. The young fledge after 9 days in the nest, and may remain with one parent for up to 3 weeks after fledging. First-year males are able to reproduce during their first breeding season, but they retain the female-like plumage which may contribute to low reproductive success (less than 50% of first-year males) until year 2. In contrast, most first-year females successfully reproduce during their first breeding season. There is evidence for a skewed sex ratio that results in a surplus of unmated males.

Breeding interval: American redstarts breed once yearly

Breeding season: The breeding season for American redstarts occurs from mid- or late May through the end of July

Range eggs per season: 2 to 5.

Average eggs per season: 4.

Range time to hatching: 10 to 13 days.

Average time to hatching: 12 days.

Average fledging age: 9 days.

Range time to independence: 3 (high) weeks.

Average age at sexual or reproductive maturity (female): <1 years.

Average age at sexual or reproductive maturity (male): <1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Male Setophaga ruticilla are very territorial and will actively defend their territories, mates, and young. Females select a suitable nesting site and construct the entire nest alone. Once eggs are laid, females also perform all incubation for an average of 12 days. The young are altricial at birth and thus require significant parental investment. The helpless hatchlings are brooded by the female alone, as the male lacks a brood patch. Both parents participate equally in feeding the young, and each mate makes between 4 and 13 feeding trips per hour. Both parents also remove fecal sacs from the nest to reduce predation and keep sanitary nest conditions. After the young fledge at 9 days of age, each parent typically cares for certain offspring only. The two parents often separate with their respective young, although the male typically stays near the nest site.

One study has demonstrated a correlation between male coloration and level of parental investment. Male Setophaga ruticilla that featured brighter orange coloration on the flanks made significantly more trips to the nest and overall spent more time at the nest. Therefore, male flank coloration may play a role in sexual selection and may explain why first-year males have low levels of reproductive success until they obtain their adult, black and orange coloration.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York, NY: Simon and Schuster.
  • Ficken, M. 1963. Courtship of the American Redstart. The Auk, 80: 307-317.
  • Germain, R., M. Reudink, P. Marra, L. Ratcliffe. 2010. Carotenoid-based Male Plumage Predicts Parental Investment in the American Redstart. The Wilson Journal of Ornithology, 122/2: 318-325.
  • Sherry, T., R. Holmes. 1997. "American Redstart (Setophaga ruticilla)" (On-line). The Birds of North America Online. Accessed June 13, 2011 at http://bna.birds.cornell.edu/bna/species/277.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the mid-Atlantic region, nesting occurs from late April to early July, with a peak from mid-May to mid-June (Bushman and Therres 1988). Clutch size is 1-5; clutch size declines over the summer, however, from 4 (occasionally 5) eggs in late May/early June to 3 (occasionally 1 or 2) eggs in July. Incubation, by female, lasts 11-13 days. Young are tended by both parents, leave nest at 8-9 days. Typically, there is only one brood, though females may renest up to three times when nests are lost (Sherry and Holmes 1994). Fledging success can be highly variable from year to year; for example, Sherry and Holmes (1992) reported a range of 0.2 to 0.7 at Hubbard Brook; causes of nest failures also varied annually, as did abundance and age structure of the population. The number of yearlings that return to breed appears dependent upon nest success the previous year; poor nesting success in the mid-1980s appears to have caused a decline in the total population during that period (Sherry and Holmes 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Setophaga ruticilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNATTATACTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCTCTTCTGGGCGACGACCAAGTATACAACGTAGTTGTCACGGNCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCTATTATAATCGGAGGGTTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTCCTCCTCCTAGCATCCTCCACAGTTGAAGCAGGAGTAGGCACAGGCTGAACAGTATACCCCCCACTAGCTGGTAACCTGGCCCACGCCGGAGCCTCAGTCGACCTTGCAATCTTCTCCCTACACCTAGCCGGTATTTCCTCAATCCTCGGAGCAATCAACTTCATCACAACAGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCACTATTCGTCTGATCCGTCCTAATCACTGCAGTCCTCCTACTCCTTTCCCTTCCAGTTCTGGCTGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACTACATTCTTCGACCCTGCTGGAGGAGGAGATCCCGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Setophaga ruticilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Setophaga ruticilla is listed as least concern by the International Union for Conservation of Nature and Natural Resources (IUCN) an account of its wide geographic range and relatively stable population size. Recent population data however, has shown this species to be in slight decline and numbers should be monitored closely in the future. Like many declining Neotropical migrants, this species likely suffers from habitat loss on both the wintering and breeding grounds. The main causes for habitat loss is logging for human conversion of land to urban or residential areas. Setophaga ruticilla also prefers shrubby, early-successional habitats which naturally age and progress to mature forests which are less suitable. This species also suffers significant fatalities from impacts with man-made structures during night migration. Over four fall migrations, two towers in Florida accounted for over 1,600 Setophaga ruticilla deaths. Setophaga ruticilla is also a common host for brown-headed cowbirds which decrease reproductive success. Currently, there are few conservation efforts being made for this species, as it is still of least concern. In general, efforts are being made to create sustainable logging practices that support the creation of early-successional habitat. Sustainable farming practices, such as shade-grown coffee, are becoming more prevalent on Central and South American countries that strike a balance between agriculture and providing habitat for songbirds. Many local Audubon chapters are promoting "lights out" campaigns that work with businesses to turn lights off in large skyscrapers during peak migration season, which reduces migrating bird collisions and fatalities.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large breeding range in southern Canada and the eastern and northern U.S.; numerous occurrences; common in many areas; population relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: North American Breeding Bird Survey (BBS) data indicate a nonsignificant 13% decline in North America from 1966 to 1993 and a nonsignificant 7% decline from 1984 to 1993 (Price et al. 1995). Where the species is most often detected on BBS routes (Adirondack Mountains Physiographic Area) there are signs of decline. Seemingly has become less common in winter habitat in Puerto Rico (Faaborg and Arendt 1989). Sauer and Droege (1992) analyzed the total BBS data set and found declines over the long-term (1966-1988; percent change per year = - 0.30, nonsignificant) and the short-term (1978-1988; percent change per year = -1.54, significant). Similar results were obtained when BBS data were analyzed for the Eastern Region only, but nonsignificant increases were found for both the Central and Western regions, both over the long- and the short-term. Population trends in New England were studied by Witham and Hunter (1992). For the periods 1966-1988 and 1983-1988, populations declined at northern coastal New England (nonsignificantly in 1966-1988, but significantly so in 1983-1988); BBS data for the period 1966-1987 showed a significant increase in the population in central New England, but a nonsignificant decrease in northern New England. Population trends in Ontario were analyzed by Hussell et al. (1992); a significant decline (6.7% per year) in 1961-1970 contributed to a significant net decline for the last three decades (1961-1988; 2.2% per year). For the period 1969-1986, Holmes and Sherry (1988) compared local trends (Hubbard Brook) with regional trends (BBS data for New Hampshire): whereas redstarts declined significantly in New Hampshire (-4.6% annual change), no change was detected in the Hubbard Brook population (+0.013% annual change; nonsignificant).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Primary threats are degradation and fragmentation of suitable habitat and associated increased cowbird parasitism and nest predation. Whitcomb et al. (1981) considered the species to be susceptible to fragmentation, and forest management practices that open the canopy decrease populations (Crawford et al. 1981). Noon et al. (1979) found population decreases in a variety of disturbed and successional habitats. In Arizona (the edge of the range), populations are threatened by the development of streams for recreational pursuits, and suitable habitat is susceptible to scouring by floods; this species also may be intolerant of continuous disturbance by birdwatchers and is potentially impacted by grazing (Schwartz, pers. comm.). Herbicide reversion of suitable habitat to spruce-fir forest is considered a threat in Maine (Tudor, pers. comm.). The biggest threat in Alabama (Bailey, pers. comm.) and Mississippi (Mann, pers. comm.) is the conversion of suitable habitat to pine monocultures. Tropical deforestation may be a significant threat; regional declines in this species cannot necessarily be explained by loss of habitat in temperate North America alone. Where forests are fragmented, cowbirds can have a heavy impact (Bent 1953, Klein and Rosenberg 1986, D. Backland, C. Heckscher, and V. Kleen, pers. comms.), but where forests are more extensive, cowbird parasitism is rare (e.g., Hubbard Brook Experimental Forest; Sherry and Holmes 1992). Rates of nest predation from both mammalian and avian predators also increase in fragmented landscapes; blue jays, squirrels, and many other nest predators are therefore important potential threats. In an unfragmented forest in New Hampshire, breeding abundance decline was associated with poor recruitment due primarily to nest depredation and also weather-related starvation (Sherry and Holmes 1992). Brown-headed cowbird (Molothrus ater) parasitism at Hubbard Brook is rare because of the distance of the forest interior from nonforested habitats preferred by cowbirds. By contrast, Bent (1953) considered the cowbird to be the greatest menace. At Ithaca, New York, the redstart was the most common host of the cowbird, with over 67% of nests being parasitized. Rarely do redstarts desert a nest because of the presence of cowbird eggs. Occasionally a new nest floor is built over the cowbird eggs. In the absence of cowbirds, Sherry and Holmes (1992) found that a high percentages of nests were lost to predators (56-100%), although which mammals and/or birds were responsible was unclear; blue jays (Cyanocitta cristata) and red squirrels (Tamiasciurus hudsonicus) are the most important predators, but there are about 18 species of opportunistic nest predators at Hubbard Brook (Sherry, unpubl. data). Bent (1953) stated that the redstart's habit of nesting in rather tall, slender trees, usually at a considerable distance from the ground, frees this species from most of the enemies to which ground-nesting birds are subject. This is not so at Hubbard Brook, however: for nests less than 10 m high, sheet metal baffles placed below active nests significantly reduced the probability of nest loss; this result was statistically significant even within summers (Sherry, pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: Currently not in need of restoration in any state. Should the species decline, restoration and recovery seems highly plausible if the correct habitat is provided. Where the species is of most concern (e.g., Arizona), it is on the periphery of its range and has never been a common breeder.

Preserve Selection and Design Considerations: When considering a preserve for this species, several factors are necessary to consider: the overstory canopy should be closed, there should be a dense midstory and understory, and well-developed undergrowth; minimum area requirements are poorly understood, although some evidence suggests forests should be extensive. Favorable habitat conditions are created by selective cutting and thinning competing understory trees (Crawford et al. 1981). Although unlikely, edges may be a positive variable for this species (DeGraaf 1985, Chasko and Gates 1982), although this will also increase the likelihood of cowbird parasitism and nest predation.

Freemark and Merriam (1986) regarded this as a forest interior species. Reported as rare or absent in forest patches smaller than about 32 ha in Wisconsin (Bond 1957), 70 ha in Maryland, and 118 ha in Illinois (Blake and Karr 1984). Associated with large (>15 ha) aspen groves in Saskatchewan (Johns 1993). Was regarded as susceptible to forest fragmentation by Whitcomb et al. (1981), who did not find this species in any forest less than 173 acres (70 ha). In contrast, DeGraaf (1985) and Collins et al. (1982) reported that edges are a positive habitat variable. Chasko and Gates (1982) located nests an average 114 ft (35 m) from transmission-line corridors (Bushman and Therres 1988).

Management Requirements: Bushman and Therres (1988) offered the only management guidelines for this species. Forest canopies should be left closed, and disturbed and successional habitats may be detrimental. Selective cutting and thinning of competing understory trees is recommended to promote suitable habitat.

Management Research Needs: Minimum area requirements seem to be the least understood aspect of management. Better estimates of minimum viable population size and impacts of both cowbird parasitism and habitat fragmentation also need to be better addressed. Also, studies of the relative role of tropical deforestation compared with temperate habitat fragmentation are needed--where are redstarts most strongly affected and what is the value of tropical forest to this species?

Comments: Other important research has concerned song (Schackell et al. 1988), delayed plumage maturation in males (Procter-Gray and Holmes 1981, Procter-Gray 1991), foraging (Morse 1973, Robinson and Holmes 1984), and the effects of male plumage and song on reproductive success (Lemon et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Probably there are many protected occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Setophaga ruticilla on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Setophaga ruticilla is a common visitor to shade-grown coffee plantations in Central and South America. These insectivorous warblers are attracted to the ample vegetation provided on these plantations and will consume large amounts of crop pests. This species, along with other insectivores, help to reduce farmer reliance on pesticides.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Widely distributed, both throughout its breeding range in North America and in its wintering range in the West Indies, Central America, and northern South America. Essential breeding habitat is hardwood forest, usually near water, preferably low, damp, deciduous and mixed floodplain forests and river swamps. The major threat is forest fragmentation and general loss of habitat as many states convert mixed deciduous forests to pine monocultures. Where habitat is fragmented, cowbird parasitism can be a serious problem. Population trends are negative, with most states experiencing net losses over the past three decades; studies at Hubbard Brook Experimental Forest in New Hampshire suggest that populations will remain relatively stable if habitat remains intact. Stewardship needs include determination of the minimum area requirements for viable breeding populations and better understanding of the role of habitat loss and cowbird parasitism. Nest predation can be very high (even in forest), and may in fact better explain regional declines than does cowbird parasitism (in some regions); hence nest predation should be addressed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American Redstart

The American Redstart (Setophaga ruticilla) is a New World warbler. It is unrelated to the Old World redstarts. It derives its name from the male's red tail, start being an old word for tail.

Contents

Description [edit]

American Redstart of Quintana, Texas

The American Redstart is smallish warbler. It measures 11 to 14 cm (4.3 to 5.5 in) in total length, has a wingspan of 16 to 23 cm (6.3 to 9.1 in) and weighs 6.7 to 12 cm (2.6 to 4.7 in). Among standard measurements, the wing chord is 5.5 to 6.9 cm (2.2 to 2.7 in), the tail is 4.9 to 5.8 cm (1.9 to 2.3 in), the bill is 0.7 to 0.9 cm (0.28 to 0.35 in) and the tarsus is 1.5 to 1.9 cm (0.59 to 0.75 in).[2] The breeding males are unmistakable, jet black above apart from large orange-red patches on their wings and tails. Their breast sides are also orange, with the rest of their underparts colored white. In their other plumages, American Redstarts display green in their upperparts, along with black central tails and grey heads. The orange patches of the breeding males are replaced by yellow in the plumages of the females and young birds. Orange and yellow coloration is due to the presence of carotenoids; males possess the red carotenoid Canthaxanthin and the yellow carotenoids Canary Xanthophyll A and B, all of which mix together to produce an orange color, while the females possess only the yellow carotenoids. Recent research indicates that an age and sex effect on observed color attributes of hue, brightness, and saturation exists in American Redstarts, with the exception for saturation, which only showed an age effect.[3] Their song is a series of musical see notes. Their call is a soft chip.

Male American Redstart

Distribution and habitat [edit]

They breed in North America, across southern Canada and the eastern USA. These birds are migratory, wintering in Central America, the West Indies, and northern South America (in Venezuela they are called "candelitas"). They are very rare vagrants to western Europe. During the breeding season, this warbler inhabits open-canopy, mostly deciduous forests, second growth, and forest edge across much of the United States and southern Canada. This insectivorous bird often shares its foraging habitats with other warblers, and is found feeding in the mid to lower regions of a tree or shrub. A wide range of habitats are occupied during migration, including many shrubby areas. On their wintering grounds in Central and South America, this warbler may be found in nearly all woody habitats but tend to avoid non-forested agricultural areas. It is often found in shade-grown coffee plantations which provide native trees and shrubs, as well as coffee trees. Elevations occupied vary by location, as this species may be found at elevations up to 3,000 m (9,800 ft) in South America, but only up to 1,500 m (4,900 ft) in Jamaica.

Behaviour [edit]

Breeding [edit]

The breeding habitats of the redstarts are open woodlands or scrub, often located near water. They nest in the lower part of a bush, laying 2-5 eggs in a neat cup-shaped nest. The clutch is incubated by the female for 10 to 13 days. The young fledge after 9 days in the nest, and may remain with one parent for up to 3 weeks after fledging. First-year males are able to reproduce during their first breeding season, but they retain the female-like plumage which may contribute to low reproductive success (less than 50% of first-year males) until year 2. In contrast, most first-year females successfully reproduce during their first breeding season. There is evidence for a skewed sex ratio that results in a surplus of unmated males.[4][5]

American redstarts display a mixed mating strategy; they are predominantly monogamous but around 25% of males maintain multiple territories and are polygynous. Even within monogamous pairs, a high proportion of offspring - as many as 40% - are not fathered by the male of the pair. The intensity of the males' coloration (which is due to carotenoid pigments) predicts their success at holding territory in their non-breeding, winter locations in the Caribbean, the probability that they will be polygynous, and the proportion of offspring in their nests that they will themselves father.[6] Males are invariably very territorial and the superior males occupy the best habitats, such as moist mangroves, while inferior males occupy secondary habitats such as dry scrub forests.

Feeding [edit]

The redstarts feed almost exclusive on insects which are usually caught by flycatching. American Redstarts also have been known to catch their insect prey by gleaning it from leaves. This is a very active species. The tail is often held partly fanned out. These birds have been observed flashing the orange and yellow of their tails, on and off, to startle and chase insects from the underbrush. Overall, this species is a very flexible, opportunistic feeder that can easily adapt to varying habitat, season, insect community, vegetation structure, and time of day. The diet consists largely of caterpillars, moths, flies, leafhoppers and planthoppers, small wasps, beetles, aphids, stoneflies and spiders. Few berries and seeds are consumed, but are most often from barberry, serviceberry, and magnolia.[5]

Mortality [edit]

The oldest known redstart to be banded was over 10 years of age. Other adults have been known to live up to around 5 years of age. However, few survive past the first stages of life. Setophaga ruticilla is vulnerable to both terrestrial and aerial predators. Highest rates of predation occur during the breeding season when eggs and helpless nestlings are abundant and easy prey for varied predators. Females mostly brood during this period and thus often fall prey to nest predators. Common terrestrial predators include red squirrels, fishers, eastern chipmunks, American black bears, flying squirrels, fox snakes, and domestic cats. Aerial predators take nestlings, eggs, or even adults in flight. Possible aerial predators include jaegers, blue jays, common ravens, northern saw-whet owls, common grackles, northern goshawks, and sharp-shinned hawks, and Cooper's hawks.[5][7]

References [edit]

  1. ^ BirdLife International (2012). "Setophaga ruticilla". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ New World Warblers (Helm Field Guides) by Jon Curson. Christopher Helm Publishers (1993). 978-0713639322.
  3. ^ Faris, Michael (2011). Determination and Quantitation of Carotenoids in Setophaga ruticilla Feathers (M.A. thesis). University of Scranton. http://digitalservices.scranton.edu/cdm/ref/collection/p15111coll1/id/798. Retrieved 10 April 2012.
  4. ^ Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York, NY: Simon and Schuster.
  5. ^ a b c Sherry, T., R. Holmes. 1997. American Redstart (Setophaga ruticilla) (On-line). The Birds of North America Online.
  6. ^ Reudink, M. W., Marra, P. P., Boag, P. T., & Ratcliffe, L. M. (2009). Plumage coloration predicts paternity and polygyny in the American redstart. Animal Behaviour, 77, 495-501. doi:10.1016/j.anbehav.2008.11.005
  7. ^ McCallum, C., S. Hannon. 2001. 'Accipiter predation of American redstart nestlings. The Condor, 103/1: 192-194.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!