Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Setophaga citrina

A medium-sized (5 ½ inches) wood warbler, the male Hooded Warbler is most easily identified by its olive-green back, yellow breast and face, and black head and throat connected by solid black neck stripes. Female Hooded Warblers are similar to males, but lack much of the black on the head and throat. The male Hooded Warbler may be distinguished from the similarly-colored Wilson’s Warbler (Cardellina pusilla) by that species’ yellow throat, whereas the female Hooded Warbler may be distinguished from the female Wilson’s Warbler by that species’ lighter head and pale yellow eye-stripes. The Hooded Warbler breeds across much of the eastern United States and extreme southern Canada. Within that range, this species is mostly or completely absent from the southern half of Florida, New England, and parts of the upper Midwest. In winter, Hooded Warblers may be found in the West Indies, southern Mexico, and the Caribbean coast of Central America. Hooded Warblers breed in deciduous forest habitats, preferring woodland with small openings and shrubby edge habitats to dense forest. In winter, this species may be found in undergrowth and edge habitats in tropical forest as well as in overgrown fields. Hooded Warblers primarily eat small invertebrates, including insects and spiders. In appropriate habitat, Hooded Warblers may be observed foraging for insects on leaves, twigs, and branches on the ground or in the undergrowth. Birdwatchers may also listen for this species’ song, a whistled “chi chi chi chi chi chet chet. ” Hooded Warblers are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

E US; winters Mexico to Panama.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Wilsonia citrina is generally found in the midwestern and eastern parts of the United States. The western boundary extends north from east Texas to central Wisconsin, and on the east can be found from western New York and Connecticut down to northern Florida. The hooded warbler generally migrates to Southern Mexico and Central America for the winters. (Johns, 2000)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) BREEDING: extreme southeastern Nebraska (rarely) east to southern Michigan, southern Ontario, and southern New England; south to eastern Texas, Gulf Coast, and northern Florida peninsula; and west to eastern Kansas and eastern Oklahoma (AOU 1983). NON-BREEDING: lowlands from central Veracruz and southern Oaxaca south, including Yucatan Peninsula, through Belize, Guatemala, and Honduras; rarer on Pacific slope than on Atlantic, and rare as far south as Panama. Irregular in West Indies, most noticeably during migration (uncommon in Puerto Rico and the Virgin Islands) (Raffaele 1983). Rare in northern Colombia, northern Venezuela, Trinidad, Netherlands Antilles (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The upper tail and back are an olive-brown color, with the underside of the tail having white feathers. Both male and female birds have a black face with yellow around the eyes, but the coloring on the male is more drastic and distinctive compared to the shaded colors of the female. Wilsonia citrina also has yellow on the underside of the body and pink legs. (Robbins, et al., 1966)

Range mass: 10 to 11 g.

Average length: 12.5 cm.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 0.21538 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wilsonia citrina generally nests in gaps in heavily forested areas, but stays away from the edge of the forest. Wilsonia citrina picks sites that have a well developed understory to build the nest in. The male and female prefer different habitats during the winter months. Males still prefer forested areas while females will take up in brushy fields and shrubby areas (Johns, 2000).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: nests in understory of deciduous forest, especially along streams and ravine edges, and thickets in riverine forests (AOU 1983). Inhabits both young and mature forests but is most abundant in the latter. A dense shrub layer and scant ground cover are important. In North Carolina, common in mountain ravines with dense growth of mountain laurel (Kalmia latifolia) and rhododendron (Rhododendron spp.) and in bottomland swamps with dense pepperbush (Clethra alnifolia) and giant cane (Arundinaria gigantea) (LeGrand, pers. comm.). Generally favors large tracts of uninterrupted forest, but sometimes nests in forest patches as small as 5 ha, probably where these are close to larger forested areas. Nest placed in sapling or shrub in dense deciduous undergrowth, usually between 0.3 - 1.5 m. Individuals often return to the same area to nest in successive years (males are more likely to do so than females).

NON-BREEDING: undergrowth of various wooded habitats, scrubby areas, and thickets (AOU 1983). On winter range males occupy more mature forests than do females (Powell and Rappole 1986, Lynch et al. 1985); males use closed canopy forests, females use shrub or field habitats (Morton 1990). Older birds occupy higher quality habitat (Stutchbury 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In fall, migrates over Gulf of Mexico (east to Greater Antilles). Departure from nesting areas occurs mainly from late July to late September. Begins to arrive in southern Mexico in mid-August, abundant there by late September. Arrival on the wintering grounds extends through late October or early November. In spring follows a more westerly route over the western Gulf and coastal plain of Mexico and Texas. Arrives in breeding areas generally from March or early April through mid-May. Recorded in South America October-April (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Wilsonia citrina feeds primarily on small insects, spiders and other arthropods, either catching them while in flight or picking them off of forest vegetation (Johns, 2000).

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats wide variety of insects and spiders; gleans and flycatches in undergrowth, rarely moves more than 4.5 m above ground when foraging (Terres 1980, Powell and Rappole 1986). On breeding grounds, females seem to glean insects near ground while males hawk or sally to ground from elevated perch (Lynch et al. 1985). In winter in Mexico, foraged in open to fairly dense situations, 0-17 m above ground (average 2.7 m); most often hawked and sallied for flying insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

While this species feeds on small insects and arthropods, it is not clear that it plays a unique role in the ecosystem, or that its function would have any impact on the ecosystem if it were removed. It has been reduced dramatically in number in various Canadian forests, but there is no apparent effect on those forests (Whittam & McCracken, 1999).

Ecosystem Impact: creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of W. citrina include snakes, racoons and cats. The largest danger comes from the possibility of running into man-made structures during the nocturnal migrations (Whittam & McCracken, 1999).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Wilsonia citrina is prey of:
Serpentes
Procyon lotor
Felis silvestris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Wilsonia citrina preys on:
non-insect arthropods
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: See Page and Cadman (1994 COSEWIC report) for status in Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Breeding territory size generally is about 0.5-0.75 ha. Males and females also maintain separate winter territories. Commonly returns to same winter territory in successive years (Powell and Rappole 1986, Rappole and Warner 1980); often joins mixed flocks within territory (Stiles and Skutch 1989). Breeding density may range up to 22 pairs per 40 ha.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The hooded warbler has two modes of singing. One involves repeatedly singing the same pattern, and the other is an irregular mix of 3 or 4 different patterns. Singing is used by both the males and females in attracting mates. The repeat mode may be used for attracting the mate, while the irregular mode is some sort of method of "negotiating" with nearby warblers (Wiley, et al., 1994).

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of W. citrina is about 8-9 years.

Average lifespan

Status: wild:
8 years.

Average lifespan

Status: wild:
98 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Both male and female W. citrina sing during the process of attracting a mate. While birds will form pairs for mating purposes, it is frequently found that a mother's eggs have been fertilized by a neighboring male (Johns, 2000).

Mating System: monogamous

The female constructs a nest in the underbrush of a low lying area. The nest is constructed of bark and plant material, with an outer layer of dead leaves. Three to five eggs are laid, then normally incubated for about twelve days before hatching. After hatching, the chicks will fledge in about eight or nine days and continue their growth into adult birds. Juvenile birds will be capable of reproduction the next breeding season.

Breeding season: April - June

Range eggs per season: 3 to 5.

Average time to hatching: 12 days.

Average fledging age: 9 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average time to hatching: 12 days.

Average eggs per season: 3.

Males provide from 25% to 75% of feeding visits to young. Scientists had hypothesized that males that provide less parental care use their time and energy to seek matings with neighboring females instead. However, this turns out not to be the case. (Pitcher and Stutchbury, 2000)

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In most areas, nesting occurs mainly from mid- to late May through July. In Ohio, most clutches are completed from mid-May to mid-June (Peterjohn and Rice 1991). Clutch size three to four (rarely five). Incubation, by the female, lasts 12 days. Young are tended by both parents, leave nest in 8-9 days, fly 2-3 days later, remain with adults for several weeks. Sexually mature usually in one year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Wilsonia citrina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTGATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCTCTTCTGGGAGACGACCAAGTCTATAACGTAGTTGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCTATTATAATCGGAGGGTTTGGAAATTGACTAGTCCCCCTAATAATTGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGCGTAGGTACAGGCTGAACTGTGTACCCACCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTGGCAATCTTCTCCCTACACCTGGCCGGTATTTCCTCAATCCTCGGGGCAATTAACTTCATTACAACAGCAATTAATATGAAACCTCCTGCCCTCTCACAATATCAAACCCCTCTATTCGTCTGATCAGTCCTAATCACTGCAGTTCTCCTACTCCTTTCCCTCCCAGTCCTAGCTGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTCGATCCTGCCGGAGGAGGAGATCCCGTCCTATATCAACATCTTTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTTATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Wilsonia citrina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wilsonia citrina is generally abundant in the United States. In Canada, however, concern has been raised about the dwindling number of mating pairs and efforts are being made to study and prevent the loss of this species from the Canadian landscape. In some cases selective logging may actually help in that it provides a gap in the forest for W. citrina to live, yet doesn't create an edge to the forest. It is difficult for W. citrina to survive on the forest edge because of the increased presence of predators and the loss of desired habitat. (Whittam & McCracken, 1999). Hooded warblers are considered to be a species of special concern in Michigan.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: special concern

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3B - Vulnerable

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range, increasing trend; locally threatened by habitat loss and degradation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: North American Breeding Bird Survey (BBS) data indicate a non-significant population increase of 0.4% per year from 1966-1996 (Sauer et al. 1997). Trend is significantly positive (2.1% per year) in eastern North America, non-significantly negative in central North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Threats include habitat loss and degradation in temperate and tropical regions (e.g., conversion of diverse forests to plantations, forest fragmentation) and in some areas, parasitism by the brown-headed cowbird (Molothrus ater). On Delmarva Peninsula, river channelization and associated effects on floodplain forests is suspected as a cause of decline (Heckscher, pers. obs.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: Potential for successful restoration will be greatest at sites occurring in proximity to extant populations. Increasing size of contiguous forests, expanding forest buffers, and promoting dense understory, should increase chances for successful population restoration.

Preserve Selection and Design Considerations: Large contiguous forests will provide the greatest probability of maintaining long-term viable populations. Robbins (1979) suggested that 30 ha was the minimum area needed to sustain viable populations. However, this may be a low estimate for some geographical regions. For example, in Illinois not detected in forests < 600 ha (Blake and Karr 1984) and in Wisconsin not believed to occupy forests < 200 ha (Mossman, pers. comm.). Selection of riparian forests with mature forest buffers, as opposed to those without, may be important in designing preserves (e.g., Sargent et al. 1997). Robbins et al. (1989) found that the percent of forest within 2 km of sites was a significant predictor of occurrence and is probably important in maintaining populations within a given area.

Site specific information seems important. For example, New Jersey birds once thought to be nesting in cedar swamps found to be associated with hardwood forests on swamp edges (Wander 1981) and in Delaware found to be uncommon at site where previously believed to be common (Heckscher, pers. obs.).

Management Requirements: Notable declines in disturbed and successional habitats in general have been observed. However, forest management practices noted as beneficial or tolerable include localized disturbances that result in an increased shrub layer density such as selective logging, small clearcuts, and thinning of trees. These practices will be beneficial only when they increase the overall heterogeneity of large forest stands.

Robbins et al. (1989) found that dense foliage between 0.3 and 1 m is an important component, and a successful predictor, of occupied sites. Has been observed in logged areas as early as 3 years after cutting when numerous trees > 7 cm dbh are left uncut (Bushman and Therres 1988). Similarly, Robinson and Robinson (1999) reported higher numbers in forest openings from "perforation" practices in large forests in Illinois; numbers peaked at 4 or 5 years after cutting. However, these management practices should be implemented with caution because increased parasitism and predation rates may also be associated with forest openings. In Wisconsin, characteristics of forest openings occupied include size < 10 m wide and hardwood saplings/seedlings 1.5-4 m with some canopy cover (Mossman, pers. comm.). Occupied forest openings in Wisconsin created by selective logging 5 - 20 years earlier, varied in size from 0.03 ha to 1 ha with density of 200-420 saplings per 0.01 ha (Brittingham and Temple 1980). In the same forest, similar openings in dry or xeric areas remained unoccupied (Mossman and Lange 1982). In Delaware, observed occupying forests 3 to 4 years after severe southern pine bark beetle (DENDROCTONUS FRONTALIS) outbreak resulted in development of dense understory (Heckscher, pers. obs.).

Systematic removal of adult cowbirds from concentrated populations has reduced cowbird parasitism but has not lead to significant increases in productivity (Evans Ogden and Stutchbury 1994). Nest predation, not parasitism, is widely considered the greatest contributor to low population productivity.

Large-scale management guidelines suggested include maintenance of large areas of contiguous forest (Robbins et al. 1989). Sargent et al. (1997) suggested that maintenance of riparian forests (> 50 m wide) is essential to conservation in southeastern North America. Mature pine forests may be important in buffering riparian forests and thus effectively increasing the productivity in these ecosystems (Sargent et al. 1997).

Management Research Needs: A better understanding of the response to forest thinning is needed and how thinning compares with that of forest perforation (see Robinson and Robinson 1999), especially with regard to annual productivity. The effect of size and shape of localized cuts on reproductive success should be determined prior to widespread use as a management tool. To gain a better understanding of effective preserve design, better understanding of the factors influencing recruitment, seems important. Understanding of natal dispersal and yearling habitat choice are needed (Evans Ogden and Stutchbury 1994) and should lead to improved chance for effective habitat restoration. The role of complex social interaction in habitat selection is largely unknown; small forests may not provide this important need (Evans Ogden and Stutchbury 1994).

Biological Research Needs: Habitat associations during migratory periods are largely unknown. Although relatively well studied on wintering grounds (Stutchbury 1994), needs additional research on effects of tropical deforestation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species has no negative effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

It is not clear that this species has any positive impact on humans other than its aesthetic value and its contribution to animal diversity.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Preservation of large tracts of contiguous forest or riparian bottomland forests with mature forest buffers are of primary importance. Preserve design should include large tracts to provide both the temporal and spatial variation in forest structure necessary for long-term persistence. Limited forest thinning or localized clearings can improve habitat if some large trees and dense saplings are not removed. Clearings should be small to minimize the possible increase in parasitism and predation often associated with forest edges. Effect of thinning and localized cuts on annual reproductive success has not been investigated. Site specific information should be collected prior to implementing management strategies. More research on effective management and monitoring protocol in tropical regions is needed. Monitoring management areas and preserves by use of point counts or transects seems most likely to be effective and is recommended to quantify success of management practices.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hooded Warbler

The Hooded Warbler (Setophaga citrina) is a New World warbler. It breeds in eastern North America and across the eastern USA and into southernmost Canada, (Ontario). It is migratory, wintering in Central America and the West Indies. Hooded Warblers are very rare vagrants to western Europe.

Recent genetic research has however suggested that the type species of Wilsonia (Hooded Warbler W. citrina) and of Setophaga (American Redstart S. ruticilla) are closely related and should be merged into the same genus. As the name Setophaga (published in 1827) takes priority over Wilsonia (published in 1838), Hooded Warbler would then be transferred as Setophaga citrina.[2] This change has been accepted by the American Ornithologists' Union,[3] and the IOC World Bird List.[4]

Female on nest

Contents

Description [edit]

The Hooded Warbler is a small bird and mid-sized warbler, measuring 13 cm (5.1 in) in length and weighing 9–12 g (0.32–0.42 oz).[5] It has a plain olive/green-brown back, and yellow underparts. Their outer rectrices have whitish vanes. Males have distinctive black hoods which surround their yellow faces; the female has an olive-green cap which does not extend to the forehead, ears and throat instead. Males attain their hood at about 9–12 months of age; younger birds are essentially identical to (and easily confused with) females.[6] The song is a series of musical notes which sound like: wheeta wheeta whee-tee-oh, for which a common mnemonic is "The red, the red T-shirt" or "Come to the woods or you won't see me". The call of these birds is a loud chip.

Life history [edit]

These birds feed on insects, which are often found in low vegetation or caught by flycatching. Hooded Warblers' breeding habitats are broadleaved woodlands with dense undergrowth. These birds nest in low areas of a bush, laying 3–5 eggs in a cup-shaped nest. Hooded Warblers are often the victims of brood parasitism by the Brown-headed Cowbird, especially where the Hooded Warblers' forest habitats are fragmented. In areas with protected woodlands or recovering wooded habitat, the hooded warbler population is stable and possibly increasing.[5]

References [edit]

  1. ^ BirdLife International (2009). "Wilsonia citrina". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 31 May 2012. 
  2. ^ Lovette, I. J. et al. (2010). "A comprehensive multilocus phylogeny for the wood-warblers and a revised classification of the Parulidae (Aves)". Molecular Phylogenetics and Evolution 57 (2): 753–770. doi:10.1016/j.ympev.2010.07.018. PMID 20696258. 
  3. ^ Chesser, R. T. et al. (2011). "Fifty-Second Supplement to the American Ornithologists' Union Check-list of North American Birds" (PDF). Auk 128 (3): 600–613. doi:10.1525/auk.2011.128.3.600. 
  4. ^ "Family Parulidae". IOC World Bird List. 
  5. ^ a b "Hooded Warbler". All About Birds. Cornell Lab of Ornithology. 
  6. ^ Burns, Frank L. (1898). "Hooded Warbler" (PDF). Wilson Bulletin 10 (5): 70. 

Further reading [edit]

  • Curson, Jon; Quinn, David; Beadle, David (1994). New World Warblers. London: Christopher Helm. ISBN 0-7136-3932-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!