Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

The Common Yellowthroat (Geothlypis trichas) is a common breeding bird across most of North America, from Canada south through Mexico, with a winter range extending from the southern United States to northern South America.. Common Yellowthroats tend to stay low in grassy fields, thickets, and marshes. They breed most abundantly in marshes (especially cattails) and other very wet habitats with low, dense growth. During migration and in winter they are less closely associated with marshes and may occur in any sort of brushy or wooded area.

The diet of the Common Yellowthroat consists mainly of insects and spiders, but includes some seeds.

During courtship, the male displays to the female by flicking his wings and tail, following her closely, and performing a flight display in which he may climb up to 30 m in the air and returns to another low perch, calling and singing.

Common Yellowthroats generally nest less than a meter from the ground. The nest is a bulky open cup built by the female and sometimes has a partial roof of material loosely attached to the rim. There are typically 3 to 5 (sometimes 6) eggs, which are creamy white with brown and black spots. The eggs are incubated (by the female only) for 12 days. The male feeds the female on the nest during incubation. Young are fed by both parents and leave the nest after 8 to 10 days. There are typically two broods per year. The young remain dependent on their parents for longer than most other wood warblers. Common Yellowthroats are very commonly "parasitized" by Brown-headed Cowbirds, which are "brood parasites", laying their eggs in the nests of birds of other species in lieu of building their own.

Migration occurs mainly at night and in many areas is spread over a long period in both spring and fall.

Despite habitat loss that has surely led to local declines, the Common Yellowthroat remains a common and widespread species in the United States and Canada.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: southeastern Alaska to central Saskatchewan and Newfoundland, south to northern Baja California, southern Mexico, southern Texas, Gulf Coast, and southern Florida. WINTERS: northern California, southwestern U.S., southern Texas, Gulf states and South Carolina south through Mexico and the West Indies (fairly common in Puerto Rico, rare in Virgin Islands, Raffaele 1983), to Panama and rarely into Colombia, Venezuela, Netherlands Antilles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Geothlypis trichas nest in Alaska and from the Atlantic Ocean to the Pacific Ocean across Canada and the United States. They also nest further south into Mexico. Their wintering range is from southern United States to northern South America and into the West Indies (Terres 1980; Versaware 2000).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Common Yellowthroats are wren-like wood warblers with upturned tails. They are 11 to 14 cm in length. The males are olive green above and have a year round black facial mask, bordered above by a blue-white band. They have a white belly with pale yellow chin, throat, breast, and undertail coverts. The beak is black and the legs are a pinkish color. The females look similar to the males but lack the black facial mask. Immature yellowthroats are dull brown with the males' face showing a drab facial mask (Rogers 2000; Terres 1980; Tufts 1986).

Range mass: 7.3 to 13.6 g.

Average basal metabolic rate: 0.17622 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 13 cm

Weight: 10 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the Kentucky warbler by lacking a yellow line over the eye. Differs from the yellow-breasted chat in smaller size (chat 18 cm long) and lack of a white line extending from the top of the eye to the bill.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Marshes (especially cattail), thickets near water, bogs, brushy pastures, old fields, and, locally, undergrowth of humid forest. In migration and winter also in brushy and shrubby areas in both moist and arid regions (AOU 1983).

Nests just above ground or over water, in weeds, reeds, cattails, tules, grass tussocks, brier bushes, and similar situations; often at base of shrub or sapling, sometimes higher in weeds or shrubs up to about 1 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Yellowthroats occupy non-forested areas low to the ground in briers, damp brushy places, weeds or grasses along country roads or agricultural environments. They are also found in cattails, bulrushes, sedges, and willows by streamsides, swamps, freshwater, and salt-water marshes. They occupy similar types of habitats for both their breeding and wintering locations (Fisher and Acorn 1998; Rogers 2000; Terres 1980).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Winter: withdraws from areas north of the southern U.S. Arrives in Puerto Rico by September-October, departs mostly by the end of April but some remain into June; appears to congregate and pair before migrating north in spring (Raffaele 1983). Migration in Costa Rica extends from mid-October to November and from April to early May (Stiles and Skutch 1989). Present in South America mostly October-April (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats various small invertebrates obtained among low plants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The yellowthroat is generally an insectivore. It gleans leaves of shrubbery, grasses or weeds for adult and larval insects such as grasshoppers, dragonflies, beetles, butterflies, and spiders. Seeds are sometimes eaten as well (Fisher and Acorn 1998; Terres 1980).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Geothlypis trichas (Maryland yellow-throat) is prey of:
Accipiter striatus
Accipiter cooperii

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Geothlypis trichas (Maryland yellow-throat) preys on:
Araneae
Disyonicha quinquevitata
Insecta
Collembola
Diptera
Auchenorrhyncha
Sternorrhyncha
Lepidoptera
Coleoptera
Arachnida

Based on studies in:
Canada: Manitoba (Forest)
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 393 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Density was about 1.5-2.5 territories per ha in southeastern Massachusetts (Morimoto and Wasserman 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
138 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size is 3-6 (usually 4). Usually produces two broods per year. Incubation, by female, lasts 11-13 days. Young are tended by both parents, leave nest at 8-10 days. Polygyny has been observed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The female yellowthroat lays her eggs between April and July, and incubates 3-5 eggs for 12 days. The eggs are white or cream-white and are speckled brown, black, or grey at the large end. The cup-shaped, bulky nest made from dead leaves, coarse grass and weed stems, with a lining of fine black rootlets, is located low to the ground, in shrubbery. While only the female incubates the eggs, both the male and female tend the young. The young are altricial and leave the nest 8 days after hatching (Ehrlich et al. 1988; Fisher and Acorn 1998; Terres 1980; Tufts 1986).

Average time to hatching: 12 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Geothlypis trichas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCATNTATNTAATTTTCGGCGCATGAACCGGAATAGTGGGTACCGCCCTAAGCCTCCTAATCCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCGCCATCATTCCTCCTCCTCCTAGCATCATCCACAGTTGAAGCAGGAGTAGGCACAGGTTGAACAGTGTACCCCCCACTAGCCGGCAACCTAGCCCACGCTGGGGCCTCAGTCGACCTCGCAATCTTCTCCTTACACTTAGCCGGTATCTCCTCAATCCTTGGGGCAATCAACTTCATTACAACAGCAATCAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCTCTATTCGTTTGATCAGTACTAATCACCGCAGTGCTCCTACTCCTCTCCCTTCCAGTCCTAGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACTACATTCTTCGACCCGGCTGGAGGAGGAGATCCAGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCCGAAGTTTATATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Geothlypis trichas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There has been a general decline in neotropical migrants. However, the yellowthroat is a very common species of wood warbler and the only threats to its status may be the parasitism of cowbirds and the possibility of habitat loss from development of open areas or wetlands.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The Common Yellowthroat has no known negative impact on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Yellowthroats are a pleasant addition to the variety of sights and sounds of wetlands.

They eat many different species of insects, some of which may pose as pests to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common yellowthroat

The common yellowthroat (Geothlypis trichas) is a New World warbler. They are abundant breeders in North America, ranging from southern Canada to central Mexico.

Description[edit]

Common yellowthroats are small songbirds that have olive backs, wings and tails, yellow throats and chests, and white bellies. Adult males have black face masks which stretch from the sides of the neck across the eyes and forehead, which are bordered above with white or gray. Females are similar in appearance, but have paler underparts and lack the black mask. Immature birds are similar in appearance to the adult female. First-year males have a faint black mask which darkens completely by spring.[2]

There are 13 races of this bird. These races differ mainly in the males' facial patterns and the brightness of the yellow underparts. The southwestern forms of this bird are the brightest and the yellowest below.[3]

Habits[edit]

The breeding habitats of these birds are marshes and other wet areas with dense low vegetation, and may also be found in other areas with dense shrub. However, these birds are less common in dry areas. Females appear to prefer males with larger masks. Common yellowthroats nest in low areas of the vegetation, laying 3–5 eggs in a cup-shaped nest. Both parents feed the young.

Northern races are migratory, wintering in the southern parts of the breeding range, Central America and the West Indies. Southern forms are largely resident. This species is a very rare vagrant to western Europe.

These birds feed on insects, which are usually captured in dense vegetation, but sometimes caught in midair.

The common yellowthroat's song is a loud twichety twichety twichety twich. Its call is a soft jip.

Population[edit]

Despite a decline in numbers in some areas, which is due to loss of favoured habitat, this species is still very common.

References[edit]

  1. ^ BirdLife International (2012). "Geothlypis trichas". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Common Yellowthroat". All About Birds. Cornell Lab of Ornithology. Retrieved 2009-05-17. 
  3. ^ Curson, Quinn and Beadle New World Warblers ISBN 0-7136-3932-6

Further reading[edit]

Books[edit]

  • Guzy, M. J., and G. Ritchison. 1999. Common Yellowthroat (Geothlypis trichas). In The Birds of North America, No. 448 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Exhibits relatively deep mtDNA separations between populations in Washington and those in the central and eastern states (Ball and Avise 1992). Populations around Lake Chapala, Jalisco, regarded as a distinct group, CHAPALENSIS (AOU 1998). Sometimes regarded as conspecific with G. ROSTRATA, G. FLAVOVELATA, and G. BELDINGI (AOU 1983). Further study required of species relationships with GEOTHLYPIS (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!