Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.620 - 10.632
  Nitrate (umol/L): 5.801 - 12.829
  Salinity (PPS): 32.748 - 35.293
  Oxygen (ml/l): 6.330 - 6.507
  Phosphate (umol/l): 0.521 - 0.734
  Silicate (umol/l): 2.744 - 8.436

Graphical representation

Temperature range (°C): 9.620 - 10.632

Nitrate (umol/L): 5.801 - 12.829

Salinity (PPS): 32.748 - 35.293

Oxygen (ml/l): 6.330 - 6.507

Phosphate (umol/l): 0.521 - 0.734

Silicate (umol/l): 2.744 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Anthus spinoletta (water pipits, horned larks) preys on:
Hemiptera
Coleoptera
Diptera
Hymenoptera

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Anthus spinoletta (water pipits, horned larks) is prey of:
Falco mexicanus

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anthus spinoletta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATCTTCGGCGCATGAGCAGGAATAGTAGGCACTGCCCTGAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCTCTCCTGGGAGACGATCAAGTCTACAACGTAGTCGTCACCGCCCACGCCTTCGTAATGATCTTCTTCATAGTCATGCCCATCATGATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCGGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCACCATCATTCCTCCTCCTACTAGCATCCTCCACAGTCGAAGCAGGAGTCGGTACAGGCTGAACTGTATACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGAGCATCCGTTGATCTAGCAATCTTCTCCCTGCACCTAGCTGGAATTTCATCTATCCTAGGCGCAATCAACTTCATCACAACAGCAATCAACATAAAACCTCCCGCCCTCTCACAATACCAAACCCCTCTGTTTGTCTGATCCGTCCTGATCACCGCAGTACTACTCCTGCTCTCCCTACCAGTGCTGGCCGCAGGCATCACAATACTCCTAACAGACCGTAACCTCAACACCACATTCTTCGACCCAGCAGGAGGAGGAGACCCAGTCCTGTACCAACATCTTTTCTGATTCTTTGGCCACCCAGAGGTTTACATCCTGATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anthus spinoletta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 640,000-2,000,000 breeding pairs, equating to 1,920,000-6,000,000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size is 8,000,000-120,000,000 individuals, although further validation of this estimate is needed. The population in China has been estimated at c.50-1,000 individuals on migration and c.50-1,000 wintering individuals (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Water pipit

The water pipit (Anthus spinoletta) is a small passerine bird which breeds in the mountains of southern Europe and southern temperate Asia across to China. It is a short-distance migrant moving to wet open lowlands such as marshes and flooded fields in winter. Some birds migrate north to Britain for winter, taking advantage of the warm oceanic climate[citation needed].

Like most other pipits, this is an undistinguished looking species on the ground, mainly brown above and dark streaked buff below. It has dark legs, white outer tail feathers and a longish dark bill. In summer it has a distinctive breeding plumage, with a pinkish breast, grey head and pale supercilium.[2][3]

Anthus spinoletta from Tal Chhapar Sanctuary

The Eurasian rock pipit's subspecies littoralis in summer plumage is very close in outward appearance to the water pipit. They can be told apart by their song,[4] and occupy different habitat types even when they occur in the same general area.[5] The water pipit is also much less approachable than the Eurasian rock pipit, rising high and quickly leaving the vicinity when approached. Water and buff-bellied pipit do not co-occur except in a small area in Central Asia.[6]

This species is insectivorous. Its call is an explosive "fit", like Eurasian rock pipit. Its song is similar, but it consisting of maybe 5 "blocks" of just about half a dozen notes each (the Eurasian rock pipit has fewer, but longer blocks); it ends either with no or with repeated trills.[5]

Formerly included in the water pipit were the subspecies now separated as rock pipit and buff-bellied pipit.[7] The former is more closely related to the water pipit than the latter, as indicated by external[2] and molecular characteristics.[8]

References[edit]

  1. ^ BirdLife International (2012). "Anthus spinoletta". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Per Alström & Krister Mild (1996). "The identification of Rock, Water and Buff-bellied Pipits". Alula 2 (4): 161–175. 
  3. ^ Per Alström & Krister Mild (1987). "Some notes on the taxonomy of the Water Pipit complex". Proceedings of the 4th International Identification Meeting. Eilat: International Birdwatching Center. pp. 47–48. 
  4. ^ V. V. Leonovich, G. V. Deminia & O. D. Veprintseva (1997). "On the taxonomy and phylogeny of pipits (Genus Anthus, Motacillidae, Aves) in Eurasia". Biulleten Moskovskogo obshchestva ispytatelei prirody. Otdel biologicheskii (in Russian) 102 (2): 14–22. 
  5. ^ a b R. Bijlsma (1977). "Voorkomen en oecologie van Anthus spinoletta en A. s. littoralis in de uiterwaarden van de Rijn bij Wageningen". Limosa (in Dutch) 50: 127–136. 
  6. ^ A. A. Nazarenko (1978). "On species validity of Anthus rubescens Tunstall (Aves: Motacillidae)". Zoologicheskiy Zhurnal (in Russian) 57: 1743–1744. 
  7. ^ George Sangster, Alan G. Knox, Andreas J. Helbig & David T. Parkin (2002). "Taxonomic recommendations for European Birds". Ibis 144 (1): 153–159. doi:10.1046/j.0019-1019.2001.00026.x. 
  8. ^ G. Voelker (1999). "Molecular evolutionary relationships in the avian genus Anthus (Pipits: Motacillidae)". Molecular Phylogenetics and Evolution 11 (1): 84–94. doi:10.1006/mpev.1998.0555. PMID 10082613. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!