Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.620 - 10.632
  Nitrate (umol/L): 5.801 - 12.829
  Salinity (PPS): 32.748 - 35.293
  Oxygen (ml/l): 6.330 - 6.507
  Phosphate (umol/l): 0.521 - 0.734
  Silicate (umol/l): 2.744 - 8.436

Graphical representation

Temperature range (°C): 9.620 - 10.632

Nitrate (umol/L): 5.801 - 12.829

Salinity (PPS): 32.748 - 35.293

Oxygen (ml/l): 6.330 - 6.507

Phosphate (umol/l): 0.521 - 0.734

Silicate (umol/l): 2.744 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.620 - 10.632
  Nitrate (umol/L): 5.801 - 12.829
  Salinity (PPS): 32.748 - 35.293
  Oxygen (ml/l): 6.330 - 6.507
  Phosphate (umol/l): 0.521 - 0.734
  Silicate (umol/l): 2.744 - 8.436

Graphical representation

Temperature range (°C): 9.620 - 10.632

Nitrate (umol/L): 5.801 - 12.829

Salinity (PPS): 32.748 - 35.293

Oxygen (ml/l): 6.330 - 6.507

Phosphate (umol/l): 0.521 - 0.734

Silicate (umol/l): 2.744 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Anthus spinoletta (water pipits, horned larks) preys on:
Hemiptera
Coleoptera
Diptera
Hymenoptera

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Anthus spinoletta (water pipits, horned larks) is prey of:
Falco mexicanus

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anthus spinoletta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATCTTCGGCGCATGAGCAGGAATAGTAGGCACTGCCCTGAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCTCTCCTGGGAGACGATCAAGTCTACAACGTAGTCGTCACCGCCCACGCCTTCGTAATGATCTTCTTCATAGTCATGCCCATCATGATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCGGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCACCATCATTCCTCCTCCTACTAGCATCCTCCACAGTCGAAGCAGGAGTCGGTACAGGCTGAACTGTATACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGAGCATCCGTTGATCTAGCAATCTTCTCCCTGCACCTAGCTGGAATTTCATCTATCCTAGGCGCAATCAACTTCATCACAACAGCAATCAACATAAAACCTCCCGCCCTCTCACAATACCAAACCCCTCTGTTTGTCTGATCCGTCCTGATCACCGCAGTACTACTCCTGCTCTCCCTACCAGTGCTGGCCGCAGGCATCACAATACTCCTAACAGACCGTAACCTCAACACCACATTCTTCGACCCAGCAGGAGGAGGAGACCCAGTCCTGTACCAACATCTTTTCTGATTCTTTGGCCACCCAGAGGTTTACATCCTGATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anthus spinoletta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5