Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Geothlypis formosa

A medium-sized (5 ½ inches) wood warbler, the Kentucky Warbler is most easily identified by its olive-green back, yellow breast and throat, black eye-stripes, and yellow eye-rings. Other field marks include a short tail, pale legs, and thin bill. Male and female Kentucky Warblers are similar to one another in all seasons. The Kentucky Warbler breeds in the eastern and southeastern United States from New York south to northern Florida and west to Oklahoma. This species is a long-distance migrant, wintering from central Mexico south to northern South America. Despite this species’ small size, Kentucky Warblers cross the Gulf of Mexico twice a year while on migration, and are occasionally reported resting on ships in the Gulf. Kentucky Warblers breed in thick deciduous forests with large amounts of undergrowth, particularly those near water. In winter, this species inhabits humid tropical forests with similar quantities of undergrowth to those forests used during the summer. Kentucky Warblers eat small invertebrates, including beetles, caterpillars, and spiders. Due to this species’ preference for heavily vegetated habitats, Kentucky Warblers are much more easily heard than seen. Birdwatchers may listen for this species’ “churry-churry-churry-churry” song, or may attempt to observe it foraging for insects deep in the undergrowth. Kentucky Warblers are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least Concern

  • Kentucky Warbler (Oporornis formosus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Mcdonald, Mary Victoria. 1998. Kentucky Warbler (Geothlypis formosus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/324
  • Oporornis formosus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Kentucky Warbler. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations, but breeds in a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: from southeastern Nebraska, east across central Iowa, southwestern Wisconsin, northeastern Illinois, central Indiana, north-central Ohio, southern Pennsylvania, northern New Jersey, and southeastern New York, to southwestern Connecticut, south to Texas, Gulf Coast to northwestern Florida, central Georgia, and South Carolina, and west to eastern Kansas and central Oklahoma (AOU 1983). NON-BREEDING: tropical zones of southern Veracruz and Oaxaca, through Chiapas, the base of the Yucatan Peninsula, primarily on the Caribbean slope of northern Central America, throughout Costa Rica and Panama, and into northern Colombia and northwestern Venezuela (AOU 1983, McDonald 1998). Uncommon transient through the West Indies; some may overwinter on eastern and southern West Indies islands (McDonald 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E US; winters Mexico to nw South America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 13 cm

Weight: 14 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adults are easily distinguished from other species. Nests are like those of the golden-winged warbler (VERMIVORA CHRYSOPTERA), but unlike many ground-nesting birds, the Kentucky warbler usually builds a nest slightly above ground level (Harrison 1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Oporornis formosus
Catalog Number: USNM 137220
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male;
Preparation: Skin: Whole
Collector(s): W. Todd
Year Collected: 1893
Locality: Vanport, 1.5 mi Down Ohio River From, Near Mouth of Four-Mile Run, Beaver, Pennsylvania, United States, North America
  • Type: Oberholser. September 23, 1974. Bird Life Of Texas. ii: 1001.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Oporornis formosus
Catalog Number: USNM 137220
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male;
Preparation: Skin: Whole
Collector(s): W. Todd
Year Collected: 1893
Locality: Vanport, 1.5 mi Down Ohio River From, Near Mouth of Four-Mile Run, Beaver, Pennsylvania, United States, North America
  • Type: Oberholser. September 23, 1974. Bird Life Of Texas. ii: 1001.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Humid deciduous forest (Hamel 1992), dense second growth, swamps. Occurs in stands of various ages but is most common in medium-aged forests (Shugart et al. 1978). Prefers forests with a slightly open canopy, dense understory, and well-developed ground cover (Bushman and Therres 1988). Seldom found in conifers. In Virginia, McShea et al. (1995) found that forest type, streams, and the density of deer were significant variables in territory selection, but forest age (within a reasonable span of years) and the presence of a habitat boundary did not contribute significantly. Specifically, warblers selected cove hardwoods and avoided oak/hickory overstory. The avoidance of oak/hickory overstory is surprising, since a nonquantified gestalt impression of distribution at this site would at first suggest they prefer oak/hickory. Areas with streams and low white-tailed deer (ODOCOILEUS VIRGINIANUS) density also were selected.

NON-BREEDING: In migration, habitats include forest, woodland, scrub, and thickets. In winter, habitat includes the floor of rain forests; also second growth, forest edge, undergrowth (AOU 1983, Bushman and Therres 1988). This species was found in wet forest (most commonly), moist forest (less commonly), and dry forest (rarely) on the Yucatan Peninsula (Lynch 1992); birds were also captured in mid-successional Acahual habitat. From studies in various Latin American countries, Robbins et al. (1992) concluded that wintering birds are ground foragers that require forest. Some birds were found in early successional habitats, but only an occasional bird was captured in pine woods or agricultural habitats. In Belize, found to prefer broadleaved forest edge and interior habitats (Petit et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in Costa Rica early to mid-September, departs by late April (Stiles and Skutch 1989). Present in South America mostly October-March (Ridgely and Tudor 1989). See also McLaren (1981) and Moore (1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Walks rapidly over ground overturning leaves with bill, searches under sticks and in crevices, leaps up to snatch insect or spider from overhanging leaf or branch (Terres 1980). In winter in Mexico, gleans insects from the undersurfaces of low herbaceous growth typical of dense humid forests; sometimes climbs into low vegetation; uncommonly takes food items from forest floor (Rappole and Warner 1980). Also forages along twigs in low shrubbery (Stiles and Skutch 1989). Regularly attends army ant swarms in Panama (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 to >1,000,000 individuals

Comments: Locally abundant where there is suitable habitat. Breeding Bird Survey data show the Kentucky warbler to be relatively abundant in West Virginia, Arkansas, and Louisiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

POPULATION DENSITY: Published information on densities from breeding bird censuses in the southeastern U.S. between 1947 and 1979 were summarized by Hamel et al. (1982): mean (se) density was 4.8 (0.56) pairs per 40 ha with a range of 1-8.5 pairs per 40 ha. In Missouri, density was 1.82 males per 10 ha in continuous forest, 0.91-1.29 per 10 ha in isolated forest fragments (Wenny et al. 1993). Wenny et al. (1993) studied two forest fragments, one smaller (300 ha) and one larger (> 800 ha) in Missouri. Kentucky warblers were found to have significantly higher densities in the larger forest area than in both fragments. In the largest contiguously forested site (> 800 ha), the estimated total population size was 243 birds with 98 breeding pairs. Gibbs and Faaborg (1990) found an average 2.2 males per 10 ha in larger forest tracts compared with 1.4 males per 10 ha in smaller fragments. Whitcomb et al. (1981) reported a territorial density of 36 males per sq km in Maryland. In Virginia, densities of 30-55 pairs were observed over the years 1988-1997 in the 1200 ha core area of suitable habitat at the study site (McDonald 1998). Winter density was up to 5.5 birds per 10 ha in Panama, around 30 per 10 ha in Veracruz, Mexico (Mabey and Morton 1992).

TERRITORY SIZE: Territory sizes were found to differ significantly between forest tracts of different size by Wenny et al. (1993): territories averaged 0.8 ha in a large forest (> 800 ha) and 1.08 ha in two smaller fragments (300 ha). In Virginia, territory sizes ranged from about 0.8 to 2 ha; for nearly all territories considered individually, configuration (boundaries) and size remained nearly constant over the 14-year study. With few exceptions, the same male returned to and occupied a given territory for as long as he lived, although returning females did shift from year to year (McDonald, unpubl. data). Territorial in winter (Stiles and Skutch 1989, Mabey and Morton 1992). Individuals commonly return to the same winter territory in successive years (Rappole and Warner 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs are laid mainly in May-June. Clutch size is 3-6 (usually 4-5). Incubation lasts 12-13 days, by female. Young are tended by both parents, leave nest at 8-10 days (before they can fly), fed by adults for up to 17 days more. Typically one brood, but sometimes two (Harrison 1975). A first clutch size of 4.12 eggs with 1-2 broods per year and a reproductive effort of 6.18 was reported by Whitcomb et al. (1981) in Maryland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oporornis formosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACNTAATTTTCGGTGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAANGTAGTTGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTTCTCCCACCATCATTCCTCCTACTCCTAGCATCCTCCACAGTTGAAGCAGGGGTCGGTACCGGTTGAACAGTATACCCCCCATTAGCTGGTAACCTAGCCCACGCTGGAGCCTCAGTCGACCTTGCAATCTTCTCCTTACACCTAGCAGGTATTTCCTCAATCCTTGGAGCAATCAACTTCATCACAACAGCAATCAACATGAAACCCCCTGCCCTCTCACAATACCAAACCCCACTATTCGTTTGATCAGTACTAATCACTGCAGTCCTCTTACTCCTCTCCCTTCCAGTCCTAGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTAAACACTACATTCTTCGACCCTGCTGGAGGAGGAGACCCAGTCCTATATCAACATCTCTTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oporornis formosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5