Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Geothlypis formosa

A medium-sized (5 ½ inches) wood warbler, the Kentucky Warbler is most easily identified by its olive-green back, yellow breast and throat, black eye-stripes, and yellow eye-rings. Other field marks include a short tail, pale legs, and thin bill. Male and female Kentucky Warblers are similar to one another in all seasons. The Kentucky Warbler breeds in the eastern and southeastern United States from New York south to northern Florida and west to Oklahoma. This species is a long-distance migrant, wintering from central Mexico south to northern South America. Despite this species’ small size, Kentucky Warblers cross the Gulf of Mexico twice a year while on migration, and are occasionally reported resting on ships in the Gulf. Kentucky Warblers breed in thick deciduous forests with large amounts of undergrowth, particularly those near water. In winter, this species inhabits humid tropical forests with similar quantities of undergrowth to those forests used during the summer. Kentucky Warblers eat small invertebrates, including beetles, caterpillars, and spiders. Due to this species’ preference for heavily vegetated habitats, Kentucky Warblers are much more easily heard than seen. Birdwatchers may listen for this species’ “churry-churry-churry-churry” song, or may attempt to observe it foraging for insects deep in the undergrowth. Kentucky Warblers are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations, but breeds in a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: from southeastern Nebraska, east across central Iowa, southwestern Wisconsin, northeastern Illinois, central Indiana, north-central Ohio, southern Pennsylvania, northern New Jersey, and southeastern New York, to southwestern Connecticut, south to Texas, Gulf Coast to northwestern Florida, central Georgia, and South Carolina, and west to eastern Kansas and central Oklahoma (AOU 1983). NON-BREEDING: tropical zones of southern Veracruz and Oaxaca, through Chiapas, the base of the Yucatan Peninsula, primarily on the Caribbean slope of northern Central America, throughout Costa Rica and Panama, and into northern Colombia and northwestern Venezuela (AOU 1983, McDonald 1998). Uncommon transient through the West Indies; some may overwinter on eastern and southern West Indies islands (McDonald 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

E US; winters Mexico to nw South America.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 13 cm

Weight: 14 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults are easily distinguished from other species. Nests are like those of the golden-winged warbler (VERMIVORA CHRYSOPTERA), but unlike many ground-nesting birds, the Kentucky warbler usually builds a nest slightly above ground level (Harrison 1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Oporornis formosus
Catalog Number: USNM 137220
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male;
Preparation: Skin: Whole
Collector(s): W. Todd
Year Collected: 1893
Locality: Vanport, 1.5 mi Down Ohio River From, Near Mouth of Four-Mile Run, Beaver, Pennsylvania, United States, North America
  • Type: Oberholser. September 23, 1974. Bird Life Of Texas. ii: 1001.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Humid deciduous forest (Hamel 1992), dense second growth, swamps. Occurs in stands of various ages but is most common in medium-aged forests (Shugart et al. 1978). Prefers forests with a slightly open canopy, dense understory, and well-developed ground cover (Bushman and Therres 1988). Seldom found in conifers. In Virginia, McShea et al. (1995) found that forest type, streams, and the density of deer were significant variables in territory selection, but forest age (within a reasonable span of years) and the presence of a habitat boundary did not contribute significantly. Specifically, warblers selected cove hardwoods and avoided oak/hickory overstory. The avoidance of oak/hickory overstory is surprising, since a nonquantified gestalt impression of distribution at this site would at first suggest they prefer oak/hickory. Areas with streams and low white-tailed deer (ODOCOILEUS VIRGINIANUS) density also were selected.

NON-BREEDING: In migration, habitats include forest, woodland, scrub, and thickets. In winter, habitat includes the floor of rain forests; also second growth, forest edge, undergrowth (AOU 1983, Bushman and Therres 1988). This species was found in wet forest (most commonly), moist forest (less commonly), and dry forest (rarely) on the Yucatan Peninsula (Lynch 1992); birds were also captured in mid-successional Acahual habitat. From studies in various Latin American countries, Robbins et al. (1992) concluded that wintering birds are ground foragers that require forest. Some birds were found in early successional habitats, but only an occasional bird was captured in pine woods or agricultural habitats. In Belize, found to prefer broadleaved forest edge and interior habitats (Petit et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in Costa Rica early to mid-September, departs by late April (Stiles and Skutch 1989). Present in South America mostly October-March (Ridgely and Tudor 1989). See also McLaren (1981) and Moore (1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Walks rapidly over ground overturning leaves with bill, searches under sticks and in crevices, leaps up to snatch insect or spider from overhanging leaf or branch (Terres 1980). In winter in Mexico, gleans insects from the undersurfaces of low herbaceous growth typical of dense humid forests; sometimes climbs into low vegetation; uncommonly takes food items from forest floor (Rappole and Warner 1980). Also forages along twigs in low shrubbery (Stiles and Skutch 1989). Regularly attends army ant swarms in Panama (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 to >1,000,000 individuals

Comments: Locally abundant where there is suitable habitat. Breeding Bird Survey data show the Kentucky warbler to be relatively abundant in West Virginia, Arkansas, and Louisiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

POPULATION DENSITY: Published information on densities from breeding bird censuses in the southeastern U.S. between 1947 and 1979 were summarized by Hamel et al. (1982): mean (se) density was 4.8 (0.56) pairs per 40 ha with a range of 1-8.5 pairs per 40 ha. In Missouri, density was 1.82 males per 10 ha in continuous forest, 0.91-1.29 per 10 ha in isolated forest fragments (Wenny et al. 1993). Wenny et al. (1993) studied two forest fragments, one smaller (300 ha) and one larger (> 800 ha) in Missouri. Kentucky warblers were found to have significantly higher densities in the larger forest area than in both fragments. In the largest contiguously forested site (> 800 ha), the estimated total population size was 243 birds with 98 breeding pairs. Gibbs and Faaborg (1990) found an average 2.2 males per 10 ha in larger forest tracts compared with 1.4 males per 10 ha in smaller fragments. Whitcomb et al. (1981) reported a territorial density of 36 males per sq km in Maryland. In Virginia, densities of 30-55 pairs were observed over the years 1988-1997 in the 1200 ha core area of suitable habitat at the study site (McDonald 1998). Winter density was up to 5.5 birds per 10 ha in Panama, around 30 per 10 ha in Veracruz, Mexico (Mabey and Morton 1992).

TERRITORY SIZE: Territory sizes were found to differ significantly between forest tracts of different size by Wenny et al. (1993): territories averaged 0.8 ha in a large forest (> 800 ha) and 1.08 ha in two smaller fragments (300 ha). In Virginia, territory sizes ranged from about 0.8 to 2 ha; for nearly all territories considered individually, configuration (boundaries) and size remained nearly constant over the 14-year study. With few exceptions, the same male returned to and occupied a given territory for as long as he lived, although returning females did shift from year to year (McDonald, unpubl. data). Territorial in winter (Stiles and Skutch 1989, Mabey and Morton 1992). Individuals commonly return to the same winter territory in successive years (Rappole and Warner 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Eggs are laid mainly in May-June. Clutch size is 3-6 (usually 4-5). Incubation lasts 12-13 days, by female. Young are tended by both parents, leave nest at 8-10 days (before they can fly), fed by adults for up to 17 days more. Typically one brood, but sometimes two (Harrison 1975). A first clutch size of 4.12 eggs with 1-2 broods per year and a reproductive effort of 6.18 was reported by Whitcomb et al. (1981) in Maryland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oporornis formosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACNTAATTTTCGGTGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAANGTAGTTGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTTCTCCCACCATCATTCCTCCTACTCCTAGCATCCTCCACAGTTGAAGCAGGGGTCGGTACCGGTTGAACAGTATACCCCCCATTAGCTGGTAACCTAGCCCACGCTGGAGCCTCAGTCGACCTTGCAATCTTCTCCTTACACCTAGCAGGTATTTCCTCAATCCTTGGAGCAATCAACTTCATCACAACAGCAATCAACATGAAACCCCCTGCCCTCTCACAATACCAAACCCCACTATTCGTTTGATCAGTACTAATCACTGCAGTCCTCTTACTCCTCTCCCTTCCAGTCCTAGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTAAACACTACATTCTTCGACCCTGCTGGAGGAGGAGACCCAGTCCTATATCAACATCTCTTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oporornis formosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1B - Critically Imperiled

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large breeding range in the eastern (mainly southeastern) U.S. but declining in recent decades, due most likely to loss and fragmentation of breeding and/or winter habitat.

Other Considerations: Heritage Program ranks are as follows: S1 (critically imperiled in state because of extreme rarity, fewer than six occurrences) in no state; S2 (imperiled in state because of rarity, 6-20 occurrences) in Connecticut, New York, and Wisconsin; S3 (rare or uncommon in state, 21-100 occurrences) in Kansas and Nebraska; S4 (apparently secure in state) in Arkansas, Delaware, Indiana, Louisiana, Missouri, New Jersey, North Carolina, and Pennsylvania; and S5 (demonstrably secure in state and essentially ineradicable under present conditions) in Alabama, Illinois, Kentucky, Georgia, Maryland (may be re-evaluated to S4), Mississippi, Ohio, and West Virginia. A rank of S4S5 is given in Virginia. The species is unranked in Florida, South Carolina, and Tennessee. Some state by state comments follow: ALABAMA: Neotropical migrants in general, including the Kentucky warbler, are perceived to be declining in Alabama. The major threat appears to be habitat loss and fragmentation due to conversion of natural forest to pine plantations; residential development, strip mining, and road construction are also contributing to habitat loss (Bailey, pers. comm.). The Kentucky warbler is a common, breeding, summer resident in Alabama (Imhof 1976). ARKANSAS: A migrant in all regions. Common summer resident chiefly in the highlands and on the Coastal Plain; inhabits moist shrubby forest understory and forest edge (James and Neal 1986). CONNECTICUT: Scattered records for the Kentucky warbler (ranked S2) exist for Connecticut. Suspected breeding in 1962 in central Connecticut; since then it has summered several times but breeding has not been proven (Dawhan and Craig 1976). DELAWARE: Breeds throughout the state and threatened primarily by forest fragmentation and nest predation. Although preferring deciduous forest with dense undergrowth and bottomland swampy areas, the Kentucky warbler in Delaware will perhaps also use forest islands with less dense undergrowth (Heckscher, pers. comm.). ILLINOIS: Not tracked in Illinois, little is known of the Kentucky warbler which is far more common in southern Illinois. Range may have contracted because of forest fragmentation and cowbird parasitism (Kleen, pers. comm.). Considered a very rare spring and summer visitor to northeastern Illinois, at least historically. More recently this species seems to have gained more in numbers in northwestern Illinois than in northeastern Illinois; the population has increased slowly in the north. Considered a dominant species of bottomland woods in the south (Graber at al. 1983). INDIANA: The Kentucky warbler is primarily confined to southern Indiana (94% of counties), is less common in central Indiana (54% of counties), and is rare in the north (33% of counties); statewide this species is found in 64% of counties. According to Breeding Bird Survey data for Indiana, numbers have not changed over the period 1966-1990 (Castrale, pers. comm.). KANSAS: Estimated to be in the 1000s, the Kentucky warbler is found on a number of University preserves, state wildlife areas, and Army Corps reservoir lands. The population seems stable, as does its range. Breeding is confined to the eastern quarter of the state where this warbler is described as an uncommon migrant and local summer resident; it is a rare migrant in the rest of the state. Breeds in hardwood forest east of the Flint Hills. May breed sporadically to eastern Cowley County (Busby, pers. comm.). MARYLAND: In Maryland, the Kentucky warbler may be re-evaluated from S5 to S4 because of regional decline. This is despite the fact that its range has expanded from primarily the Coastal Plain and Piedmont in the 1950s to most of the state today - including the Ridge and Valley, and the Allegheny Plateau Provinces (Davidson, pers. comm.). NEBRASKA: Here the Kentucky warbler is a peripheral species and is ranked S3. It is a rare to uncommon spring and fall migrant in southeastern Nebraska, and a summer resident in the lower part of the Missouri's forested valley. Localized in the Missouri River valley from Sarpy County south in shrubby woodland borders or shady woods, especially in moist ravines and bottomlands. Historically this bird was a regular nester, but no recent records makes its status uncertain. Threatened primarily by habitat altered for agriculture (Clausen, pers. comm.). NEW JERSEY: Status as a breeder in New Jersey is considered stable and there are signs that this species is more common now than earlier in the century. Occurs as a rare to uncommon migrant and breeder with nesting occurring at scattered localities throughout the state. Nests in a band across the state from Salem to Bergen County. New Jersey is at the northern extreme of the Kentucky warbler's U.S. range (Dutko, pers. comm.). NEW YORK: Ranked S2 in New York, the Kentucky warbler has confirmed breeding records in only 18% of 5-km blocks monitored by the state Breeding Bird Atlas. A very uncommon breeder, New York is at the northern-most edge of this species' range. Numbers have apparently increased since the 1950s, but the Kentucky warbler is not as common now as it was a century ago. The fact that this southern warbler is only now reoccupying a breeding range that it held over 100 years ago is often overlooked. In 1973 a pair nested in Suffolk County - the first breeding record for the state since 1942, and the first confirmed nesting on Long Island in history. Since 1973, the Kentucky warbler has been found with increasing regularity on Long Island and at traditional sites in the lower Hudson Valley. The Hudson Valley is where this species is concentrated today (Schneider, pers. comm.). NORTH CAROLINA: In North Carolina this species is considered "uncommon to fairly common". Numbers are probably declining, most likely in response to Neotropical deforestation, timbering in the bottomlands, and the creation of reservoirs. Restoration of the Kentucky warbler population in North Carolina would best be achieved by allowing bottomlands to regenerate and a reduction in the cutting of bottomlands (LeGrand, Jr., pers. comm.). OHIO: Unranked in Ohio, the Kentucky warbler would have a rank of S5. While it is not tracked in the state, it is known that numbers have increased since the 1930s as the Kentucky warbler expands its range northward. Threatened primarily by strip mining, clearcutting, and land development in Ohio. Concentrated in the southern and southeastern parts of the state, this warbler is distributed widely in the woodlands of the Unglaciated Plateau and Illinoian Till Plain regions. Widespread also in counties bordering the glacial boundary, but is scarce and very locally distributed in northeastern and northwestern Ohio (Rice, pers. comm.). PENNSYLVANIA: Not tracked in Pennsylvania, little is known of population trends and/or range expansion. Breeding Bird Atlas records indicate the Kentucky warbler to be confined primarily to southern Pennsylvania, with most birds in the extreme southeastern and southwestern corners. Having expanded their range northward since the early 1960s, this species is now a widespread summer resident in the south. Locally, populations are influenced by overbrowsing of understory plants by white-tailed deer. The species declined along its northern distribution limits during the middle of this century, but in the early 1960s southeastern Kentucky warbler populations began to expand northward (Barton, pers. comm.). RHODE ISLAND: Species known only as accidental during spring migration although it has been considered as a nester given its occurrence in Connecticut; no good evidence in Rhode Island, however (Enser, pers. comm.). VIRGINIA: Relatively common in Virginia, the Kentucky warbler is not tracked in this state either. Threatened primarily by forest fragmentation, especially in northern Virginia. Prefers to inhabit riparian forest (deciduous maple, locust, and oak- hickory), this species will also use bottomland hardwoods in this state. Cowbirds, raccoons, opossums, and deer are the major predators. Large contiguous riparian forest tracts with controlled deer populations (i.e., to ensure a well-developed understory) are required (Mabey, pers. comm.). Victoria McDonald (University of Central Arkansas) is an expert on the Kentucky warbler and continues to study this species in Virginia (see MONIT.PROG). WEST VIRGINIA: A fairly common to uncommon summer resident and an uncommon fall migrant. One of the most characteristic birds of the Western Hills Avifaunal Region, probably nesting in every county west of the mountains (although not confirmed in all of them). East of the mountains the Kentucky warbler is quite uncommon, although there are scattered nesting records from Jefferson, Morgan, and Hampshire County. Perhaps most common in the southern or central hardwoods forests, but also occurring in the oak-hickory and the oak-pine (Sargent, pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: North American Breeding Bird Survey (BBS) data indicate a nonsignificant decline averaging 0.7% per year, 1966-1989 (Droege and Sauer 1990), a significant decline of 1.26% per year during 1966-1988, and a significant decline of 1.95% per year for 1978-1988; there was a significant population decline in central North America, 1966-1988, and a significant decline in eastern North America, 1978-1988 (Sauer and Droege 1992). A nonsignificant decline of 18% occurred between 1966 and 1993 and a significant decline of 20% occurred from 1984 to 1993 (Price et al. 1995). James et al. (1992) reanalyzed BBS data for the southeastern and south-central U.S. over the period 1966-1987 using an alternative analysis designed especially for BBS data. The Kentucky warbler, which was especially numerous in the Cumberland Plateau, shows a peak and then a decline. Elsewhere in the uplands this species has been in general decline, most apparently so in the Ridge and Valley. Increases in the lowlands are offset by decreases in the highlands; as a result, the overall population in the region has been stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Probably adversely affected by forest fragmentation. Whitcomb et al. (1981) reported that populations were only 33% of their maximum potential in forests less than 173 acres (70 ha). Nesting was reported in higher densities at distances approaching 200 ft (61 m) from transmission-line corridors (Kroodsma 1982, Chasko and Gates 1982). Pairing success and territory density were examined in populations occupying small (< 140 ha), isolated forest fragments in an agricultural setting and larger (> 500 ha), contiguous forest tracts in central Missouri by Gibbs and Faaborg (1990). Densities did not differ between fragmented (2.1 males per 10 ha) and contiguous sites (1.9 males per 10 ha), and the proportion of paired and unpaired males was identical between the two forest types. Gibbs and Faaborg (1990) suggested two reasons for the lack of sensitivity to forest area. First, the fact that breeding occurs in heavily vegetated creek-bottoms where nests are inconspicuous may alleviate predation pressure. Second, food (herb and shrub invertebrates) is unlikely to be affected by the increased local evaporation rates and decreased soil and litter moisture levels associated with forest area reduction. Loss of tropical forests may also contribute significantly to the regional declines that have been observed in temperate North America. Some declines parallel deforestation in the tropics, and habitat fragmentation on the breeding grounds cannot account completely for these declines. 1980). According to Bent (1953), a common victim of the brown-headed cowbird (MOLOTHRUS ATER); in parts of Pennsylvania, historical records cite the warbler as the commonest victim of the cowbird. More recently, Robinson (1992) documented brood parasitism by cowbirds, although his data, as well as McDonald's in Virginia, indicate that ground-nesters appear to be less susceptible than shrub-nesting species. Of six nests in central Illinois, two were parasitized with an average 0.8 cowbird eggs per nest and an average 3.0 cowbird eggs per parasitized nest (Robinson 1992). In total, three warblers and one cowbird were raised; in no cases were warblers and cowbirds raised together at the Illinois site. At McDonald's Virginia site, the intensity of cowbird parasitism over 14 years has varied annually from 0% to about 15% of the known nests and fledged families. No correlates have been identified, however, to account for this variation (McDonald, unpubl. data). Unlike the Illinois study, in Virginia warblers and cowbirds were raised and fledged together successfully, with no species-specific survival differences. Predation on nests is probably more common than usually realized because the parents simply start re-nesting within a week unless the nest was destroyed very late in the season (McDonald, unpubl. data). Bent (1953) stated that snakes and other prowling predators have been known to rob nests. At McDonald's site in Virginia, about one-fourth of the nests were depredated before fledging. Indirect evidence, including disturbance of the nest cup, and the results of experiments at the same site on artificial nests, suggest that the major predators at this site are small mammals (e.g., eastern chipmunk [TAMIAS STRIATUS]) and medium-sized mammals (raccoon [PROCYON LOTOR], skunk [MEPHITIS MEPHITIS], and opossum [DIDELPHIS VIRGINIANA]). It is not unlikely that snakes and corvids also prey on these nests (McDonald, unpubl. data). The only documented cases of predation on adults include a bizarre report of one being captured and consumed by a box turtle (TERRAPENE CAROLINA) and McDonald's finding remains of a banded female at her nest of four 7-day-old nestlings, also mostly consumed. A medium-sized mammalian predator, such as a raccoon or opossum, common at the Virginia site, were suspected in the latter predation event.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: Currently not in need of restoration or recovery. Should the species continue to decline, restoration and recovery seems highly plausible if the correct habitat is provided. Controlling deer populations seems key to developing the dense understories required by this species. Where the species is of most concern (e.g., Connecticut, New York, and Wisconsin), it is on the northern periphery of its range and never has been a common breeder.

Preserve Selection and Design Considerations: Relatively little has been published about the specific habitat and minimum area requirements of this species. It seems reasonable that preserves should be no smaller than 500 ha, and as with most similar species, the larger the better to reduce rates of cowbird parasitism and nest predation. Data from on-going research and a paper in review, both based on a long-term study site in Virginia, however, are available. This study and other observations suggest that preserves must be in deciduous forest with an abundant hardwood understory layer, of about 40-80 years old. Bottomland hardwood forests with little or no slope are favored, and conifer must be avoided. Deer numbers should be controlled (McShea et al. 1995).

Breeding occurs most often in large tracts of forest but may nest in forest patches as small as a few hectares if habitat conditions are suitable. Lynch and Whigham (1982) found that stand size was the most important forest characteristic determining presence in upland forests on Maryland's Coastal Plain. Estimates of minimum area requirements vary. Robbins (1979, 1980) estimated the minimum forest area required to sustain a viable breeding population at 80-125 acres (32-50 ha). Blake and Karr (1984) found warblers breeding in forest islands as small as 6 acres (2.5 ha) in Illinois. Anderson and Robbins (1981) detected breeding in woodlots as small as 20-47 acres (8-19 ha), but found the highest frequency of occurrence in forests 325-4250 acres (130-700 ha). Wenny et al. (1993) found warblers in Missouri to be significantly more abundant in large forest tracts (> 800 ha) compared with two 300-ha fragments; this species was present, but not breeding, on a 340-ha forest fragment, which suggests that forests larger than 300 ha are required (cf. Hayden et al. 1985, and earlier references). Gibbs and Faaborg (1990) did not find differences in densities between fragmented (9-140 ha; 2.1 males per 10 ha) and contiguous (> 500 ha; 1.9 males per 10 ha) sites in central Missouri. Furthermore, the proportion of paired and unpaired males was identical for all forest types. In general, suggested to be less area-sensitive than other ground-nesting Neotropical migrant warblers such as ovenbirds (SEIURUS AUROCAPILLUS) (Blake 1983, Hayden et al. 1985, Gibbs 1988).

Management Requirements: Among six species that clearly need management and/or monitoring attention in the Coastal Plain of the southeastern U.S. (Hunter, unpubl. data). Bushman and Therres (1988) provided the following management guidelines. Forest management practices that encourage a dense understory and well-developed ground cover should enhance forest stands for this species. Because these birds are tolerant of openings in the canopy, harvesting techniques such as group selection, small or narrow clearcuts, thinning of "overmature" trees, and selection cutting are acceptable practices (Crawford et al. 1981). Light timber stand improvement should also be acceptable. Whereas Whitcomb et al. (1977) suggested that this warbler should benefit from selective logging, Adams and Barrett (1976) reported a decline after such practices in Indiana. Clearcutting temporarily removes habitat, but regenerating forest may be reoccupied after a few years. For example, Conner and Adkisson (1975) found birds breeding in a seven-year-old clearcut in Virginia.

Management Research Needs: Research priorities on the breeding grounds should be assessment of minimum area requirements and quantification of specific habitat requirements, especially of nest sites, as related to breeding success. In addition, research is needed on determining minimum viable population sizes and the impacts of forest fragmentation (including its effect on predation and cowbird parasitism). On the wintering grounds, similarly, quantification of specific habitat requirements and minimum area requirements should be a top priority. Habitat requirements for the birds in migration should also be addressed.

McDonald's data from banding records during the breeding season have shown that plumage characters, particularly the relative blackness of the crown, is not as reliable a sexing criterion as previously reported (e.g., Bent 1953, Pyle et al. 1987). The accumulation and publication of sex- and age-specific plumage and morphometric data should aid in any research and management requiring information on relative numbers of males and females, including studies on wintering and migratory stop-over grounds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Probably there are at least several protected occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Primarily a southeastern bird, has shown signs of expanding northward and can now be found at scattered northern localities in Connecticut, New York, and Wisconsin. Prefers rich, moist deciduous forests; bottomland hardwoods and woods near streams are ideal as long as they have a dense hardwood understory. Being a ground-nester, requires well-developed ground cover, and a thick understory is essential. Because of this key requirement, preserve managers should promote dense low vegetation by controlling deer populations. Studies of forest fragmentation in Missouri indicate that preserves should be at least 500 ha in size, and preferably larger. Contiguous forest is ideal since rates of brood parasitism by cowbirds and nest predation by raccoons, jays, opossums, etc., will be lower. In probable global decline; this decline may be more drastic in some regions (e.g., Ridge and Valley, Blue Ridge Mountains, Cumberland Plateau) than in others (e.g., Mississippi Alluvial Plain, Upper Coastal Plain). Tropical deforestation may be one major factor impacting this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Kentucky Warbler

The Kentucky Warbler (Geothlypis formosa) is a small species of New World warbler. The Kentucky Warbler, is a sluggish and heavy warbler with a short tail, preferring to spend most of its time on or near the ground, except when singing.

Adult Kentucky Warblers are about 13 cm (5 to 6 inches) long. They are mostly an olive-green in color on their back and nape, and a brilliant yellow below from their throat to their belly. They have a small tinge of black on their crown, and a large black mask with a yellow pattern that runs from the beak and encircles the eyes, resembling a pair of spectacles. Female Kentucky warblers have slightly less black on the sides of their head, and immature birds may have almost no black at all.

The Kentucky Warbler is a very common bird with a large range, frequenting moist deciduous forests. It is migratory, spending summer in the central and eastern United States, often ranging as far north as Wisconsin to Pennsylvania. Come fall and winter the Kentucky warbler will migrate back to the Yucatán Peninsula and the many islands of the Caribbean, flying non-stop across the Gulf of Mexico.

Kentucky Warblers nest on the ground hidden at the base of a shrub or in a patch of weeds in an area of ample vegetation. The female will lay between 3 to 6 eggs, which are white or cream-colored and specked with brown. Incubation is done by the female only, and lasts for about 12 days. The young Kentucky Warblers usually leave the nest about 10 days after hatching.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Phylogenetic analyses of sequences of mitochondrial and nuclear DNA (Escalante et al. 2009, Lovette et al. 2010) indicate that several species often placed in Oporornis (tolmiei, philadelphia, and formosa) are more closely related to Geothlypis species than to Oporornis sensu stricto (cf. Lowery and Monroe 1968).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!