Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Geographic Range

Dendroica palmarum breeds in the boreal forests of North America. This species breeds from northern Canada south through the northern United States. It is also classified as a neotropical migrant. On the East Coast, this species winters regularly from southern Delaware south through Florida and along the Gulf Coast through southern Texas. This species also winters throughout the West Indies, along the Yucatan Peninsula through Belize, and along coastal Honduras (Dunn and Garrett 1997; Wilson 1996).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: southwestern Mackenzie to northern Saskatchewan and Labrador, south to central Alberta, northeastern Minnesota, central Michigan, southern Ontario, Maine, and Nova Scotia. NON-BREEDING: north-central Texas, Gulf Coast, and South Carolina south to southern Texas, southern Florida; common in Bahamas and Cuba (rare in eastern Greater Antilles); also on islands off Caribbean coasts of Mexico and Central America and rarely on adjacent mainland. Found in very small numbers along coast of Oregon (Gilligan et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dendroica palmarum are average sized wood warblers (12.5 to 14.5 cm of length). In their basic plumage they present grayish-brown to olive-brown upperparts and yellowish to off-whitish underparts. Their have a long pale supercilium and bright lemony-yellow undertail-coverts. They present blurry brown streaking on breast and flanks and pale wing-bars. While in alternate plumage they present a rufous crown. Legs are blackish, eyes are small and black, and their bills are short and pointy, varying in color from black to pale.

There are two subspecies: 1) Yellow Palm Warbler in the east and 2) Western Palm Warbler. The Yellow Palm Warbler has underparts that are entirely yellow in all plumages. Western Palm Warbler only have deep yellow color in their undertail-coverts and throat, contrasting with a whitish or slightly yellow breast and belly. Sexes are very similar in both subspecies, and are often indistinguishable in the field (Pyle 1997; Wilson 1996).

Range mass: 9.65 to 10.63 g.

Range length: 12.5 to 14.5 cm.

Average basal metabolic rate: 0.1554 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 14 cm

Weight: 10 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

On the breeding grounds, Palm Warblers prefer open bogs with a wooded border of spruces and tamaracks. The bog cover is preferably Sphagnum moss, sedges, or other damp ground plants. On the wintering grounds, Palm Warblers prefer a variety of habitats including open and weedy fields, forest edges, second-growth, thickets, savannas, and mangroves (Dunn and Garrett 1997; Wilson 1996).

Habitat Regions: temperate

Terrestrial Biomes: taiga

Wetlands: bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Bogs, open boreal coniferous forest, partly open situations with scattered trees and heavy undergrowth, usually near water. Nests in open tamarack-spruce bog or on barrens, on ground in hummock of moss or lichens, at base of small spruce, fir, birch, sometimes to 60 cm up in crotch of small conifer (Terres 1980). NON-BREEDING: in migration and winter typically on ground in open areas in various woodland, second growth, and thicket habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Most winter specimens are from mid-October to late March; spends less time on wintering grounds than do most common West Indian migrant warblers. Arrives in Puerto Rico about November, departs by about April (Raffaele 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

On the breeding grounds, Palm Warblers are mainly insectivorous, taking food from the ground, from shrubs and scattered trees in the territory, and in the air by means of sallying from the ground or from a perch. In open areas, the majority of insects are caught from the ground or from low shrubs. Common insect prey include: grasshoppers (Odonata), beetles (Coleoptera), true files (Diptera), true bugs (Hemiptera), butterflies and moths(Lepidoptera) and wasp, bee and ant larvae (Hymenoptera). During the fall and winter, Palm Warblers feast on seeds, insects, and berries, including bayberries, in addition to nectar from century plants, sea grapes, hawthorns, and tiger claw trees (Wilson 1996).

Palm Warblers are diurnal visual foragers. Prey is captured by gleaning from leaves and cones, on the ground, and by hawking. Palm Warblers actively forage by flitting from branch to branch, as well as to the ground pursuing flying insects. Foraging methods are described as opportunistic, often switching between predation and nectivory.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit; nectar

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats insects, also small fruits; forages on ground and among twigs and cones of conifers on nesting grounds (Terres 1980). In Jamaica in winter, feeds primarily on ground in short grass in open areas (Lack 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Palm Warblers have very important roles in their boreal bog habitat. One of their most important roles in the ecosystem is by controling insect populations through feeding (Wilson 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Gray Jays, Short-tailed Weasels and Garter Snakes have been reported as possible nest predators of Palm Warblers

(Wilson 1996).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Dendroica palmarum is prey of:
Thamnophis
Accipiter striatus
Accipiter cooperii
Falco columbarius
Mustela erminea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Dendroica palmarum preys on:
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

The oldest recorded age for Palm Warbler is 6 years 7 months. There is no data on life span and survivorship.

Some body parasites found on Palm Warblers include ticks, mites, and Hippoboscid flies, which may affect their lifespan (Wilson 1996).

Average lifespan

Status: wild:
79 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Palm warblers are monogamous. However, there are two examples of bigamous males, where a second female was sometimes noted on territory. Pair formation in Palm Warblers begins shortly after arrival on breeding grounds, from late April until mid-May, where the male sings frequently upon arrival on breeding grounds.

Mating System: monogamous

Nest-building apparently begins in early to mid-May. The nest is usually located in Sphagnum of peat bog at the base of a small conifer on the ground. Site characteristics include nests closely located to the margins of heath bogs with scattered tall trees and small saplings, in addition to very dense shrub cover. The nest itself is cup-shaped and is comprised of weed stalks, grass and sedges, shreds of bark, rootlets, woody stems of Labrador tea, and bracken fern.

Breeding season: May through July

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average time to hatching: 12 days.

Average eggs per season: 4.

Palm Warbler is known to produce only 1 clutch/season which consists of 4 to 5 eggs. Egg dates are from mid-May to late June, mid-July. The incubation period for this species is 12 days. During incubation, the male feeds the incubating female. Both parents feed the young in the nest and through fledging after 12 days of age (Wilson 1996).

Upon hatching, Palm Warblers are altricial and don't leave the nest for nearly a couple weeks. From juvenal plumage, Palm Warblers molt into their first basic plumage from July through September before winter sets in (Wilson 1996).

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs laid May-June. Clutch size 4-5. Incubation 12 days. Young tended by both parents, leave nest at 12 days but cannot fly for several days (young hide in herbage).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroica palmarum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBIR1321-09|EU815667|Dendroica palmarum| AACCGATGATTATTCTCAACCAACCACAAAGACATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTA---AGCCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCTCTTCTGGGAGAC---GACCAAGTTTACAACGTAGTTGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCGATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATA---ATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTACTCCCACCATCATTCCTTCTCCTCCTAGCATCCTCCACAGTTGAAGCAGGCGTAGGTACAGGCTGAACAGTGTACCCTCCACTAGCTGGCAACCTAGCCCATGCCGGAGCCTCAGTCGACCTC---GCAATCTTCTCTTTACACCTAGCCGGTATCTCCTCAATCCTCGGAGCAATCAACTTCATCACAACGGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACTCCACTATTCGTCTGATCAGTCCTAATCACTGCAGTCCTCCTACTCCTCTCCCTTCCAGTCCTAGCTGCA---GGAATCACAATGCTCCTCACAGATCGCAACCTCAACACCACATTCTTCGACCCTGCCGGAGGAGGAGACCCAGTCCTATACCAACATCTTTTCTGATTCTTCGGTCATCCAGAAGTCTACATCCTAATCCTCCCAGGATTTGGAATCATCTCCCACGTCGTAACATACTATGCAGGCAAAAAA---GAACCATTCGGCTACATAGGAATAGTATGAGCCATGCTATCCATTGGATTCCTAGGCTTTATTGTCTGAGCCCACCACATATTTACAGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendroica palmarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Species: 16
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Palm Warblers are tolerant of human activity, occurring in winter in residential areas.

One threat to Palm Warbler is the presence of TV towers and other tall structures. Palm Warbler is one of the most common victims to illuminated TV towers.

There seems to be no suggestion of degradation of habitat except for some evidence of bog drainage and peat-harvesting which may harm habitat (Wilson 1996).

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N4B,N5N : N4B: Apparently Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Only known beneficial aspect of this species to humans is that Palm Warblers eat insects, thus may control the insect populations (Wilson 1996).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Palm Warbler

Western subspecies

The Palm Warbler, Dendroica palmarum, is a small songbird of the New World warbler family.

The species comprises two distinct subspecies that may merit specific status.

"Yellow Palm-Warbler" (D. p. hypochrysea) of the eastern third of the breeding range has brownish-olive upper parts and thoroughly yellow underparts with bold rufous breast and flank streaking. It migrates later in the fall than its western counterpart.

"Western Palm-Warbler" (D. p. palmarum) inhabits the remaining western two-thirds of the breeding range. It has much less yellow below, with less colorful streaking, and cold grayish-brown upper parts.

Palm Warblers breed in open coniferous bogs and edge east of the Continental Divide, across Canada and the northeastern United States. Their nests take the form of an open cup, usually situated on or near the ground in an open area.

These birds migrate to the southeastern United States, the Yucatán Peninsula, islands of the Caribbean, and eastern Nicaragua south to Panama to winter.[2] They are one of the earlier migrants to return to their breeding grounds in the spring, often completing their migration almost two months before most other warblers.

Palm Warblers forage on the ground much more than other warblers, sometimes flying to catch insects. These birds mainly eat insects and berries.

The song of this bird is a monotonous buzzy, trill. The call is a sharp chek.

Kirtland's, Prairie, and Palm Warblers are the only Dendroica species that incessantly bob their tails.

Contents

Status and distribution

Vagrancy

Palm Warbler has been recorded as a vagrant to Iceland.[3]

References

  1. ^ BirdLife International (2004). Dendroica palmarum. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006. Database entry includes justification for why this species is of least concern
  2. ^ "Palm Warbler". All About Birds. Cornell Laboratory of Ornithology. http://www.birds.cornell.edu/AllAboutBirds/BirdGuide/Palm_Warbler.html. Retrieved 2008-10-12. 
  3. ^ Þráinsson, Gunnlaugur (1997) Palm Warbler and Cerulean Warbler in Iceland - new to the Western Palearctic Birding World 10(10): 392-393


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!