Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Biology

Arriving first at the breeding site, the males return to their usual nest site and begin to sing immediately, defending their territory. Later, the females arrive to mate, selecting a male for the season based on his singing voice. The nest is constructed on the ground between young jack pines in late May, in time for egg-laying between late May and mid June. From three to six eggs are incubated by the female for 14 days, during which time the male brings food to his partner. After hatching, both parents tend to the chicks, each tending to only half the brood, which disperse just 9 or 10 days later (4). Kirtland's warbler feeds mainly on flying insects, although it also consumes pine needles, grasses and blueberries (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This large warbler has a bright yellow breast and underside with black streaking on the sides. The male has a blue-grey back and the female is similar but paler, with a browner back. The black eye is encircled by a white ring that is broken to the left and right by black. The pointed beak is black, as are the legs. Juveniles are pale yellow and brown, but streaked with grey, with spots of grey on the throat. This species calls with a persistent 'chip-chip-che-way-o' (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Dendroica kirtlandii breeds in north and central Michigan, with small numbers (and occasional breeding) in Michigan's Upper Peninsula and Wisconsin, USA. Breeding was also recorded in Canada in 2007 for the first time since 194517. Breeding habitat has declined by 33% since the 1960s, but is more extensive than the 18 km2 occupied in 19949. It has a very small winter range in the Bahamas and the Turks and Caicos Islands (to UK), either concentrated in the northern islands or spread throughout the Bahama Archipelago5,12. There were major declines in c.1900-1920 and 1961-19715, with the population just 167 singing males in 1974 and 19872. Numbers have recovered to 1,478 singing males in Michigan in 2006, the highest since surveys began in 19517,16.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Kirland's Warbler breeds in northern central Michigan, in an area that is about 100 miles long and 60 miles wide. It is also a neotropical migrant, spending the winter in the Bahamas.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs (regularly, as a native taxon) in multiple nations, but breeds in a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (5000-20,000 square km (about 2000-8000 square miles)) Breeding range is almost exclusively in the northern Lower Peninsula of Michigan, with relatively few nesting or summer records in Minnesota, Wisconsin, southern Ontario, and Quebec. In winter, the species occurs in the Bahama Islands, including Grand Bahama, Abaco, Berry Islands, Andros, New Providence, Eleuthera, Cat Island, San Salvador, Green Cay, and others; Caicos Islands (Mayfield 1996); Dominican Republic (Faanes and Haney 1989); and rarely elsewhere (Brewer et al. 1991). Migration sightings indicate fairly direct route between Michigan and the Bahamas (Mayfield 1992, 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (principally MI), Canada, West Indies_Bahama Islands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Kirtland's warbler breeds mainly in north and central Michigan, but singing males have also been recorded in Ontario and Quebec, Canada. They spend the winter in a small area of the Bahamas, as well as on the Turks and Caicos Islands (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Average mass: 15.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 15 cm

Weight: 14 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

In fall and winter, in dorsal view, resembles yellow-rumped warbler but lacks yellow rump.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Optimal breeding habitat is fire-maintained homogeneous stands of 2-4 m tall jack pines Pinus banksiana on sandy soil8,11. Eggs are laid in May-June3. Wintering habitat is either primarily Caribbean pine P. caribbaea5, or natural and secondary scrub, and saline/upland ecotone12. Birds move from patch to patch in the wintering grounds as food supplies are depleted and areas dry out, eventually concentrating in small patches where they maintain small and overlapping home ranges15.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Kirtland's warbler nests in groves of young Jack pines (Pinus banksiana) ranging in height from 5 to 18 feet. They also seek out areas with ground cover composed of blueberries, bearberry, or sweetfern. These warblers also require a very specific soil type, the Grayling Sands, which is important because they nest on the ground and their nests would be flooded if rain water did not drain away quickly. For this reason, nearly 90% of these birds breed in the drainage area of a single stream.

Their winter habitat in the the Bahamas consists of low scrub. During the night they retreat to higher shrubs to roost.

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nesting habitat consists of nearly homogeneous fire-generated stands of usually 30 hectares or more of dense scrubby jack pine, 1.3-6 meters high (6-22 years old) (also reported as 2-4 meters tall and 8-20 years old) interspersed with many small openings, minimal ground cover, and little or no hardwoods, typically in areas of Grayling sand soils and level or gently rolling topography (Mayfield 1960, 1992; Walkinshaw 1983). Habitat tends to be suitable only for periods of about 10-15 years. When trees reach 3.5 meters or more in height, with no live needles present below about 1.0 meters, habitat becomes increasingly unfavorable and populations decline (Brewer et al. 1991). Habitat tracts of less than 30 hectares are sledom used for nesting (Mayfield 1993). Nests are on the ground, well concealed under arching plants near the bases of pines. In winter, Kirtland's warbler occurs mainly in low broadleaf scrub, including transient early successional habitats dominated by Lantana, generally in habitat patches of 2-3 hectares or larger (Miller and Conroy 1990, Mayfield 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The very specific habitat requirements of this species are the main cause of its threatened status. Despite nesting on the ground, Kirtland's warbler will only nest amongst 9 – 13 year old jack pines (Pinus banksiana); taller stands are abandoned for a new site. Ninety percent of these birds nest in the drainage area of a single stream, as they require the well-drained soil type found there, known as Grayling sands. They winter in low scrub, moving to higher shrubs to roost at night (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Enters and leaves U.S. along coasts of North and South Carolina. Arrives on the breeding ground in May. Extreme wintering dates: mid-November to late April; earliest arrivals (young of the year) reach the Bahamas in August, but many (adults) may remain in the nesting range into late September. Many may not pause in migration until at or near destination (Mayfield 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This species feeds primarily on insects; however, it is known to sample an array of other food materials including pine needles, grasses, and bluberries. Food is gathered by gleaning and flycatching on the wing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly insects, also berries (e.g., blueberries) and tree sap; forages on ground, on pine branches and among pine foliage and in scrub oaks, also flycatches (Terres 1980, USFWS 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

2500 - 10,000 individuals

Comments: In 2008, 1,791 singing males were counted in Michigan, up from 1,697 males observed in 2007. This is the highest number of birds recorded since monitoring began in 1951. The 2008 population exceeds the goal for de-listing that was set in the Kirtland's Warbler Recovery Plan. The lowest numbers were recorded in 1974 and 1987, when only 167 singing males were found. For a second consecutive year, singing and mated males were observed outside Michigan; nine birds were heard in Wisconsin and one male with a female was found in Ontario. [Michigan Department of Natual Resources website, October 2008]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Breeding territory encompasses about 12 ha. Possibly affected negatively by periods of drought in the winter range (Mayfield 1993).

Nest predators are thought to include blue jays (Cyanocitta cristata), American crows (Corvus brachyrhynchos), garter snakes (Thamnophis spp.), hognose snakes (Heterodon platyrhinos), thirteen-lined ground squirrels (Spermophilus tridecemlineatus) and red squirrels (Tamiasciurus hudsonicus) (Mayfield 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
108 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild) Observations: Even though sexual maturity may occur earlier, first breeding generally only takes place at age 1. In the wild, these animals live about 2 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Nests are constructed in late May, followed by the laying of eggs in late May to mid-June. The number of eggs per clutch ranges from 3 to 6. In the rare event that a pair has a second clutch, fewer eggs will be laid than in the first. The female incubates the eggs for approximately 14 days before hatching occurs. During the incubation period, defense and care of the nest are predominantly the responsibilty of the female; however, the male will bring food to her. After the eggs hatch, both parents tend to the needs of the altricial young. The young gain weight rapidly during the first five days after hatching, doubling their weight every two days. During the last three days in the nest, their growth rate decreases and their energy is directed towards providing their own body warmth, plumage development,and heightened physical activity. The young leave the nest 9-10 days after hatching. During the fledging period, the brood is divided in half, each parent taking care of select offspring. The post juvenile molt occurs approximately one month after fledging.

Average time to hatching: 14 days.

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males singing ends in early July. Eggs are laid in late May-June (also July for renestings; few after 25 June). Clutch size is 3-5. Incubation lasts 13-15 days, by female. Young are tended by both parents, leave nest at 8-12 days (beginning in mid-June). Common host for brown-headed cowbird, which reduces nesting success. Commonly nests in loose groups of 2-30 pairs separated by substantial distances of similar unoccupied habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroica kirtlandii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBIR1323-09|EU815665|Dendroica kirtlandii| AACCGATGATTATTCTCAACCAACCACAAAGACATCGGGACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTA---AGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGAC---GACCAAGTCTACAATGTAGTTGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCGATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATA---ATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTTCTCCTCCTAGCATCATCCACAGTTGAAGCAGGTGTAGGTACAGGCTGAACAGTGTACCCTCCACTAGCTGGCAACTTAGCCCACGCCGGAGCCTCAGTCGACCTT---GCAATCTTTTCTCTACATCTGGCCGGTATTTCCTCAATCCTAGGGGCAATCAACTTCATTACAACAGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCACTATTTGTCTGATCGGTCCTAATCACTGCAGTCCTCCTACTCCTTTCCCTCCCAGTCCTAGCTGCA---GGGATCACAATGCTCCTTACAGACCGCAACCTCAACACCACATTCTTCGACCCAGCTGGAGGAGGAGATCCCGTCCTATATCAACATCTCTTCTGATTCTTCGGTCATCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATCATCTCTCACGTCGTAACATACTACTCAGGCAAAAAA---GAACCATTCGGTTACATAGGAATGGTATGAGCCATGCTATCTATCGGATTCCTAGGCTTTATTGTCTGAGCCCACCACATATTTACAGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendroica kirtlandii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s
Hilton, G., Rustem, R., Ewert, D.

Justification
Since 1987, conservation action has successfully increased the population of this species. Numbers exceeded 500 singing males in 1994 following doubling of suitably aged habitat between 1987 and 1990. Numbers continue to increase, but its population and range remain small, hence its classification as Near Threatened.

History
  • 2005
    Near Threatened
  • 2004
    Vulnerable
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The Kirtland's Warbler has been the focus of much attention over the last 25 years because of its rarity and need for a very specific habitat. Natural forest fires were the original providers of such habitat, but the advance of white settlers resulted in the clearing of much of Michigan's natural forests. At first, the warbler benefited from such clearing; however, so did the Brown-Headed Cowbird (Molothrus ater). The Cowbird had a major impact on the warbler as a nest parasite. Cowbirds lay their eggs in the nests of other birds and leave the rearing of their young to these hosts. Cowbird young usually develop much faster than the young of the host species and are thus able to out-compete the hosts' young for food resources. Many of the hosts' young die as a result. Recognition of the effects of this phenomena on the Kirtland's Warbler in the early 1970's lead to a program of killing Cowbirds in the warbler's range. This program, coupled with the management of breeding grounds by way of controlled burns, has significantly aided the warbler. However, the Kirtland's Warbler seems to be faced with other problems that effect it during migration or during its time in the Bahamas. As a result, the breeding population in Michigan has not changed significantly recently from spring to spring.

US Migratory Bird Act: protected

US Federal List: endangered

CITES: no special status

State of Michigan List: endangered

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NHB - Possibly Extirpated

United States

Rounded National Status Rank: N1B - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: Breeding is limited mainly to a small area in Michigan; since 1990, population has steadily increased and now includes nearly 1,800 singing males; species depends on active management to maintain habitat and reduce impact of brown-headed cowbird.

Further review of GRANK is needed; NatureServe Rank Calculator Version 6.11 yielded a rank of G3.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/11/1967
Lead Region:   Great Lakes-Big Rivers Region (Region 3) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Dendroica kirtlandii , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Kirtland's warbler is classified as Near Threatened on the IUCN Red List 2006 (1) and is listed on Appendix I of the Convention on Migratory Species (CMS or Bonn Convention) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Assuming equal sex ratio, the global population is likely to number c. 3,000 individuals based on 1,478 singing males recorded during surveys in 2006. Until better data are available this is precautionarily interpreted here as 2,500 mature individuals.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: The population has steadily increased over the past 10 years or three generations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
If scrub is the preferred winter habitat, key threats are fire suppression and brood-parasitism by Brown-headed Cowbirds Molothrus ater in Michigan12. If Caribbean pine is preferred, habitat loss on the wintering ground is probably more important5. The latter is considered likely because of the failure to occupy all breeding habitat, and changes in population have occurred contemporaneously with the degradation and recovery of the north Bahamas pine ecosystem5. Recently however the four-fold population increase between 1990 and 2000, coincident with a tripling of the available habitat through management, would appear to indicate that currently population levels are closely linked to habitat availability14. Consequentially, the current breeding range is too large for fire to affect the whole population rapidly.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: For many years Kirtland's warbler was detrimentally affected by habitat loss and degradation due to a reduction in fires and forestry practices (replacement of jack pines with red pines or hardwoods). The species requires a highly specialized and successionally transitory nesting habitat. Forest fires maintained this habitat. Human prevention and control of forest fires and alternate land uses decreased the amount of already scarce habitat (Mayfield 1992). Due to previous problems with prescribed burns and the proximity of private property, there was not an adequate amount of habitat created in the past. Management actions have essentially eliminated this threat by creating a favorable extent of productive nesting habitat on a sustained basis.

The wintering habitats appear to be secure, at least for the present time (Mayfield 1992, 1996). In the late 1990s, a partnership including U.S. and Bahamas agencies and NGOs was formed to identify and protect habitats within the Bahamas that are used by wintering songbirds, including the Kirtland's warbler. Protection includes the development of pine islands and controlling the impact of feral cats.

Brood parasitism by the brown-headed cowbird (Molothrus ater), which moved into northern Michigan with forest clearing and agricultural expansion, formerly posed a serious threat. In the presence of cowbirds, about 1/3 of all nests are abandoned (in their absence only 1/10 are deserted). Cowbirds remove eggs and kill warbler nestlings (Mayfield 1992). Ongoing trapping of cowbirds in warbler nesting areas has substantially reduced the impact of cowbirds and resulted in much improved warbler reproductive success.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species is heavily dependent on an extremely specialised and limited habitat which was originally maintained through regular, natural forest fires, providing a constant supply of young jack pines. However, white human settlers cleared much of this habitat and reduced the likelihood of forest fires. Initially, Kirtland's warbler benefited from this action, but the brood-parasitic brown-headed cowbird (Molothrus ater) also thrived. The brown-headed cowbird lays an egg in the nest of Kirtland's warbler, removing one of the warbler's eggs, and tricking it into raising a cowbird as its own. Compounding this problem, the cowbird chick hatches before the warbler chicks and out-competes them for food. As a consequence, the breeding success of Kirtland's warbler has declined dangerously (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS Appendix I. Management replicating the effects of natural fires has expanded potential breeding habitat to c.516 km2 10,11. Since 1972, a cowbird trapping programme has reduced parasitism from 70% to 3%2. Education and ecotourism initiatives in Michigan include an annual Kirtland's Warbler Festival10. Surveys have been undertaken in the Bahamas, most recently in 19984,5. There is a project in progress to establish the principal wintering habitat6. Virtually the entire population breeds within the 140,000-acre Kirtland's Warbler Management Area which includes the Huron National Forest, the Kirtland's Warbler National Wildlife Refuge and various Michigan state forests.

Conservation Actions Proposed
Ascertain winter habitat requirements. Continue existing initiatives - this will need $1 million per year to maintain it13. Study the effects of management on breeding ecology11. Implement prescribed burning for all breeding habitat11. This is not possible in many areas, where it has been replaced by commercial clearouts, followed by a replant or re-seed13. Increase the area of jack pine - this is difficult to maintain due to the cost, and its future is uncertain because of the loss of the carbon sequestration program13. Investigate more economical cowbird control11.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Habitat should continue to be maintained at different successional stages and managed on a rotational basis. Brown-headed cowbird numbers should be kept low, through management, in breeding areas.

Management Research Needs: Winter range needs to be evaluated for potential threats (Collar et al. 1992).

Biological Research Needs: Better information is needed on winter habitat requirements.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many (13-40) occurrences appropriately protected and managed

Comments: Many areas are managed for the benefit of this species. In Michigan, the total public land specifically set aside for the Kirtland's warbler amounts to more than 150,000 acres (607 square kilometers) (Michigan Department of Natural Resources website, October 2008).

Needs: Protection and suitable management of the wintering habitat is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

To combat the two main threats to this species, habitat loss and brood-parasitism, the nature authorities of Michigan began a cowbird trapping programme in 1972 which was extremely successful, reducing brood-parasitism from 70% to 3%. Habitat management has also been undertaken, resulting in a threefold increase in suitable Kirtland's warbler habitat. The number of Kirtland's warblers is clearly directly linked to available habitat as, following management work, the population quadrupled between 1990 and 2000. Collaborative efforts between the United States and the Bahamas have improved the quality of wintering grounds and led to ongoing surveying. More economical cowbird control is now being investigated. The success of conservation efforts for Kirtland's warbler is well documented and referred to in the conservation community (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The warbler's endangered species status has affected the ability of private landowners to develop property containing warbler habitat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Negligible

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: To mimic the effects of wildfire and ensure the future of this species, the Michigan DNR and its state and federal partners manage the forests through a combination of clearcutting, burning, seeding, and replanting to promote warbler habitat. Approximately 3,000 acres of jack pine trees are planted or seeded annually on state and federal lands, primarily for the purpose of providing habitat for Kirtland's warblers. [Michigan Department of Natural Resources website, October 2008]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Kirtland's Warbler

Kirtland's Warbler (Setophaga kirtlandii) is a small songbird of the New World warbler family (Parulidae), named after Jared P. Kirtland, an Ohio doctor and amateur naturalist. Nearly extinct just 50 years ago, it is well on its way to recovery. It requires large areas (> 160 acres) of dense young jack pine for its breeding habitat. This habitat was historically created by wildfire, but today is primarily created through the harvest of mature jack pine, and planting of jack pine seedlings.[1]

Since the mid-19th century at least it has become a restricted-range endemic species. Almost the entire population spends the spring and summer in the northeastern Lower Peninsula of Michigan and winters in The Bahamas.

Contents

Description

Female

These birds have bluish-brown upper body parts with dark streaks on the back and yellow underparts with streaked flanks. They have thin wing bars, dark legs and a broken white eye ring. Females and juveniles are browner on the back. Like the Palm Warbler and Prairie Warbler, they frequently bob their tails. At 14–15 cm (5.5–5.9 in) and 12–16 g (0.42–0.56 oz), it is the largest of the numerous Setophaga warblers.[2] Their song is a loud chip-chip-chip-too-too-weet-weet often sung from the top of a snag (dead tree) or northern pin oak (Quercus ellipsoidalis) clump.

Range and ecology

Their breeding range is in a very limited area in the north of the Lower Peninsula of Michigan. They then come to southern Ontario. In recent years, breeding pairs have been found in the Upper Peninsula of Michigan, Wisconsin, and Ontario likely due to the rapidly expanding population. Breeding habitat is typically large areas (> 160 acres) of dense young jack pine (Pinus banksiana). Kirtland's Warblers occur in greatest numbers in large areas that have been clearcut or where a large wildfire has occurred.[1] The birds leave their breeding habitat between August and October and migrate to The Bahamas and nearby Turks and Caicos Islands; they return to Michigan to breed again in May. In their winter habitat, they have been found primarily in scrub habitat, feeding on wild sage, black torch, and snowberry.[3]

Kirtland's Warbler found in northern Ohio on May 14, 2010, on the shores of Lake Erie where migrant warblers stop before crossing into Ontario. Kirtland's occasionally appear at this location in spring, where they are considered accidentals.

Kirtland's Warblers forage in the lower parts of trees, sometimes hovering or searching on the ground. These birds eat insects and some berries, also eating fruit in winter. For breeding they require stands of young (4 to 20 year old, 2–4 m high) Jack Pine trees. They nest on the ground. Their nest is usually at the base of a tree, next to a down log or other structure, and is well concealed by sedge, grasses, blueberries and other ground vegetation.

Habitat

This Lower Peninsula Jack Pine stand was still a bit young in 2002, but by 2008 made good breeding habitat. By 2015–2020, the mature trees would form a forest nearly 20 m high and Kirtland's Warblers would not want to breed there anymore.

Ecology of Jack Pine

Jack Pines are somewhat smallish pine widespread from the Canadian tundra and taiga to the Great Lakes region and the Atlantic Ocean; they are a boreal species, only occurring in a certain climate.[4] Their cones open only after trees have been cleared away by forest fires or, after logging, in the summer sun. About all of its present-day range was covered by solid ice as late as 10 000 to 15 000 years ago; the range of the pine (and as it seems the warbler also) was probably a contiguous swath between the Appalachian Mountains and the Great Plains. The pine's peculiar reproductive strategy fits well with a dry taiga or cool temperate habitat as would have predominated there, probably with a higher incidence of forest fires than today, as the ice age climate was somewhat drier overall.[5]

Decline to near-extinction

As global climate changed out of the ice age through the last 10 millennia or so, Jack Pine, and consequently also Kirtland's Warbler, shifted their habitat north. As the Kirtland's Warbler—and Parulidae in general—is not able to expand into subarctic climate well, most Jack Pine woods are too far north for the species. Moreover, the Great Lakes, which formed before the receding ice, were an obstacle for its spread. Kirtland's Warbler found itself blocked by the expanse of water, while the cold-hardy Jack Pine expanded its range as far as the Northwest Territories.

With European settlement of North America progressing in earnest, much of the forest in the southern Great Lakes region was cut away, never to be restocked. Kirtland's Warbler became trapped on the Northern Peninsula. It may or may not have occurred in Dr. Kirtland's home state of Ohio in recent times, but if it did it would seem to have been extirpated from the state around the time when its namesake himself died in 1877. What habitat there might have been was cleared away in the latter half of the 19th century, and certainly the bird was not breeding there anymore in 1906.[6] Kirtland's Warblers used to breed in Ontario but have not done so since the 1940s. By the mid twentieth century its numbers had crashed to near-extinction. The Kirtland's Warbler population reached lows of probably less than 500 individuals around the 1970s, and in 1994 only 18 km² of suitable breeding habitat was available.[7]

Recovery

Today this bird's habitat is being preserved by controlled or prescribed burns and staggered timber harvests in its limited breeding range. Since this habitat management regime was begun in the 1970s, the birds' numbers have steadily risen, though they are still at dangerously low levels. People have also intervened to protect this bird against nest parasitism by Brown-headed Cowbirds, to which these birds are highly susceptible.

They have still been observed in Ontario and the Upper Peninsula of Michigan, and though it is still only rarely recorded in NW Ohio (where there is hardly any significant woodland left), the numbers of recorded birds are increasing.[8] Beginning in 2005, a small number have been observed in Wisconsin. In 2007, three Kirtland's Warbler nests were discovered in central Wisconsin[9] and one at CFB Petawawa,[10] providing an auspicious sign that they are recovering and expanding their range once again.

The Kirtland's Warbler is listed as "endangered" under the Endangered Species Act of 1973.[11] Although there seem to be no more than 5,000 Kirtland's Warblers as of late 2007,[12] four years earlier they had numbered just 2500–3000. On the IUCN "Red List of Threatened Species," the Kirtland's Warbler was classified as Vulnerable to extinction since 1994, but was downlisted to Near Threatened in 2005 due to its encouraging recovery. It is not clear to what extent the birds depend on Bahamas pine during winter; deforestation on the wintering grounds may eventually become a bigger threat to the birds' recovery than the situation in its breeding range.[7]

The Michigan Department of Natural Resources has recently made optimistic reports about the populations of Kirtland's Warblers.[13]

Recent reports indicate that the population is growing, but also suggest that the Kirtland Warbler may continue to be dependent upon human protection and intervention forever.[14]

There is a Kirtland's Warbler Wildlife Festival, which is sponsored in part by Kirtland Community College (which is named in honor of the bird and its habitat).[15]

See also

Bibliography

Footnotes

References

Further reading

Theses

  • Bocetti CI. Ph.D. (1994). Density, demography, and mating success of Kirtland's warblers in managed and natural habitats. The Ohio State University, United States -- Ohio.
  • Deloria CM. M.S. (2000). Kirtland's warbler (Dendroica kirtlandii) diet and its relationship to warbler age, sex, and jack pine stand characteristics. Michigan State University, United States -- Michigan.
  • Smith EL. M.S. (1979). ANALYSIS OF KIRTLAND'S WARBLER BREEDING HABITAT IN OGEMAW AND ROSCOMMON COUNTIES, MICHIGAN. Michigan State University, United States -- Michigan.

Articles

  • Anderson WL & Storer RW. (1976). Factors Influencing Kirtlands Warbler Nesting Success. Jack Pine Warbler. vol 54, no 3. pp. 105–115.
  • Anonymous. (2004). Lights out policy saves migrating birds. Biodiversity. vol 5, no 3. pp. 38–39.
  • Anonymous. (2005). 100 Years ago in the American ornithologists' union. Auk. vol 122, no 3. pp. 1024–1025.
  • Bart J, Kepler C, Sykes P & Bocetti C. (1999). Evaluation of mist-net sampling as an index to productivity in Kirtland's Warblers. Auk. vol 116, no 4. pp. 1147–1151.
  • Berger AJ. (1968). Appendicular Myology of Kirtlands Warbler. Auk. vol 85, no 4. pp. 594–616.
  • Berger AJ. (1968). Behavior of Hand Raised Kirtlands Warblers Dendroica-Kirtlandii. Living Bird. vol 7, pp. 103–116.
  • Bocetti CI. (1993). Hatching year Kirtland's warbler captured in unusual habitat. Wilson Bulletin. vol 105, no 3. pp. 532–533.
  • Botkin DB, Woodby DA & Nisbet RA. (1991). KIRTLANDS WARBLER HABITATS - A POSSIBLE EARLY INDICATOR OF CLIMATIC WARMING. Biological Conservation. vol 56, no 1. pp. 63–78.
  • Botkin DB, Woodby DA & Nisbet RA. (1991). Kirtland's Warbler Habitats a Possible Early Indicator of Climatic Warming. Biological Conservation. vol 56, no 1. pp. 63–78.
  • Brewer AD. (1990). Additions to the Bird List of Wellington County Ontario Canada. Ontario Birds. vol 8, no 3. pp. 87–91.
  • Brewer R & Morris KR. (1984). Cross-Fostering as a Management Tool for the Kirtlands Warbler Dendroica-Kirtlandii. Journal of Wildlife Management. vol 48, no 3. pp. 1041–1045.
  • Buech RR. (1980). Vegetation of a Kirtlands Warbler Dendroica-Kirtlandii Breeding Area and 10 Nest Sites. Jack Pine Warbler. vol 58, no 2. pp. 59–72.
  • Burgoyne GEJ & Ryel LA. (1978). Kirtlands Warbler Dendroica-Kirtlandii Numbers and Colonies 1977. Jack Pine Warbler. vol 56, no 4. pp. 185–190.
  • Clench MH. (1973). The Fall Migration Route of Kirtlands Warbler. Wilson Bulletin. vol 85, no 4. pp. 417–428.
  • Currie D, Wunderle JM, Ewert DN, Anderson MR, Davis A & Turner J. (2005). Habitat distribution of birds wintering in Central Andros, The Bahamas: Implications for management. Caribbean Journal of Science. vol 41, no 1. pp. 75–87.
  • Currie D, Wunderle JM, Jr., Ewert DN, Davis A & McKenzie Z. (2005). Winter avian distribution and relative abundance in six terrestrial habitats on southern Eleuthera, The Bahamas. Caribbean Journal of Science. vol 41, no 1. pp. 88–100.
  • Currie D, Wunderle Jr JM & Ewert DN. (2006). The response of wintering Kirtland's Warblers to food patch dynamics in The Bahamas and its implications for conservation on the wintering grounds. Journal of Ornithology. pp. 98–99.
  • Dalton R. (2005). Ornithology: A wing and a prayer. Nature. vol 437, no 7056. pp. 188–190.
  • De Groot KL & Smith JNM. (2001). Community-wide impacts of a generalist brood parasite, the Brown-headed Cowbird (Molothrus ater). Ecology. vol 82, no 3. pp. 868–881.
  • Deloria-Sheffield CM, Millenbah KF, Bocetti CI, Sykes PW, Jr. & Kepler CB. (2001). Kirtland's Warbler diet as determined through fecal analysis. Wilson Bulletin. vol 113, no 4. pp. 384–387.
  • Dennis B, Munholland PL & Scott JM. (1991). Estimation of Growth and Extinction Parameters for Endangered Species. Ecological Monographs. vol 61, no 2. pp. 115–144.
  • Dow DD. (1978). A Test of Significance for Mayfields Method of Calculating Nest Success. Wilson Bulletin. vol 90, no 2. pp. 291–295.
  • Ellison K, Sykes PW, Jr. & Bocetti CI. (2002). Re-evaluating the Bay-breasted Warbler breeding range: Nine years of presence in Lower Michigan. Wilson Bulletin. vol 114, no 3. pp. 415–416.
  • Faanes CA & Haney JC. (1989). First Record of Kirtland's Warbler from the Dominican Republic West Indies and Additional Bird Observations. Caribbean Journal of Science. vol 25, no 1-2. pp. 30–35.
  • Fitzmaurice RL & Case DJ. (1995). Making communications work for wildlife conservation: A Kirtland's warbler case study. Wildlife Society Bulletin. vol 23, no 4. pp. 796–798.
  • Frank MC. (1998). Kirtland's Warbler (Dendroica kirtlandi). The Auk. vol 115, no 4. p. 1096.
  • Haney JC, Lee DS & Walsh-Mcgehee M. (1998). A quantitative analysis of winter distribution and habitats of Kirtland's warblers in the Bahamas. Condor. vol 100, no 2. pp. 201–217.
  • Hayes JP, Probst JR & Rakstad D. (1986). Effect of Mating Status and Time of Day on Kirtland's Warbler Dendroica-Kirtlandii Song Rates. Condor. vol 88, no 3. pp. 386–388.
  • Houseman GR & Anderson RC. (2002). Effects of jack pine plantation management on barrens flora and potential Kirtland's warbler nest habitat. Restoration Ecology. vol 10, no 1. pp. 27–36.
  • Hundley MH. (1967). Recent Wintering Records of the Kirtlands Warbler. Auk. vol 84, no 3. pp. 425–426.
  • Hunter MLJ. (1992). Paleoecology Landscape Ecology and Conservation of Neotropical Migrant Passerines in Boreal Forests. In Hagan, J M Iii and D W Johnston (Ed) Ecology and Conservation of Neotropical Migrant Landbirds; Symposium, Woods Hole, Massachusetts, USA, December 6–9, 1989 Xiii+609p Smithsonian Institution Press: Washington, DC, USA; London, England, Uk Illus Maps 511-523, 1992.
  • Kappes PJ & Stutchbury BJM. (2005). Brooding behavior in an adult male American Redstart. Northeastern Naturalist. vol 12, no 1. pp. 119–121.
  • Kashian DM & Barnes BV. (2000). Landscape influence on the spatial and temporal distribution of the Kirtland's warbler at the Bald Hill burn, northern Lower Michigan, U.S.A. Canadian Journal of Forest Research. vol 30, no 12. pp. 1895–1904.
  • Kashian DM, Barnes BV & Walker WS. (2003). Ecological species groups of landform-level ecosystems dominated by jack pine in northern Lower Michigan, USA. Plant Ecology. vol 166, no 1. pp. 75–91.
  • Kashian DM, Barnes BV & Walker WS. (2003). Landscape ecosystems of northern Lower Michigan and the occurrence and management of the Kirtland's warbler. Forest Science. vol 49, no 1. pp. 140–159.
  • Kelly ST & Decapta ME. (1982). Cowbird Molothrus-Ater Control and Its Effect on Kirtlands Warbler Dendroica-Kirtlandii Reproductive Success. Wilson Bulletin. vol 94, no 3. pp. 363–365.
  • Kepler CB, Irvine GW, Decapita ME & Weinrich J. (1996). The conservation management of Kirtland's warbler Dendroica kirtlandii. Bird Conservation International. vol 6, no 1. pp. 11–22.
  • King TL, Eackles MS, Henderson AP, Bocetti CI, Currie D & Wunderle JM. (2005). Microsatellite DNA markers for delineating population structure and kinship among the endangered Kirtland's warbler (Dendroica kirtlandii). Molecular Ecology Notes. vol 5, no 3. pp. 569–571.
  • Latta SC & Parkes KC. (2001). A possible Dendroica kirtlandii hybrid from hispaniola. Wilson Bulletin. vol 113, no 4. pp. 378–383.
  • Levy S. (2004). Native incursions: Avian range expansions imperil threatened species. Bioscience. vol 54, no 2. pp. 94–98.
  • Lovette IJ & Hochachka WM. (2006). Simultaneous effects of phylogenetic niche conservatism and competition on avian community structure. Ecology. p. S) S14-S28, JUL 2006.
  • Marshall E, Haight R & Homans FR. (1998). Incorporating environmental uncertainty into species management decisions: Kirtland's Warbler habitat management as a case study. Conservation Biology. vol 12, no 5. pp. 975–985.
  • Marshall E, Homans F & Haight R. (2000). Exploring strategies for improving the cost effectiveness of endangered species management: The Kirtland's Warbler as a case study. Land Econ. vol 76, no 3. pp. 462–473.
  • Mayfield HF. (1972). 3rd Decennial Census of Kirtlands Warbler. Auk. vol 89, no 2.
  • Mayfield HF. (1972). Winter Habitat of Kirtlands Warbler. Wilson Bulletin. vol 84, no 3. pp. 347–349.
  • Mayfield HF. (1973). Census of Kirtlands Warbler in 1972. Auk. vol 90, no 3. pp. 684–685.
  • Mayfield HF. (1973). Kirtlands Warbler Census 1973. American Birds. vol 27, no 6. pp. 950–952.
  • Mayfield HF. (1975). The Numbers of Kirtlands Warblers. Jack Pine Warbler. vol 53, no 2. pp. 39–47.
  • Mayfield HF. (1983). Kirtlands Warbler Dendroica-Kirtlandii Victim of Its Own Rarity. Auk. vol 100, no 4. pp. 974–976.
  • Mayfield HF. (1988). Where Were Kirtland's Warblers During the Last Ice Age. Wilson Bulletin. vol 100, no 4. pp. 659–660.
  • Mayfield HF. (1992). Dendroica kirtlandii: Kirtland's warbler. Birds of North America. vol 0, no 19. pp. 1–15.
  • Mayfield HF. (1993). Kirtland's warblers benefit from large forest tracts. Wilson Bulletin. vol 105, no 2. pp. 351–353.
  • Miller KV & Conroy MJ. (1990). Spot Satellite Imagery for Mapping Kirtland's Warbler Wintering Habitat in the Bahamas West Indies. Wildlife Society Bulletin. vol 18, no 3. pp. 252–257.
  • Mitchell BA & Barborak JR. (1991). DEVELOPING COASTAL PARK SYSTEMS IN THE TROPICS - PLANNING IN THE TURKS-AND-CAICOS-ISLANDS. Coast Manage. vol 19, no 1. pp. 113–134.
  • Nelson MD & Buech RR. (1996). A test of 3 models of Kirtland's warbler habitat suitability. Wildlife Society Bulletin. vol 24, no 1. pp. 89–97.
  • O'Grady JJ, Brook BW, Reed DH, Ballou JD, Tonkyn DW & Frankham R. (2006). Realistic levels of inbreeding depression strongly affect extinction risk in wild populations. Biological Conservation. vol 133, no 1. pp. 42–51.
  • Orr CD. (1975). 1974 Breeding Success of the Kirtlands Warbler. Jack Pine Warbler. vol 53, no 2. pp. 59–66.
  • Probst JR. (1986). A Review of Factors Limiting the Kirtland's Warbler Dendroica-Kirtlandii on Its Breeding Grounds. American Midland Naturalist. vol 116, no 1. pp. 87–100.
  • Probst JR, Donner DM, Bocetti CI & Sjogren S. (2003). Population increase in Kirtland's warbler and summer range expansion to Wisconsin and Michigan's Upper Peninsula, USA. Oryx. vol 37, no 3. pp. 365–373.
  • Probst JR, Donner DM, Worland M, Weinrich J, Huber P & Ennis KR. (2005). Comparing census methods for the endangered Kirtland's Warbler. Journal of Field Ornithology. vol 76, no 1. pp. 50–60.
  • Probst JR & Donnerwright D. (2003). Fire and shade effects on ground cover structure in Kirtland's warbler habitat. American Midland Naturalist. vol 149, no 2. pp. 320–334.
  • Probst JR & Hayes JP. (1987). Pairing Success of Kirtland's Warblers in Marginal Vs. Suitable Habitat. Auk. vol 104, no 2. pp. 234–241.
  • Probst JR & Weinrich J. (1993). Relating Kirtland's warbler population to changing landscape composition and structure. Landscape Ecology. vol 8, no 4. pp. 257–271.
  • Radabaugh BE. (1972). Polygamy in the Kirtlands Warbler. Jack Pine Warbler. vol 50, no 2. pp. 48–52.
  • Radabaugh BE. (1974). Kirtlands Warbler and Its Bahama Wintering Grounds. Wilson Bulletin. vol 86, no 4. pp. 374–383.
  • Radamaker K & Radamaker C. (2002). A recent record of the kirtland's warbler in Florida. Florida Field Naturalist. vol 30, no 3. pp. 94–96.
  • Rothstein SI & Robinson SK. (1994). Conservation and coevolutionary implications of brood parasitism by cowbirds (The Ecology and Management of Cowbirds Austin, Texas, USA November 1993). Trends in Ecology & Evolution. vol 9, no 5. pp. 162–164.
  • Ryel LA. (1976). The 1975 Census of Kirtlands Warblers. Jack Pine Warbler. vol 54, no 1. pp. 2–6.
  • Ryel LA. (1979). Population Dynamics of Kirtlands Warbler. Jack Pine Warbler. vol 57, no 2. pp. 76–84.
  • Ryel LA. (1981). The 4th Decennial Census of Kirtlands Warblers Dendroica-Kirtlandii 1981. Jack Pine Warbler. vol 59, no 3. pp. 93–95.
  • Ryel LA. (1981). Population Change in the Kirtlands Warbler Dendroica-Kirtlandii. Jack Pine Warbler. vol 59, no 3. pp. 76–91.
  • Schempf PF. (1976). A Late Record of the Kirtlands Warbler. Jack Pine Warbler. vol 54, no 1.
  • Shake WF & Mattsson JP. (1975). 3 Years of Cowbird Control an Effort to Save the Kirtlands Warbler. Jack Pine Warbler. vol 53, no 2. pp. 48–53.
  • Solomon BD. (1998). Impending recovery of Kirtland's Warbler: Case study in the effectiveness of the Endangered Species Act. Environmental Management. vol 22, no 1. pp. 9–17.
  • Sykes PW, Jr., Bocetti CI & Moore LA. (1993). Male Kirtland's warbler with incubation patch. Wilson Bulletin. vol 105, no 2. pp. 354–356.
  • Sykes PW, Jr. & Clench MH. (1998). Winter habitat of Kirtland's Warbler: An endangered nearctic/neotropical migrant. Wilson Bulletin. vol 110, no 2. pp. 244–261.
  • Sykes PWJ. (1985). Construction of Portable Net Poles and Transport Containers. North American Bird Bander. vol 10, no 4. pp. 115–116.
  • Sykes PWJ, Carpenter JW, Holzman S & Geissler PH. (1990). Evaluation of Three Miniature Radio Transmitter Attachment Methods for Small Passerines. Wildlife Society Bulletin. vol 18, no 1. pp. 41–48.
  • Sykes PWJ, Kepler CB, Jett DA & Decapita ME. (1989). Kirtland's Warblers on the Nesting Grounds During the Post-Breeding Period. Wilson Bulletin. vol 101, no 4. pp. 545–558.
  • Tessen DD. (1977). The Nesting Season June 1-July 31 1977 Western Great Lakes Region. American Birds. vol 31, no 6. pp. 1142–1146.
  • Walker WS, Barnes BV & Kashian DM. (2003). Landscape ecosystems of the Mack Lake burn, northern Lower Michigan, and the occurrence of the Kirtland's warbler. Forest Science. vol 49, no 1. pp. 119–139.
  • Walkinshaw LH. (1972). Kirtlands Warbler Endangered. American Birds. vol 26, no 1. pp. 3–9.
  • Walkinshaw LH. (1977). History of a Female Kirtlands Warbler and Her Descendants. Jack Pine Warbler. vol 55, no 2. pp. 63–68.
  • Walkinshaw LH & Faust WR. (1974). Some Aspects of Kirtlands Warbler Breeding Biology. Jack Pine Warbler. vol 52, no 2. pp. 65–75.
  • Walkinshaw LH & Faust WR. (1975). 1974 Kirtlands Warbler Nesting Success in Northern Crawford County Michigan. Jack Pine Warbler. vol 53, no 2. pp. 54–58.
  • Walkinshaw LR. (1976). A Kirtlands Warbler Life History. American Birds. vol 30, no 3.
  • Walkinshaw LW. (1976). Kirtlands Warbler and Blackpoll Warbler Banding Recoveries. Jack Pine Warbler. vol 54, no 2. pp. 92–93.
  • Zoon FC, Troelstra SR & Maas PWT. (1993). Ecology of the plant-feeding nematode fauna associated with sea buckthorn (Hippophae rhamnoides ssp. rhamnoides) in different stages of dune succession. Fundamental & Applied Nematology. vol 16, no 3. pp. 247–258.
  • Zou X, Theiss C & Barnes BV. (1992). Pattern of Kirtland's Warbler Occurrence in Relation to the Landscape Structure of Its Summer Habitat in Northern Lower Michigan. Landscape Ecology. vol 6, no 4. pp. 221–231.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!