Overview

Comprehensive Description

Male nominate race has eyebrow and moustachial streak white, crown and side of head dusky grey-brown, becoming rufous-brown on mantle, rest of upperparts rufous-chesnut, R dark dusky brown, edges narrowly rusty red, on inner webs and more broadly on outer webs, amount of red on latter increasing inwards until inner S and T entirely rusty red, WC rufous-brown, tail rufous on basal half, blackish on distal half, extent of black vyrying individually, lateral R broadly tipped rufous, throat grey-buff, underparts buff, sometimes with rufous wash, iris dark brown, bill black, pale base, legs pale blue-grey. Female is smaller than male, with crown, ear-coverts and throat paler. Juvenile has paler and less well-defined head markings, with a buff supercilium, creamy moustachial streak, and pale bill.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Subspecies and Distribution:


    * dahli Reichenow, 1897 - Umboi I and New Britain, in Bismarck Archipelago. * antonii E. J. O. Hartert, 1926 - New Ireland.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

13-14.5 cm

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Male nominate race has eyebrow and moustachial streak white, crown and side of head dusky grey-brown, becoming rufous-brown on mantle, rest of upperparts rufous-chesnut, R dark dusky brown, edges narrowly rusty red, on inner webs and more broadly on outer webs, amount of red on latter increasing inwards until inner S and T entirely rusty red, WC rufous-brown, tail rufous on basal half, blackish on distal half, extent of black vyrying individually, lateral R broadly tipped rufous, throat grey-buff, underparts buff, sometimes with rufous wash, iris dark brown, bill black, pale base, legs pale blue-grey. Female is smaller than male, with crown, ear-coverts and throat paler. Juvenile has paler and less well-defined head markings, with a buff supercilium, creamy moustachial streak, and pale bill.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

High-altitude montane forest, lower limits 750 m in Umboi, 530 in New Britain.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Insect.Frequents dense growt from substage to canopy. Prey captured by FC. Joins mixed-species foraging flocks with other small insectivorous species, including Black-tailed Monarch and Golden Whistler.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Adults with fledgling in Dec in NB. No other info.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhipidura dahli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTCATCTTCGGTGCATGAGCCGGAATAGTTGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTGGGACAACCAGGTGCTCTTCTAGGAGACGACCAAATCTACAACGTAGTTGTTACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTTATACCTATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTGCTCCCTCCATCATTCCTGCTCCTACTAGCTTCCTCAACAGTAGAAGCAGGGGTAGGCACAGGATGAACTGTATATCCCCCATTAGCTGGAAACCTAGCCCATGCCGGAGCTTCAGTAGACCTAGCAATCTTTTCACTGCATCTAGCAGGAATCTCCTCTATCCTCGGAGCAATCAACTTCATCACAACAGCAATCAATATAAAACCTCCCGCATTATCACAATATCAAACTCCCCTATTCGTATGATCCGTCCTAATCACTGCAGTCCTACTACTTCTATCACTCCCTGTCCTTGCTGCCGGGATCACTATGCTCCTTACAGACCGTAACCTAAACACTACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTACTGTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhipidura dahli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a restricted range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is reported to be generally scarce and locally common (Coates 1990).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bismarck fantail

The Bismarck fantail (Rhipidura dahli) is a fantail. The binomial commemorates the German naturalist Friedrich Dahl.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!