Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Overview

Distribution

Range

Foothills of n and central India (Western Ghats).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sitta castanea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGCGCATGAGCCGGGATAGTGGGTACCGCCCTAAGTCTCCTTATCCGAGCAGAACTAGGCCAACCAGGAGCCCTCCTGGGAGATGACCAAGTATACAATGTAGTCGTTACAGCCCATGCCTTCGTAATAATCTTCTTTATAGTCATACCAATCATAATCGGAGGATTTGGAAACTGACTAGTCCCTCTAATAATTGGAGCACCTGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGGCTCCTTCCACCATCCTTCCTCCTCCTCCTAGCCTCCTCTACAATCGAAGCGGGGGTGGGAACAGGATGGACCGTGTATCCCCCTCTAGCCGGCAACCTAGCTCACGCCGGAGCCTCAGTCGACCTAGCTATCTTCTCCCTACATCTAGCAGGAATCTCCTCTATTCTAGGAGCAATCAACTTCATCACAACTGCAATCAACATAAAACCACCTGCCCTATCCCAGTATCAAACCCCCCTATTCGTATGATCAGTACTAATCACTGCAGTCCTGCTTCTCCTCTCCCTCCCCGTCCTTGCCGCAGGCATTACCATGCTTCTTACAGACCGTAACCTAAACACTACCTTCTTTGACCCAGCAGGAGGGGGAGACCCAGTCCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sitta castanea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is reported to be common in India and Nepal and locally fairly common to common in Indochina (Harrap and Quinn 1996).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Indian Nuthatch

The Indian nuthatch (Sitta castanea) is a species of bird in the Sittidae family. It is found in India.

Its natural habitats are subtropical or tropical dry forests, subtropical or tropical moist lowland forests, and subtropical or tropical moist montane forests.

This species has been split by Rasmussen and Anderton (2005) from[2] the Chestnut-bellied Nuthatch. The Indian nuthatch (including the older prateri of the Eastern Ghats) is found South of the Ganges river. It is the only grey-backed, rufous-bellied nuthatch in the peninsula. Similar to the next but has a smaller bill and a frosty crown that is paler than the mantle. The wing and tail patterns lack contrast and has grey centres to the chestnut undertail coverts. Resident in the Terai and Gangetic plain extending into Central India, the Eastern Ghats, Sunderbans and a disjunct population in the Western Ghats. Breeds from February to July. Different in vocalization from the next.

References[edit]

  1. ^ BirdLife International (2012). "Sitta castanea". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Rasmussen, P. C. & J. Anderton (2005) The Birds of South Asia:The Ripley Guide. Smithsonian Institution and Lynx Edicions.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!