Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sitta europaea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCAGGCGCCCTCCTGGGAGACGACCAAGTATACAACGTAATCGTTACGGCCCATGCTTTCGTAATAATCTTCTTTATAGTCATACCAATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATCGGAGCACCTGATATAGCATTCCCACGGATAAACAATATAAGCTTCTGACTCCTACCACCCTCTTTCCTCCTCCTCCTAGCTTCCTCTACAATTGAAGCAGGAGTAGGAACAGGATGAACCGTATACCCACCCCTAGCCGGCAACTTAGCCCACGCTGGAGCCTCAGTCGACCTGGCCATCTTCTCCCTCCACTTAGCAGGGATCTCCTCTATTCTAGGAGCAATCAACTTCATCACAACTGCAATTAACATAAAACCACCCGCCCTATCCCAATACCAAACCCCCCTATTCGTATGATCAGTACTAATCACTGCAGTCCTACTCCTCCTATCCCTCCCCGTCCTCGCTGCAGGTATTACCATGCTCCTTACAGACCGCAACCTAAACACTACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTCCTATACCAACACCTATTCTGATTTTTCGGCCACCCTGAAGTGTATATCCTAATCCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sitta europaea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 7500000-19000000 breeding pairs, equating to 22500000-57000000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 45900000-228000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eurasian Nuthatch

The Eurasian Nuthatch (Sitta europaea) is a small passerine found throughout temperate Europe and Asia. It belongs to the nuthatch family Sittidae. This bird is the most common and most widespread nuthatch, and is often referred to just as the Nuthatch.

Behaviour and ecology

Eurasian Nuthatch in winter.
(view high resolution version)

It is a resident bird of deciduous woods and parkland, with some old trees for nesting. It feeds on insects, seeds and nuts. Its old name "nut-hack" derives from its habit of wedging a nut in a crevice in a tree, and then hacking at it with its strong bill.

It has the ability, like other nuthatches, to climb down trees, unlike species such as woodpeckers which can only go upwards. It will come to bird feeding tables and is then very aggressive, driving other species away.

The Eurasian Nuthatch is 14 cm (5.5 in) long and has the typical nuthatch big head, short tail and powerful bill and feet. It is blue-grey above, with a black eyestripe. Asian and north European birds (S. e. asiatica and S. e. europaea respectively) are white below except for chestnut in the vent area. The western European S. e. caesia has generally reddish underparts. Young birds are "washed out" versions of the adults.

Nests are in holes or crevices, lined with bark or grass. The size of the hole's entrance may be reduced by the building of a neat mud wall. Five to eight eggs are laid, white speckled with red.

This is a noisy bird, often located by its repeated tui-tui-tui call.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!