Articles on this page are available in 2 other languages: Chinese (Simplified) (13), Spanish (2) (learn more)

Overview

Brief Summary

Biology

Thanks to their long, pointed beaks, male goldfinches are the only birds that are able to extract seeds from teasel heads; they cling to the stem and tear into the seed head, accessing the seeds inside by probing with the bill (5). Females have shorter beaks and so they are unable to exploit teasel heads (5). In the autumn, when seed heads are common, goldfinches have a broad diet, feeding on groundsels, ragworts and dandelions as well as the favourite teasels and knapweeds (5). Outside of the breeding season, goldfinches roam in flocks in search of food during the day (2). At night they roost in evergreens or thick scrub. Flock size varies depending on the availability of food, but groups of 100 birds are quite common (5). During spring goldfinches often display whilst sitting on branches, singing, drooping the wings and swaying from side to side (6). Between four and six eggs are produced and these take up to 14 days to incubate. The young goldfinches will have fledged after 13-18 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

The goldfinch is a strikingly beautiful bird, with a bright red face, black and white head and a deep golden yellow bar on the otherwise jet-black wings (2). Another notable feature is the long, pointed beak, which allows this species to extract seeds from teasels. Males and females are similar in appearance, although females have shorter beaks (5). Juveniles have greyish-brown streaked heads, lacking the red, white and black pattern of the adults (2). Flocks produce a delightful liquid twittering song and call (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

This finch is found throughout Britain, and is absent only in moorland and mountainous areas where their foodplants do not occur. They occur in the greatest numbers in the south. A large proportion of the goldfinch population migrates in September and October to spend the winter in mainland Europe (5). This species is found throughout much of western Eurasia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 11.811 - 11.811
  Nitrate (umol/L): 6.342 - 6.342
  Salinity (PPS): 34.953 - 34.953
  Oxygen (ml/l): 6.391 - 6.391
  Phosphate (umol/l): 0.377 - 0.377
  Silicate (umol/l): 3.584 - 3.584
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 11.811 - 11.811
  Nitrate (umol/L): 6.342 - 6.342
  Salinity (PPS): 34.953 - 34.953
  Oxygen (ml/l): 6.391 - 6.391
  Phosphate (umol/l): 0.377 - 0.377
  Silicate (umol/l): 3.584 - 3.584
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in mixed woodland, orchards, parks, commons, gardens and pine plantations (2) (3) where there are thistles and other plants that produce seeds (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carduelis carduelis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGCACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGTCAACCCGGGGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATAATTGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCATTCCTTCTTCTGCTAGCATCCTCCACCGTAGAAGCAGGCGTTGGCACAGGTTGAACAGTATACCCCCCACTAGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTTGACTTAGCAATTTTCTCCCTACACTTAGCCGGCATTTCCTCAATCCTAGGGGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCAGTCCTAATCACTGCAGTACTCTTACTCCTTTCCCTCCCAGTCCTTGCTGCAGGAATTACAATGCTTCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTCCTGTACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTATATATCCTCATCCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carduelis carduelis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5