Articles on this page are available in 2 other languages: Chinese (Simplified) (13), Spanish (2) (learn more)

Overview

Brief Summary

Biology

Thanks to their long, pointed beaks, male goldfinches are the only birds that are able to extract seeds from teasel heads; they cling to the stem and tear into the seed head, accessing the seeds inside by probing with the bill (5). Females have shorter beaks and so they are unable to exploit teasel heads (5). In the autumn, when seed heads are common, goldfinches have a broad diet, feeding on groundsels, ragworts and dandelions as well as the favourite teasels and knapweeds (5). Outside of the breeding season, goldfinches roam in flocks in search of food during the day (2). At night they roost in evergreens or thick scrub. Flock size varies depending on the availability of food, but groups of 100 birds are quite common (5). During spring goldfinches often display whilst sitting on branches, singing, drooping the wings and swaying from side to side (6). Between four and six eggs are produced and these take up to 14 days to incubate. The young goldfinches will have fledged after 13-18 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

The goldfinch is a strikingly beautiful bird, with a bright red face, black and white head and a deep golden yellow bar on the otherwise jet-black wings (2). Another notable feature is the long, pointed beak, which allows this species to extract seeds from teasels. Males and females are similar in appearance, although females have shorter beaks (5). Juveniles have greyish-brown streaked heads, lacking the red, white and black pattern of the adults (2). Flocks produce a delightful liquid twittering song and call (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

This finch is found throughout Britain, and is absent only in moorland and mountainous areas where their foodplants do not occur. They occur in the greatest numbers in the south. A large proportion of the goldfinch population migrates in September and October to spend the winter in mainland Europe (5). This species is found throughout much of western Eurasia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 11.811 - 11.811
  Nitrate (umol/L): 6.342 - 6.342
  Salinity (PPS): 34.953 - 34.953
  Oxygen (ml/l): 6.391 - 6.391
  Phosphate (umol/l): 0.377 - 0.377
  Silicate (umol/l): 3.584 - 3.584
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in mixed woodland, orchards, parks, commons, gardens and pine plantations (2) (3) where there are thistles and other plants that produce seeds (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Carduelis carduelis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Carduelis carduelis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGCACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGTCAACCCGGGGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATAATTGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCATTCCTTCTTCTGCTAGCATCCTCCACCGTAGAAGCAGGCGTTGGCACAGGTTGAACAGTATACCCCCCACTAGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTTGACTTAGCAATTTTCTCCCTACACTTAGCCGGCATTTCCTCAATCCTAGGGGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCAGTCCTAATCACTGCAGTACTCTTACTCCTTTCCCTCCCAGTCCTTGCTGCAGGAATTACAATGCTTCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTCCTGTACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTATATATCCTCATCCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident breeder and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

included in the Birds of Conservation Concern Amber List (medium conservation concern) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 12,000,000-29,000,000 breeding pairs, equating to 36,000,000-87,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 73,500,000-348,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This species is not threatened at the present time. The numbers of goldfinches in the UK dropped markedly between the 1970s and 1980s. This is thought to have been caused either by a decline in weed seeds as a result of agricultural intensification, or by increased hunting in the wintering range of the population (4). In the past this species was trapped and kept as a cage bird; in the mid-nineteenth century around 130,000 birds were trapped each year around Worthing, which is on a major migration route. One of the first tasks of the RSPB when it set up in 1904 was to protect this species. Trapping is now completely illegal (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European goldfinch

Gowdie redirects here; not to be confused with Goldie (disambiguation).

The European goldfinch or goldfinch (Carduelis carduelis), is a small passerine bird in the finch family.

Taxonomy and systematics[edit]

The species is divided into two major groups, each comprising several races. The two groups intergrade at their boundary, so the caniceps group is not recognised as a distinct species despite its readily distinguishable plumage.

Carduelis carduelis carduelis group.
Carduelis carduelis caniceps group.

Linnaeus classified the bird as Fringilla carduelis.

The phylogeny has been obtained by Antonio Arnaiz-Villena et al.[2][3][4][5][6][7][8]

Description[edit]

Male and female on a Sunflower, in Tabo, Himachal Pradesh
Male C. c. caniceps, in Jispa, Himachal Pradesh

The average goldfinch is 12–13 cm long with a wingspan of 21–25 cm and a weight of 14 to 19 grams. The sexes are broadly similar, with a red face, black and white head, warm brown upperparts, white underparts with buff flanks and breast patches, and black and yellow wings.

On closer inspection male goldfinches can often be distinguished by a larger, darker red mask that extends just behind the eye. In females, the red face does not reach the eye. The ivory-coloured bill is long and pointed, and the tail is forked. Goldfinches in breeding condition have a white bill, with a greyish or blackish mark at the tip for the rest of the year. Juveniles have a plain head and a greyer back but are unmistakable due to the yellow wing stripe. Birds in central Asia (caniceps group) have a plain grey head behind the red face, lacking the black and white head pattern of European and western Asian birds.[9][10]

In UK

Distribution and habitat[edit]

The goldfinch is native to Europe, North Africa, and western and central Asia. It is found in open, partially wooded lowlands and is a resident in the milder west of its range, but migrates from colder regions. It will also make local movements, even in the west, to escape bad weather. It has been introduced to many areas of the world.[11] It was introduced at numerous places in south-eastern Australia in the 19th century, and their populations quickly increased and their range expanded greatly. They now occur from Brisbane to the Eyre Peninsula.[12]

Behaviour and ecology[edit]

A nest and eggs.

The goldfinch's preferred food is small seeds such as those from thistles (the Latin name is from Carduus, a genus of thistles) and teasels, but insects are also taken when feeding young. It also regularly visits bird feeders in winter. Goldfinches nest in the outer twigs of tall leafy trees, or even in bamboo, laying four to six eggs, which hatch in 11–14 days.

In the winter goldfinches group together to form flocks of up to forty, occasionally more.

The song is a pleasant silvery twittering. The call is a melodic tickeLIT, and the song is a pleasant tinkling medley of trills and twitters, but always including the trisyllabic call phrase or a teLLIT-teLLIT-teLLIT.

In earlier times, the goldfinch was kept as a cagebird for its song. Escapes from captivity and deliberate releases have colonised southeastern Australia and New Zealand.

Goldfinches are attracted to back gardens in Europe and North America by birdfeeders containing niger (commercially described as nyjer) seed. This seed of an annual from South Asia is small, and high in oils. Special polycarbonate feeders with small oval slits at which the goldfinches feed are sometimes used.

Relationships with humans[edit]

Madonna of the Goldfinch by Raphael, c. 1505–6

Goldfinches are commonly kept and bred in captivity around the world because of their distinctive appearance and pleasant song. The goldfinch males are sometimes crossed with Canary females with the intention to produce male mules with beautiful singing voices, that often capture the best singing attributes of both breeds.

Because of the thistle seeds it eats, in Christian symbolism the goldfinch is associated with Christ's Passion and his crown of thorns. The goldfinch, appearing in pictures of the Madonna and Christ child, represents the foreknowledge Jesus and Mary had of the Crucifixion. Examples include the Madonna del cardellino or Madonna of the Goldfinch, painted by the Italian renaissance artist Raphael in about 1505–6, in which John the Baptist offers the goldfinch to Christ in warning of his future. In Barocci's Holy Family a goldfinch is held in the hand of John the Baptist who holds it high out of reach of an interested cat. In Cima da Conegliano's Madonna and Child, a goldfinch flutters in the hand of the Christ child. It is also an emblem of endurance, fruitfulness, and persistence. Because it symbolizes the Passion, the goldfinch is considered a "saviour" bird and may be pictured with the common fly (which represents sin and disease).[13] The goldfinch is also associated with Saint Jerome and appears in some depictions of him.[13]

Antonio Vivaldi composed a Concerto in D major for Flute "Il Gardellino" (RV 428, Op. 10 No. 3), where the singing of the goldfinch is imitated by a flute.

Goldfinches, with their "wanton freak" and "yellow flutterings", are among the many natural "luxuries" that delight the speaker of John Keats's poem 'I stood tip-toe upon a little hill...' (1816).[14]

In the much admired poem The Great Hunger by Patrick Kavanagh the goldfinch is one of the rare glimpses of beauty in the life of an elderly Irish farmer-

a man might imagine.... these birds the birds of paradise.

Donna Tartt's novel The Goldfinch won the 2013 Pulitzer Prize for Fiction.[15][16] A turning point in the plot occurs when the narrator, Theo, sees his mother's favourite painting, Carel Fabritius's The Goldfinch, in the Metropolitan Museum of Art.

References[edit]

  1. ^ BirdLife International (2012). "Carduelis carduelis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Zamora, J; Moscoso J; Ruiz-del-Valle V; Ernesto L; Serrano-Vela JI; Ira-Cachafeiro J; Arnaiz-Villena A (2006). "Conjoint mitochondrial phylogenetic trees for canaries Serinus spp. and goldfinches Carduelis spp. show several specific polytomies". Ardeola 53 (1): 1–17. 
  3. ^ Arnaiz-Villena, Antonio; Alvarez-Tejado M.; Ruiz-del-Valle V.; García-de-la-Torre C.; Varela P; Recio M. J.; Ferre S.; Martinez-Laso J. (1998). "Phylogeny and rapid Northern and Southern Hemisphere speciation of goldfinches during the Miocene and Pliocene Epochs". Cell.Mol.Life.Sci. 54 (9): 1031–41. doi:10.1007/s000180050230. PMID 9791543. 
  4. ^ Arnaiz-Villena, A; Gómez-Prieto P; Ruiz-de-Valle V (2009). "Phylogeography of finches and sparrows". Nova Science Publishers. ISBN 978-1-60741-844-3. 
  5. ^ Zamora, Jorge; Lowy E; Ruiz-del-Valle V; Moscoso J; Serrano-Vela JI; Rivero-de-Aguilar J; Arnaiz-Villena A (2006). "Rhodopechys obsoleta (desert finch): a pale ancestor of greenfinches according to molecular phylogeny". J Ornithol 147 (3): 448–56. doi:10.1007/s10336-005-0036-2. 
  6. ^ Arnaiz-Villena, A.; Moscoso, J.; Ruiz-del-Valle, V.; Gonzalez, J.; Reguera, R.; Wink, M.; Serrano-Vela, J. I. (2007). "Bayesian phylogeny of Fringillidae birds: status of the singular African oriole finch Linurgus olivaceus and evolution and heterogeneity of the genus Carpodacus". Acta Zoologica Sinica 53 (5): 826–834. Retrieved 14 December 2009. 
  7. ^ Arnaiz-Villena, A; Moscoso J; Ruiz-del-Valle V; González J; Reguera R; Ferri A; Wink M; Serrano-Vale JI (2008). "Mitochondrial DNA Phylogenetic Definition of a Group'of "Arid-Zone" Carduelini Finches". The Open Ornithology Journal 1: 1–7. doi:10.2174/1874453200801010001. 
  8. ^ Arnaiz-Villena A, Ruiz-del-Valle V, Moscoso J, Serrano Vela JI, Zamora J. (2007). "mtDNA phylogeography of North American Carduelis pinus group of birds". Ardeola 54: 1–14. Retrieved 20 July 2010. 
  9. ^ Clement, P., Harris, A., & Davis, J. (1993). Finches & Sparrows. Christopher Helm. ISBN 0-7136-8017-2.
  10. ^ Svensson, L. (1992). Identification Guide to European Passerines. ISBN 91-630-1118-2.
  11. ^ Snow, D. W. & Perrins, C. M. (1998). The Birds of the Western Palearctic concise ed. Oxford University Press. ISBN 0-19-854099-X.
  12. ^ "European Goldfinch". Birdlife Australia. Retrieved 27 July 2013. 
  13. ^ a b Werness, Hope B. (2007). Animal Symbolism in World Art. Continuum. ISBN 0-8264-1913-5. 
  14. ^ "2. I Stood tip-toe upon a little hill. Keats, John. 1884. The Poetical Works of John Keats". Bartleby.com. Retrieved 2012-12-27. 
  15. ^ Flood, Alison (13 February 2013). "Donna Tartt to publish first novel for 11 years". The Guardian. Retrieved 10 October 2013. 
  16. ^ The Pulitzer Prizes | Citation
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!