Articles on this page are available in 1 other language: Chinese (Simplified) (12) (learn more)

Overview

Brief Summary

Acanthis flammea

The Common Redpoll is one of a few cold-weather finch species in North America. This finch is about 5 inches long with a plump body, notched tail, and thick bill. Males and females are streaked brown and tan above, and both have a red forehead and black throat. The male’s breast is washed with pink, while the female’s is off-white. Despite its name, the Common Redpoll is common only in the northernmost parts of North America and Eurasia. In North America, this species breeds in Alaska and high arctic Canada, and winters in southern Canada and the northern tier of the United States. In Eurasia, this species breeds in Scandinavia and Russia, wintering south to central Europe and China. Although among the most common species of songbird on its breeding grounds, few birdwatchers visit this species there. Common Redpolls inhabit open areas of tundra, sparse evergreen forest, and scrub. They mainly eat seeds, but will also catch insects when available during the summer. In some years, large numbers of Redpolls will move south during the winter montsh in response to lack of food further north. These finches are best observed foraging for food, when they may be found feeding high in trees, atop small bushes, or on the ground. Redpolls are acrobatic while feeding, often perching precariously on the ends of branches and hanging down to reach seeds or cones This species is most active during the day. .

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Circumpolar in Arctic and Subarctic. BREEDS: in North America, from western and northern Alaska, northern Yukon, east to northern Ontario, Quebec, and Newfoundland. WINTERS: central Alaska, southern nesting range in Canada to northern California, northern Nevada, northern Utah, central Colorado, Kansas, Missouri, Kentucky, South Carolina (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 13 cm

Weight: 13 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

See Czaplak (1995) for information on distinguishing common and hoary redpolls in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Forest, scrub and shrubby areas, and open tundra with bushes or dwarf trees; in migration and winter in open woodland, weedy fields, fence rows and cultivated lands (AOU 1983).

Nests usually in subarctic forest and tundra scrub, in tree or shrub, 1-2 m above ground (Terres 1980). Also in driftwood piles along coast, or on ground often near willow shrub.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Irruptive winter migrant to areas south of Canada. Flocks migrate to northern nesting areas by mid-March (Terres 1980). Arrives in Beaufort Sea area by May (Johnson and Herter 1989). Rare fall vagrant in northwestern Hawaii (Pratt et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats seeds of birches, alders, willows, pines, elms, grasses, etc. Forages in trees or on the ground. Also eats insects during the summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May travel in large flocks in winter.

Weakly territorial (Knox and Lowther 2000); individuals move up to 20 kilometers while foraging during breeding season (Molau 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nests are initiated usually in June in the Beaufort Sea area. Clutch size is 4-5, sometimes up to 7. Incubation, by female, lasts 10-11 days (Terres 1980). Young are tended by both adults, leave nest in 11-16 days. Females have the capacity to double-clutch. Pairs may nest near each other.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Carduelis flammea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Carduelis flammea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTTTACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGCACCGCCCTGAGCCTTCTCATCCGAGCAGAACTAGGTCAACCCGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATAATCGGGGGATTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTCCTTCTGCTAGCATCTTCTACCGTAGAAGCGGGTGTTGGTACAGGTTGAACCGTATACCCCCCACTAGCTGGTAACCTAGCCCACGCCGGAGCCTCAGTCGACCTGGCAATCTTCTCTCTACACCTAGCCGGTATCTCTTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATATCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACTGCAGTACTCCTACTTCTCTCTCTACCAGTTCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTCCTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTATATATTCTCATCCTTCCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common redpoll

The common redpoll (Carduelis flammea) is a species in the finch family. It breeds somewhat further south than the Arctic redpoll, also in habitats with thickets or shrubs. Nominate C. f. flammea (mealy redpoll) breeds across the northern parts of North America and Eurasia. There is also an Icelandic subspecies, Icelandic redpoll (C. f. islandica), and one that breeds in Greenland and Baffin Island called the Greenland redpoll (C. f. rostrata). Together the Iceland and Greenland forms are sometimes known as "northwestern redpolls". All forms migrate south into Canada, northern USA, or Eurasia. These birds are remarkably resistant to cold temperatures[2] and winter movements are mainly driven by the availability of food. There are two distinct populations (one lighter, one darker) united in islandica, the relationships of which are unresolved.[3]

Description[edit]

The common redpoll is a small brownish-grey finch with dark streaks and a bright red patch on its forehead. It has a black bib and two pale stripes on the wings. Males often have their breasts suffused with red. It is smaller, browner and more streaked than the generally similar Arctic redpoll, adults measuring between 11.5 and 14 centimetres (4.5 and 5.5 in) in length and weighing between 12 and 16 grams (0.42 and 0.56 oz). The rump is streaked and there is a broad dark brown streak across the vent. It has brown legs, dark-tipped yellowish bills and dark brown irises.[4]

Similar species[edit]

The mealy redpoll is larger and paler than the lesser redpoll with which it often mixes, apparently without significant interbreeding though sympatry was established too recently to draw firm conclusions.[5] The male mealy redpolls are darker than the similarly sized Arctic redpolls but the females are almost identical.

Behaviour[edit]

The range of the common redpoll extends through northern Europe and Asia to northern North America, Greenland and Iceland. It is a partial migrant, moving southward in late autumn and northward again in March and April. Its typical habitat is boreal forest of pines, spruces and larches. It feeds mainly on seeds, principally birch and alder seed in the winter.[4]

The common redpoll builds its nest low down in a tree or bush. The nest has an outer layer of thin twigs, a middle layer of root fibres, fragments of juniper bark and lichens and an inner layer of down, willow buds and reindeer hair. Three to seven speckled eggs are laid and incubated by the female. They hatch after about eleven days and the young fledge in about a further thirteen days.[4]

References[edit]

  1. ^ BirdLife International (2013). "Carduelis flammea". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ adn.com | Wildlife News : Some birds tougher than winter
  3. ^ Seutin, G.; Ratcliffe, L. M. & Boag, P. T. (1995) Mitochondrial DNA homogeneity in the phenotypically diverse redpoll finch complex (Aves: Carduelinae: Carduelis flammea - hornemanni). Evolution 49(5): 962–973. doi:10.2307/2410418 (HTML abstract and first page image)
  4. ^ a b c "Redpoll: Carduelis flammea". NatureGate. Retrieved 2013-12-13. 
  5. ^ Sangster, George; Knox, Alan G.; Helbig, Andreas J. & Parkin, David T. (2002) Taxonomic recommendations for European birds. Ibis 144(1): 153–159. doi:10.1046/j.0019-1019.2001.00026.x PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Known in Old World literature as the Redpoll. Formerly (AOU 1983, 1998) listed in Carduelis. Acanthis and Spinus were considered separate genera prior to their merger into Carduelis (AOU 1983), in part following Mayr and Short (1970), although they continued to be listed as subgenera. Recent mitochondrial genetic data (Arnaiz-Villena et al. 2008) indicate that Carduelis is polyphyletic and that Acanthis spp., Spinus spp., Carduelis carduelis, and Chloris sinica belong to different clades.

Acanthis flammea and A. hornemanni appear to constitute a superspecies (Mayr and Short 1970). Formerly included Acanthis cabaret [Lesser Redpoll], recently treated as a separate species by Knox et al. (2001).Species limits in the redpolls are complex, with from one to four species recognized (AOU 1998). Seutin et al. (1992, 1993) found that two relatively distinct redpoll forms breed at Churchill, Manitoba, but could not distinguish whether they were specifically distinct or the product of different types of intraspecific genetic or ecophenotypic polymorphisms. Seutin et al. (1995) examined rangewide mtDNA variation in redpolls and found little differentiation among the nominal species and subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!