Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Primary breeding range extends from central California south (west of the Sierra Nevada crest) to northern Baja California and east (at least formerly) to Arizona, with a few nesting records outside this region (Davis 1999); this goldfinch is most numerous in inland valleys and fotthills of southern California. During the breeding season, nonbreeding birds sometimes occur in Arizona and New Mexico (Davis 1999). Winter range generally includes southern California and northern Baja California; in some years, this species occurs in winter in northern and central California, and sometimes it spreads eastward (fall through early spring) into Arizona, southern Nevada, southwestern New Mexico, western Texas, and northern Mexico (Davis 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species breeds in central and southern California and western Arizona, USA, and in northwestern Baja California, Mexico (AOU 1983). Its wintering range extends through and beyond its breeding range, into northern California, central Arizona, southwestern New Mexico and formerly extreme western Texas, USA (AOU 1983), and Sonora and probably Chihuahua in Mexico (Howell and Webb 1995a).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S California and nw Baja; winters to Texas and n Sonora.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 12 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Habitats include oak woodland, chaparral, riparian woodland, pinyon-juniper association, and weedy areas in arid regions, usually near water (AOU 1983). Breeding occurs predominantly in open woodlands of arid and semiarid foothills and valleys, usually near water; from sea level near the coast and in some interior valleys to nearly 2,900 meters in southern California (Davis 1999). Nests are in evergreen oaks, conifers, or deciduous trees, 1-12 meters above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits arid to semi-arid open deciduous pine-oak woodland, oak woodland, chaparral, and pinyon-juniper vegetation, often near water (AOU 1983, Howell and Webb 1995a). The species occurs from sea level to 2,500 m (Howell and Webb 1995a).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Populations breeding north of theTransverse Ranges in southern California generally are migratory, whereas those to the south probably are incompletely and irregularly migratory (Davis 1999). Upslope movements have been noted in fall, especially in drought years (Davis 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet includes mainly seeds, also insects during the breeding season. Foraging birds often are in flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is uncertain. Rich et al. (2004) estimated population size at 150,000. Based on loose extrapolations, Davis (1999) suggested that population size may be less than 200,000. This species varies geographically and temporally from uncommon to fairly common in California (Small 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

This species is highly social; it often forms loose flocks of 20-30 birds. Flocks may include other species of goldfinches or other passerines.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Breeding begins in late March-early April. Female (fed by male) incubates typically 4-5, sometimes 3-6, eggs. Both parents tend young, which leave nest in about 11 days. Pairs may nest singly or in loose colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carduelis lawrencei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCTCCCTAAGCCTTCTCATCCGAGCAGAACTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTATAACGTAGTCGTCACAGCCCATGCTTTCGTCATAATCTTCTTCATAGTTATACCCATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCATCATTCCTCCTCCTACTAGCATCCTCCACCGTAGAAGCAGGTGTTGGCACAGGCTGAACAGTATACCCCCCACTAGCCGGTAACCTAGCCCATGCTGGAGCTTCAGTTGACTTAGCAATCTTCTCCCTACACCTGGCCGGTATCTCTTCAATCCTAGGCGCAATCAACTTCATTACAACAGCAATCAACATAAAACCCCCCGCCCTATCGCAATATCAAACCCCCCTGTTCGTTTGATCAGTCCTAATTACTGCAGTACTCCTACTTCTCTCCCTCCCAGTTCTTGCTGCAGGAATTACAATGCTTCTAACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGGGGAGGTGACCCAGTCCTATACCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTATACATCCTCATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carduelis lawrencei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Modest range extent in southwestern North America, centered in southern California; highly erratic and irregular in distribution and local abundance; estimated population size relatively small for a songbird; trend basically unknown, difficult to detect; likely experiencing habitat loss as a result of intensive land development in some areas, but species benefits from some types of land disturbance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Unknown

Global Long Term Trend: Unknown

Comments: This species is notoriously erratic in its distribtuion and local abundance, so trend detection is very diffiicult (Davis 1999). No significant decline or increase is evident in survey-wide Breeding Bird Survey data for 1968-2007 (species is very infrequently detected). Number of birds per party-hour in the Christmas Bird Count has been highly erratic over the long term and recently.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: No major threats have been identified. Conversion of oak woodland and chaparral to intensive human uses presumably have reduced habitat availability in some areas. Loss of disturbance regimes (i.e., grazing, agriculture, fire) could have a negative impact (Davis 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: At least several occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lawrence's goldfinch

Lawrence's goldfinch, (Spinus lawrencei), is a small songbird of erratic distribution that breeds in California and Baja California and winters in the southwestern United States and northern Mexico.

Description[edit]

At about 4.75 inches (12 cm) long and weighing about 0.4 oz (11.5 g), it is slightly bigger than the lesser goldfinch and slightly smaller than the American goldfinch, with less yellow in the plumage than either. Adults of both sexes are gray with pink to grayish flesh-color bills, stubbier than other goldfinches'. They have yellow rumps and paired yellowish wing-bars, as well as yellow edges on the flight feathers and yellow on the breast. The tail is black, crossed by a white band (Sibley 2000, Oiseaux.net 1996–2007). Plumage is duller in winter, brightening after a spring molt (Davis 2001, Oiseaux.net 1996–2007). Males are paler, with black caps and faces and larger areas of brighter yellow. Females are browner, have less and duller yellow, and lack the black (Sibley 2000, Oiseaux.net 1996–2007). Juveniles resemble females but are even duller and have faint streaks on the upperparts and especially the underparts. (Davis 2001, Oiseaux.net 1996–2007).

Calls include "a nasal too-err, also a sharp, high PIti and Itititi" (Sibley 2000). The flight call, which is diagnostic, is given as "a high, clear ti-too" (Sibley 2000) or tink-ul "reminiscent of glass wind-chimes" (Davis 2001). The song is high-pitched, continuous, and limited in frequency range, including wind-chime notes and especially imitations of other species' calls and other simple and distinctive sounds (Sibley 2000, Davis 2001). Males sing in winter but mostly in the breeding season. Females sing occasionally and briefly (Davis 2001).

Range and habitat[edit]

Lawrence's goldfinch is known for its wandering habits. It breeds from about Shasta County, California to northern Baja California, largely in the Coast Ranges and the foothills of the Sierra Nevada and in the Baja highlands, but also sometimes as far down as the coast; its highest breeding altitude is about 8,800 feet (2,680 m) on Mount Pinos. There are only a few places where it has been observed to nest annually, notably the Carmel Valley and the South Fork Kern River. Choice of areas in its breeding range may depend on climate through the availability of water and preferred foods. Movements to the coast and upslope in the Sierras occur in drought years and movements to the edges of the range and into the Central Valley after wet years, possibly because of an increased food supply. It has bred a few times in Arizona (Davis 2001).

Most, but not always all, birds leave northern, central, and inland southern California in winter. They move into the coastal lowlands and into the lower parts of the southeastern California deserts, ranging irregularly (sometimes in large numbers) southeastward to northern Sonora and northwestern Chihuahua and eastward to the southern half of Arizona, southwestern New Mexico, and even the area of El Paso, Texas (Davis 2001)—roughly the Madrean Sky Islands region. In some winters mysteriously few birds are observed; possibly the birds are in Sonora and Chihuahua, which are poorly covered by naturalists. The greatest eastward irruptions often occur in wet periods and are synchronized with irruptions of other seedeating birds such as the red-breasted nuthatch, the red crossbill, and the other North American goldfinches (Davis 2001).

The typical nesting habitat is dry and open woods that are near both brushy areas and fields of tall annual weeds, usually within half a mile (0.8 km) of a small body of water. It may nest in other habitats, including rural residential areas, but not in deserts or dense forests. Outside the nesting season it occurs in many open habitats including deserts, suburbs, and city parks (Davis 2001).

Behavior[edit]

Diet[edit]

Lawrence's goldfinch feeds almost entirely on seeds of shrubs and forbs. During the nesting season, it eats seeds of annuals, strongly favoring the common fiddleneck. Birders seeking Lawrence's goldfinch are advised to know this plant. At other seasons in California, it predominantly eats chamise achenes and also berries of mistletoe (Phoradendron) and California Buckthorn. In Arizona, it often eats the seeds of amaranths and inkweed (Davis 2001, 1999). It is attracted to niger seed at feeders.

Breeding[edit]

The nesting season is early spring to early summer, or sometimes as late as late July. As in other cardueline finches, pairs form in large pre-breeding flocks. Pairs leave the flocks and search for nest sites, the female taking the lead, often carrying nesting material and making building motions. The male follows, singing and calling. Nest sites may be in any of a number of trees, but early in the season they are often in mistletoe or western sycamore, while later they are in live oaks and especially the deciduous blue oak (Davis 2001, citing Coutlee 1968a).

Nests are usually single but sometimes in loose colonies that may contain over 10 pairs. The female builds the nest while the male follows her on long material-gathering forays or sings from a perch. It is a loosely woven cup in a fork of several small branches, placed about 10 feet (3 m) up near the edge of the tree. There are three to six eggs, unmarked white with a blue or green tinge (Davis 2001).

The female incubates for 12 to 13 days and broods the chicks for four or five days, staying almost constantly on the nest; the male brings food. After the fourth day, the female joins the male in food-gathering trips but still broods at times through the seventh day. The chicks fledge at about 13 or 14 days, and after another 5 to 7 days leave the family to join a pre-migratory flock (Davis 2001).

Flocking[edit]

During the breeding season, males join to form small flocks while females are on the nest. At other times, birds are found in flocks that typically comprise under 50 individuals but are occasionally over 500. Flocks may mix with other small seed-eating species.

Taxonomy[edit]

This species is remarkably homogeneous, with no subspecies, and according to one study, no genetic variation at the 23 loci tested (Davis 2001, citing Marten and Johnson 1986).

Etymology[edit]

This bird's name commemorates the American ornithologist George Newbold Lawrence.

Phylogeny[edit]

It has been obtained by Antonio Arnaiz-Villena et al.[2][3]

Evolution[edit]

This bird is one of the extant parental species of one of the Spinus/Carduelis three evolutive North American radiation. That of tristis (American goldfinch) and psaltria (which has extended itself down to North Peru through the Andean Spine).[4]

References[edit]

  1. ^ BirdLife International (2012). "Carduelis lawrencei". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Arnaiz-Villena, Antonio; Alvarez-Tejado M.; Ruiz-del-Valle V.; García-de-la-Torre C.; Varela P; Recio M. J.; Ferre S.; Martinez-Laso J. (1998). "Phylogeny and rapid Northern and Southern Hemisphere speciation of goldfinches during the Miocene and Pliocene Epochs". Cell.Mol.Life.Sci. 54 (9): 1031–41. doi:10.1007/s000180050230. 
  3. ^ Zamora, J; Moscoso J; Ruiz-del-Valle V; Ernesto L; Serrano-Vela JI; Ira-Cachafeiro J; Arnaiz-Villena A (2006). "Conjoint mitochondrial phylogenetic trees for canaries Serinus spp. and goldfinches Carduelis spp. show several specific polytomies". Ardeola 53: 1–17. 
  4. ^ Arnaiz-Villena, A; Areces C, Rey D, Enríquez-de-Salamanca M, Alonso-Rubio J and Ruiz-del-Valle V (2012). "Three Different North American Siskin/Goldfinch Evolutionary Radia-tions (Genus Carduelis): Pine Siskin Green Morphs and European Siskins in America". The Open Ornithology Journal 5: 73–81. doi:10.2174/1874453201205010073. 

Further reading[edit]

Book[edit]

Davis, J. N. 1999. Lawrence’s Goldfinch (Carduelis lawrencei). In The Birds of North America, No. 480 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.

Articles[edit]

  • Coutlee E. L. (1968a). Comparative breeding behavior of Lesser and Lawrence’s goldfinches. Condor 70 228–242.
  • Coutlee E. L. (1968b). Maintenance behavior of Lesser and Lawrence’s goldfinches. Condor 70 pp. 378–384.
  • Karubian J & Swaddle JP. (2001). Selection on females can create 'larger males'. Proceedings of the Royal Society Biological Sciences Series B 268, no 1468. pp. 725–728.
  • Kaufman K. (1993). Notes on goldfinch identification. American Birds 47, no 1. pp. 159–162.
  • Marten, J. A.; Johnson, N. K. (1986). "Genetic relationships of North American cardueline finches". Condor 88 (4): 409–420. doi:10.2307/1368266. JSTOR 1368266. 
  • Willoughby EJ, Murphy M & Gorton HL. (2002). Molt, plumage abrasion, and color change in Lawrence's Goldfinch. Wilson Bulletin 114, no 3. pp. 380–392.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly (AOU 1983, 1998) listed in Carduelis. Acanthis and Spinus were considered separate genera prior to their merger into Carduelis (AOU 1983), in part following Mayr and Short (1970), although they continued to be listed as subgenera. Recent mitochondrial genetic data (Arnaiz-Villena et al. 2008) indicate that Carduelis is polyphyletic and that Acanthis spp., Spinus spp., Carduelis carduelis, and Chloris sinica belong to different clades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!