Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Spinus tristis

A small (5 inches) finch, the male American Goldfinch in summer is most easily identified by its bright yellow body; black cap, wings, and tail; and conspicuous white rump patch. Female American Goldfinches are duller yellow overall than males, and lack black on the head. In winter, both sexes become duller yellow-brown on the back, head, and breast. The American Goldfinch breeds across much of the United States and southern Canada. In winter, northerly-breeding populations move south, expanding outside of this species’ breeding range into the coastal southeast, the southwest, northern Mexico, and the coast of California and Oregon. Birds breeding in the mid-latitudes migrate short distances, if at all. American Goldfinches breed in a variety of open habitats, including meadows, bushy fields, and (in modern times) urban and suburban yards. This species utilizes similar types of habitat in winter as it does in summer. American Goldfinches primarily eat seeds, including tree seeds and seeds of weedy groundcover plants. In appropriate habitat, American Goldfinches may be seen perched on the stalks of small plants while eating seeds from pods at the top. Goldfinches are also common feeder birds, and may be observed feeding in mixed groups of finches and other small songbirds. American Goldfinches are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Breeding range extends from southern Canada (southern British Columbia east to southwestern Newfoundland) south to southwestern California and northern Baja California, Arizona, New Mexico, extreme northeastern Texas, northern Louisiana, northern Mississippi, central Alabama, central Georgia, and South Carolina (AOU 1998). Winter range extends from southern Canada and the northern United States south to northern Baja California, northern Sonora, New Mexico, Texas, the U.S. Gulf coast, and southern Florida (AOU 1998). See Prescott and Middleton (1990) for information on age and sex differences in winter distribution in eastern North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The breeding range reaches as far north as Saskatchewan and continues across the whole of North America, with the southern limits being North Carolina in the east and northern California in the west. The wintering range extends across the entire continental United States, extending well into Mexico along the Gulf coast.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The breeding range reaches as far north as Saskatchewan and continues across the whole of North America, with the southern limits being North Carolina in the east and northern California in the west. The wintering range extends across the entire continental United States, extending well into Mexico along the Gulf coast.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

American goldfinches are small finches with small conical bills. They are olive brown above, blending to olive yellow below. Males have bright yellow throats and jet black wing feathers. Females do not have a bright coloring. Their wing feathers are dull brownish-black.

Range length: 11.4 to 12.8 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Average mass: 13.6 g.

Average basal metabolic rate: 0.4108 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

American goldfinches are small finches with small conical bills. They are olive brown above, blending to olive yellow below. Males have bright yellow throats and jet black wing feathers. Females do not have a bright coloring. Their wing feathers are dull brownish-black.

Range length: 11.4 to 12.8 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Average mass: 13.6 g.

Average basal metabolic rate: 0.4108 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 13 cm

Weight: 13 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: American goldfinches are associated with weedy fields, cultivated lands, open deciduous and riparian woodland, forest edge, second growth, shrubbery, orchards, and farmlands (AOU 1998). Nests usually are in small trees or bushes, 0.3-10 meters above ground, sometimes in thistles near the ground ( Terres 1980). See Watt and Dimberio (1990) for information on the structure of successful nests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American goldfinches prefer weedy fields and flood plains in their breeding range. These habitats include early successional growth, cultivated lands, roadsides, orchards, and gardens. This habitat preference is maintained during the spring and fall migration. Winter habitats vary more than summer habitats, with finches moving near to human feeders (if available) in the northern part of their range. In the southern parts of their range, they tend to remain in habitats that closely approximate the weedy fields and flood plains of the north.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American goldfinches prefer weedy fields and flood plains in their breeding range. These habitats include early successional growth, cultivated lands, roadsides, orchards, and gardens. This habitat preference is maintained during the spring and fall migration. Winter habitats vary more than summer habitats, with finches moving near to human feeders (if available) in the northern part of their range. In the southern parts of their range, they tend to remain in habitats that closely approximate the weedy fields and flood plains of the north.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations are migratory, whereas southern breeders are year-round residents. Overall, migrations peak from mid-April to early June and from late October to mid-December; specific timing varies across the large range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on seeds (e.g., birches, alders, conifers, thistles, goldenrod, etc.); eats some berries and insects (Terres 1980). Young fed partly digested, regurgitated seeds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

American goldfinches consume many different types of seeds from annual plants. Analysis of the stomach contents of one goldfinch showed 50 different items, only 3 of which were insects. The others included a wide variety of "weed" seeds, such as seeds from grasses and trees (alder, birch, cedar, elm, etc.) Goldfinches are well adapted to hanging on seed heads, and they prefer this to feeding on the ground. Goldfinches drink by obtaining a mouthful of water and quickly tipping the head back to swallow.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

American goldfinches consume many different types of seeds from annual plants. Analysis of the stomach contents of one goldfinch showed 50 different items, only 3 of which were insects. The others included a wide variety of "weed" seeds, such as seeds from grasses and trees (alder, birch, cedar, elm, etc.) Goldfinches are well adapted to hanging on seed heads, and they prefer this to feeding on the ground. Goldfinches drink by obtaining a mouthful of water and quickly tipping the head back to swallow.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

American goldfinch nests are sometimes parasitized by Molothrus ater, resulting in a loss of goldfinch eggs and young. However, cowbird young are not successfully fledged from American goldfinch nests.

Commensal/Parasitic Species:

  • brown-headed cowbirds (Molothrus_ater)
  • louse flies (Hippoboscidae)
  • feather mites (Acari)
  • coccidia (Isospora)
  • Schistosoma_dermatitis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Although predation at the nest is a common cause of nest failure, American goldfinches are surprisingly non-aggressive towards predators. American goldfinches display little aggressive behavior, other than alarm calling.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

American goldfinch nests are sometimes parasitized by brown-headed cowbirds, resulting in a loss of goldfinch eggs and young. However, cowbird young are not successfully fledged from American goldfinch nests.

American goldfinches are parasitized by feather mites (Acari) and louse flies (Hippoboscidae). In wild populations coccidial infections often result in death (Isospora). American goldfinches are an intermediate host for swimmer's itch (Schistosoma dermatitis).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Although predation at the nest is a common cause of nest failure, American goldfinches are surprisingly non-aggressive towards predators. American goldfinches display little aggressive behavior, other than alarm calling.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Carduelis tristis (red-eyed vireo, yellow warbler, gold finch, catbird, brown thrasher, towhee, robin) is prey of:
Accipiter striatus
Accipiter cooperii

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Carduelis tristis (red-eyed vireo, yellow warbler, gold finch, catbird, brown thrasher, towhee, robin) preys on:
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Except during the breeding season, usually travels and forages in flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

American goldfinches have been recorded living up to 11 years in the wild and in captivity.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
11 (high) years.

Average lifespan

Status: wild:
125 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

American goldfinches have been recorded living up to 11 years in the wild and in captivity.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
11 (high) years.

Average lifespan

Status: wild:
125 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13 years Observations: Breeds in the first year of life and annually thereafter (http://bna.birds.cornell.edu/)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nesting occurs relatively late for a songbird. In most areas, egg laying occurs primarily in late June, July, and August, sometimes in May or into September, with a peak in June and July, but some populations in California and Baja California nest from April to early July. Clutch size is 4-6 (usually 5). Incubation lasts 12-14 days. Young leave the nest about 11-17 days after hatching. Young depend on one or both parents for food for about 3 weeks after fledging.

Brown-headed cowbirds are brood parasites that sometimes lay eggs in American goldfinch nests. However, the cowbird young rarely survive. Probably this is because goldfinches feed mostly seeds to their nestlings, and this diet is inadequate for cowbird development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American goldfinches form mated pairs in the winter, although they don't start to breed until spring or early summer.

Breeding begins in late June or early July. The male watches attentively as the female builds the nest. The nest building takes her about six days. From 2 to 7 eggs are laid, often at night. Nesting success varies depending on the experience of the parents. In one study, experienced parents successfully raised 3.4 young per clutch and inexperienced parents raised 2.8 young per clutch. The female then incubates the eggs for 12 to 14 days before hatching. and the male feeds her. The female may leave with the male for short periods of a few minutes.

American goldfinches breed for the first time in the year after they hatch.

Breeding interval: American goldfinches may lay up to 3 clutches each year.

Breeding season: Breeding begins in late June or July.

Range time to hatching: 12 to 14 days.

Average age at sexual or reproductive maturity (female): 11 months.

Average age at sexual or reproductive maturity (male): 11 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

American goldfinch young hatch naked, with reddish bodies and eyes closed. They develop quickly, opening their eyes by day three and fully opening them by day seven.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pair formation occurs in winter. Experienced females will desert their mate in up to 15% of cases to have a second brood with another male. In those cases the first male takes over full responsibility for raising the young.

Breeding begins in late June or early July. The male watches attentively as the female builds the nest. The nest building takes her about six days. From 2 to 7 eggs are laid, often at night. Nesting success varies depending on the experience of the parents. In one study, experienced parents successfully raised 3.4 young per clutch and inexperienced parents raised 2.8 young per clutch. The female then incubates the eggs for 12 to 14 days before hatching. and the male feeds her. The female may leave with the male for short periods of a few minutes.

American goldfinches breed for the first time in the year after they hatch.

Breeding interval: American goldfinches may lay up to 3 clutches each year.

Breeding season: Breeding begins in late June or July.

Range time to hatching: 12 to 14 days.

Average age at sexual or reproductive maturity (female): 11 months.

Average age at sexual or reproductive maturity (male): 11 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

American goldfinch young hatch naked, with reddish bodies and eyes closed. They develop quickly, opening their eyes by day three and fully opening them by day seven.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Carotenoids create yellow color: American goldfinch
 

The feathers of the American goldfinch appear yellow in color due to carotenoids.

     
  "The coloration of feathers can be caused by carotenoids (usually producing yellow, orange and red), melanins (usually producing brown, black and grey), other pigments (such as found in some parrot feathers) or by nano-scale reflective tissues (usually producing UV-blue, white and iridescent coloration; Gill 1995). Coloration produced by the latter mechanism is typically referred to as 'structural coloration.'" (Shawkey and Hill 2005:121)
  Learn more about this functional adaptation.
  • Shawkey, M. D.; Hill, G. E. 2005. Carotenoids need structural colours to shine. Biology Letters. 1(2): 121-124.
  • Shawkey, MD; Hill, G.E.; McGraw, K.J.; Hood, W.R.; Huggins, K.L. 2006. An experimental test of the relative contribution and condition-dependence of microstructure and carotenoids in yellow plumage coloration. Proceedings of the Royal Society of London B. 273: 2985-2991.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carduelis tristis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTTCTCATCCGAGCAGAACTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTTATAATCTTCTTCATAGTTATACCCATCATAATCGGAGGATTCGGAAACTGACTAGTTCCTCTAATGATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCATCATTCCTCCTCCTACTAGCATCTTCCACCGTAGAAGCAGGTGTTGGTACAGGCTGAACAGTATACCCTCCACTAGCTGGTAACCTAGCTCATGCCGGAGCTTCAGTTGACTTAGCAATTTTCTCCCTACACTTAGCCGGTATCTCTTCAATCCTAGGCGCAATCAACTTCATTACAACAGCAATCAATATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTCGTTTGATCAGTCCTAATTACTGCAGTACTCCTGCTCCTCTCCCTCCCAGTCCTTGCTGCAGGAATTACAATACTTCTCACAGACCGCAACCTCAACACCACTTTCTTCGATCCTGNAGGAGGAGGTGACCCANTCCTATACCAACACCTCTTCTGATTCTTTGGACATCCAGAAGTATATATCCTCATTCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carduelis tristis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently, American goldfinch populations are not decreasing. It is thought that their populations have increased since European settlement of North America. The clearing of forests for agriculture has vastly expanded the preferred habitat of American goldfinches.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently, American goldfinch populations are not decreasing. It is thought that their populations have increased since European settlement of North America. The clearing of forests for agriculture has vastly expanded the preferred habitat of American goldfinches.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of American goldfinches on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

American goldfinches are enjoyed by birdwatchers at their feeders. They may also help to disperse seeds.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known negative effects of American goldfinches on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

American goldfinches are enjoyed by birdwatchers at their feeders. They may also help to disperse seeds.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American goldfinch

The American goldfinch (Spinus tristis), also known as the eastern goldfinch, is a small North American bird in the finch family. It is migratory, ranging from mid-Alberta to North Carolina during the breeding season, and from just south of the Canadian border to Mexico during the winter.

The only finch in its subfamily to undergo a complete molt, the American goldfinch displays sexual dimorphism in its coloration; the male is a vibrant yellow in the summer and an olive color during the winter, while the female is a dull yellow-brown shade which brightens only slightly during the summer. The male displays brightly colored plumage during the breeding season to attract a mate.

The American goldfinch is a granivore and adapted for the consumption of seedheads, with a conical beak to remove the seeds and agile feet to grip the stems of seedheads while feeding. It is a social bird, and will gather in large flocks while feeding and migrating. It may behave territorially during nest construction, but this aggression is short-lived. Its breeding season is tied to the peak of food supply, beginning in late July, which is relatively late in the year for a finch. This species is generally monogamous, and produces one brood each year.

Human activity has generally benefited the American goldfinch. It is often found in residential areas, attracted to bird feeders which increase its survival rate in these areas. Deforestation also creates open meadow areas which are its preferred habitat.

Taxonomy[edit]

The American goldfinch was one of the many species originally described by Linnaeus in the landmark 1758 10th edition of his work Systema Naturae.[3] It was initially included in the genus Spinus, a group containing New World goldfinches and siskins, but in 1976, Spinus was merged into the genus Carduelis as a subgenus.[4] Recent studies resurrect the genus Spinus. Its closest relatives are the lesser goldfinch (S. psaltria), Lawrence's goldfinch (S. lawrencei), and the siskins. Although it shares a name with the European goldfinch, the two are in separate subgenera and are not directly related.[5] Carduelis is derived from carduus, the Latin word for thistle; the species name tristis is Latin for 'sorrowful'.[6] There are four recognized subspecies of the American goldfinch:[7]

  • S. t. tristis is the most common of the subspecies. Its summer range is from southern Canada to Colorado, and east to the Carolinas. Its winter range is from southern Canada south to Florida and central Mexico.[8]
  • S. t. pallidus is differentiated from other subspecies by its paler body color, stronger white markings and, in males, a larger black cap. It is slightly larger than C. t. tristis. The summer range is from British Columbia to western Ontario, south to Colorado and west to Oregon. In winter, the range extends from southern Canada and northern California, south to Mexico.[8]
  • S. t. jewetti is smaller and darker than the other subspecies. It occurs on the coastal slope of the Cascade Mountains from southern British Columbia to central California, overlapping with the range of C. t. pallidus.[8]
  • S. t. salicamans occurs west of the Sierra Nevada range during the summer and in south and central Baja California to the Mojave Desert and Colorado Desert in winter. In winter, the plumage of both sexes is browner than other subspecies, and in summer, the male's black cap is smaller than that of other subspecies.[8] This subspecies has been called the willow goldfinch.[9]

The molecular phylogeny and evolutionary consequences have been obtained by Antonio Arnaiz-Villena et al.[10][11][12][13][14][15][16]
This seems to be the most ancient extant species of the Meso American Spinus/Carduelis evolutive radiation, whose parental species is Carduelis/Spinus lawrencei.[17]

Description[edit]

The American goldfinch is a small finch, 11–14 cm (4.3–5.5 in) long, with a wingspan of 19–22 cm (7.5–8.7 in). It weighs between 11–20 g (0.39–0.71 oz).[18] Among standard measurements, the wing chord is 6.5 to 7.8 cm (2.6 to 3.1 in), the tail is 4.2 to 5.1 cm (1.7 to 2.0 in), the culmen is 0.9 to 1.1 cm (0.35 to 0.43 in) and the tarsus is 1.2 to 1.4 cm (0.47 to 0.55 in).[19] The beak is small, conical, and pink for most of the year, but turns bright orange with the spring molt in both sexes.[20] The shape and size of the beak aid in the extraction of seeds from the seed heads of thistles, sunflowers, and other plants.[21]

The American goldfinch undergoes a molt in the spring and autumn. It is the only cardueline finch to undergo a molt twice a year.[22] During the winter molt it sheds all its feathers; in the spring, it sheds all but the wing and tail feathers, which are dark brown in the female and black in the male.[21] The markings on these feathers remain through each molt, with bars on the wings and white under and at the edges of the short, notched tail.[20] The sexual dimorphism displayed in plumage coloration is especially pronounced after the spring molt, when the bright color of the male's summer plumage is needed to attract a mate.[21]

American goldfinch call

Once the spring molt is complete, the body of the male is a brilliant lemon yellow, a color produced by carotenoid pigments from plant materials in its diet,[23] with a striking jet black cap and white rump that is visible during flight.[24] The female is mostly brown, lighter on the underside with a yellow bib.[22] After the autumn molt, the bright summer feathers are replaced by duller plumage, becoming buff below and olive-brown above, with a pale yellow face and bib. The autumn plumage is almost identical in both sexes, but the male has yellow shoulder patches.[25] In some winter ranges, the goldfinches lose all traces of yellow, becoming a predominantly medium tan-gray color with an olive tinge evident only on close viewing.

The immature American goldfinch has a dull brown back, and the underside is pale yellow. The shoulders and tail are dull black with buff-colored, rather than white, markings on wings and rump. This coloration is the same in both genders.[25]

The song of the American goldfinch is a series of musical warbles and twitters, often with a long note. A tsee-tsi-tsi-tsit call is often given in flight; it may also be described as per-chic-o-ree.[20] While the female incubates the eggs, she calls to her returning mate with a soft continuous teeteeteeteete sound. The young begin to use a call of chick-kee or chick-wee shortly before fledging, which they use until they have left the nest entirely.[21] There are two defense calls made by adults during nesting; a sweeet call made to rally other goldfinches to the nest and distract predators, and a bearbee used to signal to the nestlings to quiet them and get them to crouch down in the nest to become less conspicuous.[26]

Distribution and habitat[edit]

Female American goldfinch

The American goldfinch prefers open country where weeds thrive, such as fields, meadows, flood plains, as well as roadsides, orchards, and gardens. It may also be found in open deciduous and riparian woodlands and areas of secondary growth.[27] This habitat preference continues during the spring and autumn migrations.[20]

The summer breeding range stretches across North America from coast to coast. It is bounded on the north by Saskatchewan and stretches south across North America to North Carolina on the east coast, and northern California on the west coast.[20] The American goldfinch is a short-distance migrant, moving south in response to colder weather and lessened food supply. The migration is completed in compact flocks, which travel in an erratic, wavelike flight pattern.[28]

Its winter range includes southern Canada and stretches south through the United States to parts of Mexico. In winter, in the northern part of its range, the finch may move nearer to feeders if they are available. In southern ranges, during winter, they remain in areas similar to the fields and flood plains where they live during the summer months.[29]

Attempts were made to introduce the American goldfinch into Bermuda in the 19th century, and Tahiti in 1938, but the species failed to become established.[30]

Behavior[edit]

Male (left) and female (right) at a thistle feeder

The American goldfinch flies in a distinctive undulating pattern, creating a wave-shaped path. This normally consists of a series of wing beats to lift the bird, then folding in the wings and gliding in an arc before repeating the pattern. Birds often vocalize during the flapping phase of the pattern and then go silent during the coasting phase. The call made during flight is "per-twee-twee-twee", or "ti-di-di-di", punctuated by the silent periods.[29][31]

The American goldfinch is gregarious during the non-breeding season, when it is often found in large flocks, usually with other finches. During the breeding season, it lives in loose colonies. While the nest is being constructed, the male will act aggressively toward other males who intrude into his territory, driving them away, and the female reacts in the same way toward other females. This aggressiveness subsides once the eggs have been laid.[32]

The American goldfinch does not act aggressively toward predators within its territory; its only reaction is alarm calling. Predators include snakes, weasels, squirrels, and blue jays, which may destroy eggs or kill young, and hawks and cats, which pose a threat to both young and adults. As of 2007, the oldest known American goldfinch was 10 years and 5 months old.[33]

Diet[edit]

Male perched on a thistle plant
American goldfinches eating sunflower heads

The American goldfinch is a diurnal feeder. According to the Cornell Lab of Ornithology, the species is one of the strictest vegetarians in the bird world.[33] It is mainly granivorous, but will occasionally eat insects, which are also fed to its young to provide protein. Its diet consists of the seeds from a wide variety of annual plants, often those of weeds grasses and trees, such as thistle, teasel, dandelion, ragweed, mullein, cosmos, goatsbeard, sunflower, and alder.[27] However, it also consumes tree buds, maple sap, and berries. It will eat at bird feeders provided by humans, particularly in the winter months, preferring Niger seed (commonly and erroneously called thistle seed).[34]

Unlike some finch species, the American goldfinch uses its feet extensively in feeding. It frequently hangs from seedheads while feeding in order to reach the seeds more easily. In the spring, the American goldfinch feeds on the catkins hanging from birches and alders by pulling one up with its beak and using its toes to hold the catkin still against the branch. This dexterity enables it to take advantage of food sources relatively inaccessible to potential competitors, increasing its chances of survival.[21]

Reproduction[edit]

The American goldfinch begins its breeding season later in the year than any other finch and later than any other native North American bird, besides occasionally the sedge wren.[21][33] This may be related to the abundance of seeds in the late summer months, as seeds represent the majority of their diet.[32]

The courtship rituals of the American goldfinch include aerial maneuvers and singing by males, who begin courtship in late July. The flight displays begin as the male pursues the female, who flies in zigzagging evasive patterns. The male is able to signal his quality and fitness, both in the short term (current body condition) and long term (genes), through ornamentation (bill color and plumage).[35] If a female accepts the male as a mate, the pair will fly in wide circles, as the male warbles throughout the flight.[21]

Once a male has found a mate, he selects a territory, marking the boundaries by warbling as he flies from perch to perch. After circling the perimeter, he performs two flight displays, first repeating a low, flat flight, then flying in an exaggerated version of normal flight, tucking his wings close to his body, plummeting earthwards and catching himself as he spreads his wings to glide upward in a series of loops. Two or three pairs may group their territories together in a loose colony, perhaps to aid in defense against predators.[21]

Nest of an American goldfinch

The nest is built in late summer by the female in the branches of a deciduous shrub or tree at a height of up to 10 m (33 ft). The nest-building lasts approximately six days, during which time the female works in 10–40 minute increments. The male frequently flies with the female as she collects nesting materials, and though he may carry some materials back to the nest, he leaves its construction to the female. The outer shell of the nest is built of bark, weeds, vines, and grass.[28] The inside diameter of the finished nest is about 6.5 cm (2.6 in).[27] The rim is reinforced with bark bound by spiderwebs and caterpillar silk, and the cup is lined with plant down from milkweed, thistle, or cattail. The nest is so tightly woven that it can hold water, and it is possible for nestlings to drown following a rainstorm if the parents do not cover the nest.[22]

American goldfinches lay four to six bluish-white eggs, which are oval in shape and about 16 mm × 12 mm (0.63 in × 0.47 in), roughly the size of a peanut.[28] It is thought that they are laid during the night.[29] The eggs are incubated by the female alone, though the male brings her food as she nests, and most mating pairs raise only one brood each year.[28]

The chicks hatch 12–14 days after incubation begins. Like all passerines, the chicks are altricial; they are born naked, with reddish bodies, pale grey down, and closed eyes.[36] The mother bird feeds her young regurgitated seeds and insects as they grow.[24] The hatchlings develop quickly, opening their eyes after three days, and completing the growth of olive-brown juvenile plumage after 11–15 days, at which time they begin to practice short flights close to the nest. For up to three weeks after fledging, they are still fed by the male, who locates them by listening for their fledging call. The chicks stop giving this call when they become entirely independent.[21]

American goldfinches are occasionally victims of brood parasites, particularly brown-headed cowbirds. One study found that 9% of nests had brown-headed cowbird eggs in them.[37] American goldfinches make very poor hosts for brood parasites, with studies showing low hatching rates of brown-headed cowbird eggs and no fledging success. This is despite the fact that the American goldfinch has no known behavioral adaptations against brood parasites. It is thought that the inability of brown-headed cowbird chicks to survive is due to a failure to get enough nutrition; the seed-rich diet of American goldfinch chicks varies from the usual insect-rich diet of other hosts.[38]

Relationship with humans[edit]

The American goldfinch is found in residential areas throughout its range. Backyard birders attract it using feeders containing Nyjer thistle seed,[34] or by planting grasses and perennial plants, such as zinnias, cosmos, bee balm, or globe thistle, which produce seedheads favored by finches. Although some controversy surrounds bird feeding (see bird feeder for details), an increase in backyard feeding by humans has generally been beneficial to this species.[34]

The American goldfinch is not threatened by human activity, and is widespread throughout its range.[1][7] The clearing of forests by humans, though harmful to many species, has benefited the American goldfinch. Clearing of woodlands causes declines in numbers of neotropical migrants, while favoring short-distance migrants and permanent residents.[39] This benefits the American goldfinch both as a short-distance migrant, and because the created open areas are the preferred environment of the bird, where weeds thrive which produce the primary food source of the American goldfinch.[22]

State bird[edit]

The American goldfinch is the state bird of Iowa, New Jersey, and Washington, where it is called the "eastern goldfinch" in the two former and the "willow goldfinch" in the latter.[40] It was chosen by schoolchildren in Washington State in 1951.[9]

References[edit]

  1. ^ a b BirdLife International (2012). "Carduelis tristis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Dwight, Jonathan Jr. (1902). "Individual, seasonal, and geographical variations of the American Goldfinch (Astragalinus tristis)" (PDF). The Auk 19 (2): 149–164. doi:10.2307/4069307. JSTOR 4069307. 
  3. ^ Linnaeus, Carolus (1758). Systema Naturae (in Latin). Holmiae: Laurentii Salvii. p. 320. OCLC 174638949. Retrieved 4 February 2008. 
  4. ^ Committee on Classification and Nomenclature (1976). "Thirty-third Supplement to the American Ornithologists' Union Check-list of North American Birds" (PDF). The Auk 93 (4). Retrieved 4 February 2008. 
  5. ^ Stang, David (28 January 2008). "Carduelis tristis (American Goldfinch)". The Zipcode Zoo. BayScience Foundation. Archived from the original on 8 January 2008. Retrieved 4 February 2008. 
  6. ^ Whitaker, William. "Tristis". Words by William Whitaker. Retrieved 4 February 2008. 
  7. ^ a b "Carduelis tristis (Linnaeus, 1758)". Integrated Taxonomic Information System. Retrieved 4 February 2008. 
  8. ^ a b c d Middleton, Alex L.; Poole, A.; Gill, F. (1993). "American Goldfinch Carduelis tristis". In Poole, A.; Gill, F. The Birds of North America Online (Cornell Lab of Ornithology) (80). doi:10.2173/bna.80. Retrieved 4 February 2008. 
  9. ^ a b McAuliffe, Emily (2003). Washington Facts and Symbols. Capstone Press. p. 13. ISBN 978-0-7368-2277-0. 
  10. ^ Zamora, J; Moscoso J; Ruiz-del-Valle V; Ernesto L; Serrano-Vela JI; Ira-Cachafeiro J; Arnaiz-Villena A (2006). "Conjoint mitochondrial phylogenetic trees for canaries Serinus spp. and goldfinches Carduelis spp. show several specific polytomies". Ardeola 53 (1): 1–17. 
  11. ^ Arnaiz-Villena, Antonio; Alvarez-Tejado M.; Ruiz-del-Valle V.; García-de-la-Torre C.; Varela P; Recio M. J.; Ferre S.; Martinez-Laso J. (1998). "Phylogeny and rapid Northern and Southern Hemisphere speciation of goldfinches during the Miocene and Pliocene Epochs". Cell.Mol.Life.Sci. 54 (9): 1031–41. doi:10.1007/s000180050230. PMID 9791543. 
  12. ^ Arnaiz-Villena, A; Gómez-Prieto P; Ruiz-de-Valle V (2009). "Phylogeography of finches and sparrows". Nova Science Publishers. ISBN 978-1-60741-844-3. 
  13. ^ Zamora, Jorge; Lowy E; Ruiz-del-Valle V; Moscoso J; Serrano-Vela JI; Rivero-de-Aguilar J; Arnaiz-Villena A (2006). "Rhodopechys obsoleta (desert finch): a pale ancestor of greenfinches according to molecular phylogeny". J Ornithol 147 (3): 448–56. doi:10.1007/s10336-005-0036-2. 
  14. ^ Arnaiz-Villena, A.; Moscoso, J.; Ruiz-del-Valle, V.; Gonzalez, J.; Reguera, R.; Wink, M.; Serrano-Vela, J. I. (2007). "Bayesian phylogeny of Fringillidae birds: status of the singular African oriole finch Linurgus olivaceus and evolution and heterogeneity of the genus Carpodacus". Acta Zoologica Sinica 53 (5): 826–834. Retrieved 14 December 2009. 
  15. ^ Arnaiz-Villena, A; Moscoso J; Ruiz-del-Valle V; González J; Reguera R; Ferri A; Wink M; Serrano-Vale JI (2008). "Mitochondrial DNA Phylogenetic Definition of a Group'of "Arid-Zone" Carduelini Finches". The Open Ornithology Journal 1: 1–7. doi:10.2174/1874453200801010001. 
  16. ^ Arnaiz-Villena A, Ruiz-del-Valle V, Moscoso J, Serrano Vela JI, Zamora J. (2007). "mtDNA phylogeography of North American Carduelis pinus group of birds". Ardeola 54: 1–14. Retrieved 20 July 2010. 
  17. ^ Arnaiz-Villena, A.; Areces, C.; Rey, D.; Enríquez-de-Salamanca, M.; Alonso-Rubio, J.; Ruiz-del-Valle, V. (2012). "Three Different North American Siskin/Goldfinch Evolutionary Radia-tions (Genus Carduelis): Pine Siskin Green Morphs and European Siskins in America". The Open Ornithology Journal 5: 73–81. doi:10.2174/1874453201205010073. 
  18. ^ "Carduelis tristis". Georgia Wildlife Web. The Georgia Museum of Natural History. Retrieved 4 February 2008. 
  19. ^ Finches and Sparrows by Peter Clement. Princeton University Press (1999). ISBN 978-0-691-04878-9.
  20. ^ a b c d e "American Goldfinch". All About Birds. Cornell Lab of Ornithology. Retrieved 4 February 2008. 
  21. ^ a b c d e f g h i Hayakawa, E. "American Goldfinch". Hinterland Who's Who. Canadian Wildlife Service & Canadian Wildlife Federation. Archived from the original on 17 January 2008. Retrieved 4 February 2008. 
  22. ^ a b c d "American Goldfinch". Chipper Woods Bird Observatory. Wild Birds Unlimited. 10 December 2007. Retrieved 4 February 2008. 
  23. ^ McGraw, Kevin; Hill, Geoffrey; Parker, Robert S. (2005). "The physiological costs of being colourful: nutritional control of carotenoid utilization in the American goldfinch, Carduelis tristis". Animal Behaviour 69 (3): 653–660. doi:10.1016/j.anbehav.2004.05.018. Retrieved 4 February 2008. 
  24. ^ a b Department of Natural Resources. "American Goldfinch (Carduelis tristis)". State of Michigan. Archived from the original on 24 December 2007. Retrieved 4 February 2008. 
  25. ^ a b Unitt, Philip; Perretta, Nicole (Winter 2001). "Focus on American, Lawrence's, and Lesser Goldfinches". Wrendering (San Diego Natural History Museum). Archived from the original on 19 December 2007. Retrieved 4 February 2008. 
  26. ^ Knight, R.; Temple, A. (1987). "Nest defence in the American Goldfinch". Animal Behaviour 34 (3): 887–897. doi:10.1016/S0003-3472(86)80075-6. 
  27. ^ a b c Terres, John K. (1980). The Audubon Society Encyclopedia of North American Birds. New York: Knopf. p. 329. ISBN 0-394-46651-9. 
  28. ^ a b c d Bent, A. C.; Cleveland, Arthur; et al. (1968). "American Goldfinch Carduelis tristis". Smithsonian Institution United States National Museum Bulletin 237 (1): 447–466. Archived from the original on 1 January 2008. Retrieved 4 February 2008. 
  29. ^ a b c Dewey, T.; Roof, J. (2007). "Carduelis tristis". Animal Diversity Web. University of Michigan Museum of Zoology. Archived from the original on 8 February 2008. Retrieved 4 February 2008. 
  30. ^ Long, John L. (1981). Introduced Birds of the World: The worldwide history, distribution and influence of birds introduced to new environments. Terrey Hills, Sydney: Reed. p. 449. ISBN 0-589-50260-3. 
  31. ^ "American Goldfinch", National Geographic
  32. ^ a b Sullivan, J. (1980). Hunting for Frogs on Elston, and Other Tales from Field & Street. Chicago: University of Chicago Press. ISBN 0-226-77993-9. Retrieved 4 February 2008. 
  33. ^ a b c American Goldfinch, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2013-02-22.
  34. ^ a b c Hollis, Elece. "Backyard Birdwatching: The American Goldfinch". Garden and Hearth. Retrieved 4 February 2008. 
  35. ^ Rosen, Rafael F.; Tarvin, Keith A. (2006). "Sexual signals of the male American goldfinch". Ethology 112 (10): 1008–1019. doi:10.1111/j.1439-0310.2006.01257.x. 
  36. ^ Ehrlich, P.R.; D.S. Dobkin; D. Wheye (1988). Precocial and Atricial. Birds of Stanford. Retrieved 4 February 2008. 
  37. ^ Middleton, Alex L. (1977). "Effect of cowbird parasitism on American Goldfinch nesting" (PDF). Auk 2 (94): 304–307. Retrieved 4 February 2008. 
  38. ^ Middleton, Alex L. (1991). "Failure of Brown-headed Cowbird parasitism in nests of the American Goldfinch" (PDF). Journal of Field Ornithology 2 (62): 200–203. Retrieved 4 February 2008. 
  39. ^ Droege, Sam (2000). "Birds and Landscape Changes in Northeastern Forests". U.S. Geological Survey, Biological Resources Division. Archived from the original on 7 September 2006. Retrieved 4 February 2008. 
  40. ^ Tveten, John L. ; Tveten, Gloria (2004). Our life with birds: a nature trails book. Texas A&M University Press. p. 75. ISBN 1-58544-380-8. Retrieved 17 May 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly (AOU 1983, 1998) listed in Carduelis. Acanthis and Spinus were considered separate genera prior to their merger into Carduelis (AOU 1983), in part following Mayr and Short (1970), although they continued to be listed as subgenera. Recent mitochondrial genetic data (Arnaiz-Villena et al. 2008) indicate that Carduelis is polyphyletic and that Acanthis spp., Spinus spp., Carduelis carduelis, and Chloris sinica belong to different clades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!