Articles on this page are available in 1 other language: Chinese (Simplified) (12) (learn more)

Overview

Brief Summary

Loxia curvirostra

A medium-sized (5 ¼ -6 ½ inches) finch, the Red Crossbill is most easily identified by its black wings, short black tail, and oddly-shaped bill. Males’ bodies may be bright red, yellow, or a mixture of both, although the cause of this variation in color is more related to the timing of the individual’s yearly molt than to heredity. Female Red Crossbills are streaky brownish-yellow on the back, head, and face. The Red Crossbill inhabits a large area of the Northern Hemisphere. In the New World, this species breeds across southern Alaska, southern Canada and the northern United States. This species’ range extends south at higher elevations as far as North Carolina in the east and southern Arizona in the west. Other populations occur in the mountains of Mexico and Central America south to Nicaragua. In the Old World, this species breeds across northern portions of Eurasia, with isolated populations at higher elevations as far south as North Africa, Vietnam, and the Philippines. Red Crossbills wander widely during winter, and in some years northern populations may move south in large numbers as far as the southeastern U.S.and southern Europe. Red Crossbills inhabit evergreen forests with trees that produce cones. This species almost exclusively eats seeds taken from these cones, and its strangely-shaped bill is specially adapted to cracking open cones to extract seeds. This species eats seeds from a number of kinds of evergreen trees, including pines, spruces, firs, and hemlocks. In fact, different populations of Red Crossbills often prefer one evergreen tree family over the others, having bills particularly suited to cracking cones produced by that kind of tree. In suitable habitat, Red Crossbills may be observed feeding on cone seeds while perched on branches or hanging upside-down from the cone. In more built-up areas, this species may also visit bird feeders in the company of other finch species. Red Crossbills are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Crossbills have one of the most protracted breeding seasons of any British bird. It can begin as early as January and, in parts of their range, they have been recorded breeding in every month of the year. Up to four greenish-white, lightly-blotched eggs are laid, and incubated solely by the female. After 13 days, the eggs hatch and both parents take part in feeding duties. Like many other seed-eating birds, the chicks are fed on insects initially, as these are highly nutritious.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Although it is not a bird that many people see very often, the crossbill is quite common in the UK and has probably increased in numbers as a result of the planting of pine forests. It is a very distinctive bird, sometimes called the 'parrot of the northern woods'. As its name suggests, the tips of the bill cross, enabling the birds to extract seeds from pine cones, their principle food, and giving the birds a rather parrot-like appearance. Males and females are noticeably different in colouration. Males are a rich brick-red on the head, back, rump, and belly. The wings and tail are a dark brownish-grey on both sexes, but females are grey-green where the males are red. The head of the bird is disproportionately large, with a thick 'bull' neck, and the tail is forked. Crossbills call frequently whilst moving about in the trees, making a high-pitched, metallic sound like 'glipp-glipp'. The song is a series of trills and twitters.  There is an old belief that the crossbill acquired its peculiar beak as a result of trying to remove the nails from the hands and feet of Christ when he was on the cross. This incident also accounted for the male bird's red breast, a story which is also associated with other red-breasted birds such as the robin and goldfinch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Red crossbills are found throughout the northern hemisphere. They are not migratory, but wander widely outside of the breeding season. Occasional irruptions may involve thousands of birds traveling to areas outside of their normal range. In the Americas, red crossbills are found in northern boreal and high altitude coniferous forests from coastal Alaska throughout much of Canada to the maritime provinces and south to northern Minnesota, Wisconsin, Michigan, New York, New Hampshire, Vermont, and Maine. They are found in appropriate habitat throughout the Sierra, Rocky Mountain, and Sierra Madre mountain ranges, as well as smaller mountain ranges in Baja California, Honduras, Nicaragua, Belize, and the Mexican volcanic belt. Small, disjunct breeding populations are found in the Appalachian Mountains and occasional breeding populations are found in appropriate habitat outside of their typical range. In the Palearctic, red crossbills are found from the British Isles across northern Europe, Russia, and Asia to the Kamchatka Peninsula and Japan. They are also found in appropriate habitat in mountain ranges, including the Alps, Pyrenees, Himalayas, Vietnam, the Philippines, and into the Atlas Mountains of northern Africa. They co-occur with other Loxia species in Scotland (Loxia scotica), Scandinavia and western Russia (Loxia pytyopsittacus), and North America (Loxia leucoptera).

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Knox, A. 1990. The sympatric breeding of Common and Scottish Crossbills Loxia curvirostra and L. scotica and the evolution of crossbills. Ibis, 132: 454-466.
  • Adkisson, C. 1996. Red crossbill (Loxia curvirostra). The Birds of North America Online, 256: 1-20. Accessed March 26, 2009 at http://bna.birds.cornell.edu/bna/species/256.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) As traditionally defined, this species occurs widely in Eurasia and North America. In North America it is resident from southeastern Alaska eastward across boreal Canada to Newfoundland and Nova Scotia, and south in the west to northern Baja California and through the mountains to Nicaragua, and south in the east to Great Lakes region, southern Appalachian Mountains, New York, and New England. (Adkisson 1996, AOU 1998). In the nonbreeding season this species disperses irregularly throughout much of the remainder of the contiguous United States. The several types or species of red crossbills are highly nomadic and may shift breeding ranges by as much as a thousand miles between one breeding season and the next (Groth 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Common crossbills range across much of Europe and northern Asia, as far south as the North African Barbary Coast. In the UK, they are widely distributed but found in greater numbers around the extensive man-made pine forests such as Thetford Chase in East Anglia's Breckland, Dalby Forest in Yorkshire, Grizedale Forest in Cumbria, Keilder Forest in Northumberland and Clocaenog Forest in Clwyd. Periodically, the UK population is boosted by 'invasions' of birds from northern Europe, possibly due to the failure of spruce cones. In Scotland, the common crossbill is replaced by the Scottish crossbill, a bird intermediate between the common and the parrot crossbill of northern Scandinavia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red crossbills are medium-sized finches with distinctive, curved mandibles that are crossed at their tips. Males are slightly larger than females (males: 23.8 to 45.4 g, females: 23.7 to 42.4 g). Males are a deep red color, sometimes reddish yellow, with dark brown flight and tail feathers. Females are olive to gray or greenish yellow on the breast and rump with dark brown flight and tail feathers. Immature birds are overall streaked with brown on a lighter background. The tail is notched. Red crossbills don't undergo any seasonal changes in plumage. They are easily distinguished from other species by their crossed bills, except for other Loxia species. In North America, white-winged crossbills (Loxia leucoptera) are distinguished by their white wing bars.

Red crossbills show a striking amount of geographic variation in body size and bill size and shape, despite the fact that populations regularly co-occur and that all populations range widely outside of the breeding season. Morphologies are also associated with distinctive call types. Some researchers have proposed up to 8 North American cryptic species based on call type and associated morphology. Similar levels of variation and tight association of call types and foraging morphology is observed in the Palearctic. Some evidence of reproductive isolation has been reported in the Palearctic, but mitochondrial DNA sequence data does not support the notion of reproductive isolation, instead finding that mitochondrial haplotypes mixed at continental scales.

Basal metabolic rate of captive red crossbills was estimated at 19% higher than expected for their body size.

Range mass: 23.7 to 45.4 g.

Range length: 14 to 20 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 16 cm

Weight: 37 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red crossbills are found almost exclusively in mature, coniferous forests, including spruce (Picea), fir (Abies), hemlock (Tsuga), and pine (Pinus) forests. They can also be found in mixed decidous-coniferous forests, provided there are ample supplies of conifer seeds to eat. Specific "call types" of red crossbills are associated with 1 or more conifer species. For example, two large-billed types of red crossbills in western North America are found closely associated with the large cones of Engelmann's spruce (Picea engelmanni), ponderosa pine (Pinus ponderosa), and table mountain pine (Pinus pungens). Another, eastern type associates mainly with Newfoundland black spruce (Picea mariana). Small-billed red crossbills associate with conifers with smaller cones, such as hemlocks (Tsuga) and Douglas-fir (Pseudotsuga). This close association between call types and conifer species has led to the description of many subspecies and speculation about strong selection of food types on bill-shape and subsequent reproductive isolation through vocalizations (call types). However, a study of mitochondrial DNA showed no evidence of reproductive isolation among subspecies or call types. Morphological differences among populations specialized to particular conifer species may be the result of rapid local adaptations.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

  • Questiau, S., L. Gielly, M. Clouet, P. Taberlet. 1999. Phylogeographical evidence of gene flow among Common Crossbill (Loxia curvirostra, Aves, Fringillidae) populations at the continental level. Heredity, 83: 196-205.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Coniferous and mixed coniferous-deciduous forests; also pine savanna and pine-oak habitat. In migration and winter may also occur in deciduous forest, and more open scrubby areas.

Nests in conifers, 1.5-25 m above ground, toward outer end of branch (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common crossbills occur in conifer woodland, showing a preference for spruce.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Wanders irregularly when population high and or food supply low (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Red crossbills feed exclusively on conifer seeds. Populations, or call types, may have specialized bill morphologies that make them most efficient at extracting the seeds from cones of particular conifer species. Red crossbills travel in feeding flocks that help individuals take best advantage of locally variable conifer seed crops. Flocking is thought to help these crossbills avoid predation while also assessing the best areas for foraging. Red crossbill calls and calling rates transmit information on the availability of food. Flying birds join foraging flocks when the foraging birds are calling. However, call rate increases among foraging birds as they spend more time feeding and, perhaps, begin to have less success in finding food. As the call rate reaches a crescendo, the flock departs to look for another foraging opportunity. The calls of foraging birds do not attract flying groups of another call type, however, which is consistent with their specialization on different conifer species.

Red crossbills feed mainly on conifer cones still attached to trees, although they will also hold unattached cones in their feet. They use their peculiar mandibles to bite between cone scales so that, as they bite, the lower mandible opens the scale and exposes the conifer seed. In particularly tough cones they may have to bite several times or twist with their head before they can reach the conifer seed with their tongue. Their "crossed" mandibles are essential for this task and allow them to exploit a niche not otherwise exploited among seed-eating birds. Once they expose a conifer seed, they remove the seed coat with their tongue and mandible and either swallow small seeds whole or crush larger seeds. Red crossbills take grit or sand into their crop to help with processing their seed diet.

Plant Foods: seeds, grains, and nuts

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats seeds, buds, and insects. Forages in trees; also picks up seeds from the ground. Feeds on a wide variety of seeds: e.g., pine, fir, spruce, hemlock, larch, birch, alder, elm, etc. (Terres 1980); mostly conifer seeds (Benkman 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Red crossbills are important seed predators of conifers across their range and regional populations are highly specialized to extract seeds of particular conifer species. They are parasitized by biting lice (Mallophaga).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Observed North American predators include sharp-shinned hawks (Accipiter striatus) on adults and Tamiasciurus species, gray jays (Perisoreus canadensis), and Steller's jays (Cyanocitta stelleri) on eggs and nestlings. Likely predators include other raptors that specialize on birds: Cooper's hawks (Accipiter cooperi), merlins (Falco columbarius), peregrine falcons (Falco peregrinus), and northern shrikes (Lanius excubitor). American kestrels (Falco sparverius, sharp-shinned hawks (Accipiter striatus), and northern pygmy owls (Glaucidium gnoma) have all been observed attacking red crossbill decoys. Eurasian predators are likely to be similar: bird specialist raptors, corvids, and squirrels.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations), but crossbills are not permanent residents of any particular occurrence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total population size is unknown but presumably exceeds 1,000,000. Rich et al. (2004) estimated population size at 15,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Forms flocks when not breeding; does not maintain a feeding territory. Pairs may forage more than 500 meters from nest (Bailey 1953, Nethersole-Thompson 1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red crossbills are divided into discrete "call types" that correspond to bill morphologies that allow them to specialize on the conifer seeds of particular conifer species. Young red crossbills of all call types make similar sounds during the nestling and fledgling stages. By the time they reach independence, however, they are using the specific call type of their parents. Mated pairs imitate each other to produce identical flight calls to remain in contact with each other. Flight calls are described as a "chip chip chip." Males sing from perches near their nest, songs are described as a buzzing "whit-whit" or "zzzt zzzt," although these songs also vary among call types. Other vocalizations used include alarm or distress calls, and excitement, threat, chitter, or courtship calls.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Information on lifespan in the wild is not reported in the literature. Captive red crossbills can live up to 8 years in the wild. Females may suffer higher predation rates because of the extended periods of time they spend on the nest.

Range lifespan

Status: captivity:
8 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8 years (captivity) Observations: In the wild these animals may live up to 7.1 years (Moller 2006), and they have been reported to live up to 8 years in captivity (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Red crossbills are monogamous and seem to stay in pairs throughout the year. Pairs use identical flight calls and seem to remain together throughout the year, although there is no direct evidence that year-round pairs are also mates in breeding season. Males sing from perches and make display flights to attract females. Males are aggressive towards other males during the breeding season. Courtship involves feeding the female and billing (grabbing each other by the bill). Males then accompany females constantly after courtship and during the period of egg-laying, presumably to prevent extra-pair copulations.

Mating System: monogamous

Many aspects of breeding phenology and behavior are strongly influenced by the availability of food. Throughout their range, red crossbills may be found breeding in almost every month, although local populations breed seasonally. Some populations, given enough conifer seed resources, can breed for up to 9 months out of the year. In North America eggs have been observed from December to September. Mated pairs select a nest site, usually an interior, densely covered branch of a conifer tree from 2 to 20 meters above ground. Males may contribute nesting materials, but females build the nest. Nests are constructed of conifer twigs lined with grasses, lichen, conifer needs, shredded bark, and feathers. Females lay 3 eggs typically, 1 each day, with incubation starting at the last egg laid, unless the weather is cold. Females incubate eggs for 12 to 16 days and brood nearly continuously for 5 days after hatching. Hatchlings go into torpor during brief absences of the female from the nest. Both hatching and fledging may be delayed by cold weather or lack of food. Young fledge at 15 to 25 days after hatching, depending on the availability of food. After fledging, the young follow their parents around (or only the male parent if the female lays a second clutch) and continue to beg for food and practice obtaining seeds from conifer cones. Parents sometimes feed their young for up to 33 days after they have fledged. Young red crossbills may become sexually mature even before they have taken on their adult plumage, as early as 100 days after hatching.

Breeding interval: Red crossbills can lay several clutches in a year, usually 2 to 4, depending on food availability. Pairs with access to abundant food resources can lay a second clutch while they are still feeding previous fledglings.

Breeding season: Red crossbill breeding season varies regionally and with food availability.

Range eggs per season: 2 to 6.

Average eggs per season: 3.

Range time to hatching: 12 to 16 days.

Range fledging age: 15 to 25 days.

Range time to independence: 48 to 58 days.

Range age at sexual or reproductive maturity (female): 100 (low) days.

Range age at sexual or reproductive maturity (male): 100 (low) days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Young red crossbills hatch in an altricial state, with no down. Females incubate and brood the young and males help to defend small foraging territories, provide some courtship food to the female, and feed hatchlings and fledglings until they become proficient at extracting conifer seeds from cones.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding season is variable, depends in part on food supply. Clutch size is 3-4, sometimes 5. Incubation, by female (fed by male), lasts about 12-14 days. Young leave nest about 17 days after hatching (Terres 1980), may be fed for two more weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Managing irregular food supplies: crossbills
 

Crossbills respond to irregular food supplies by periodically spreading from their regular foraging locations great distances in search of new abundant food sources.

     
  "By its very nature, irruption is common among birds, especially certain northern species. It is often associated with irregular food supplies, such as seeds, fruit, and prey that are abundant at some times and not at others. Crossbills, for instance, periodically irrupt in response to a scarcity of conifer seeds within their normal distribution range in the conifer forests of the northern hemisphere. These birds will travel great distances beyond this range during years in which food is scarceSeveral northern birds of prey, notably such species as the snowy owl (Nyctea scandiaca), short-eared owl (Asio flammeus), North American great horned owl (Bubo virginianus), rough-legged buzzard (Buteo lagopus), and goshawk (Accipiter gentilis), undergo comparable irruptions during those years in which their prey's numbers are at their lowest ebb within their species' normal cycle of abundance-rarity. Moreover, because during previous years when prey was abundant the owls' birth rate increased, so their population now has to live on less prey. The birds are thus forced to leave their traditional grounds in search of food." (Shuker 2001:82-83)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loxia curvirostra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGATATCGGGACCCTTTACCTGATTTTCGGTGCATGAGCCGGAATAGTAGGCACCGCCCTAAGCCTTCTCATCCGAGCAGAACTAGGACAACCCGGAGCCCTTCTAGGCGACGACCAAGTCTATAACGTAATCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTTCTCCTACTAGCATCTTCCACCGTAGAAGCAGGTGTTGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGCAACCTGGCCCACGCCGGAGCCTCAGTTGACTTAGCAATCTTCTCCCTACACCTGGCCGGTATTTCCTCAATCCTAGGAGCAATCAACTTTATCACAACAGCAATCAACATAAAACCCCCCGCCCTATCACAATATCAAACCCCTCTATTCGTCTGATCCGTCCTAATCACTGCAGTACTCCTGCTTCTCTCTCTGCCAGTCCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGTAACCTCAACACCACATTCTTTGACCCCGCAGGAGGAGGTGATCCAGTCCTATATCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTATATATCCTCATCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loxia curvirostra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red crossbills have a large range and large population numbers, they are not currently considered threatened. There were large reductions in the numbers of red crossbills in areas logged during the 19th and 20th centuries, but some of those populations may have rebounded as forests re-grew. A combination of nomadism, adaptation to cold environments, high reproductive rate with abundant food supply, and early sexual maturity make red crossbills especially good at responding to variation in cone crop availability across a landscape. Their populations can rebound quickly when food resources are available. Red crossbills are frequently killed by cars when they take salt and sand off of roads.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread in North America and Eurasia; large population size; many occurrences, though these are variable in location; apparently stable or slowly declining overall in North America but trends are difficult to determine; taxonomic status is uncertain, and status and rank could change significantly if ongoing research confirms the suspicion that L. curvirostra consists of multiple species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Protected in the UK under Schedule 1 of the Wildlife and Countryside Act 1981 (as amended). Included in the Birds of Conservation Concern Amber List (medium conservation concern).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Rich et al. (2004) estimated the global population to number 15,000,000 individuals. In Europe, the breeding population is estimated to number 5800000-13000000 breeding pairs, equating to 17400000-39000000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size is 72500000-780000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trends are difficult to determine because of the species' nomadic habits, but probably the overall population is relatively stable or slowly declining.

Global Long Term Trend: Unknown

Comments: The "northeastern" subspecies declined probably due to extensive logging in the early 1900s (Dickerman 1987). Newfoundland population (subspecies percna) has declined greatly since the late 1950s and early 1960s (Benkman 1993).

Breeding Bird Survey (BBS) data for 1966-2007 indicate a significant survey-wide decline averaging 1.4% per year; this amounts to a decline of 44% over this time period. In most areas, this species is detected in low numbers during these surveys. For example, BBS abundance (average number of individuals per route) declined from 1.9-2.3 in the 1960s and early 1970s to 1.2-1.5 in 2000-2007, so the decline was not more than about 1 bird per route.

Christmas Bird Count (CBC) data for Canada and the United States for this period show large annual fluctuations in abundance, with no obvious increasing or decreasing trend.

Populations of this species may not be accurately represented by data collected by BBS or CBC methods. Apparent changes in abundance in count areas may actually reflect irregular/irruptive population movements with no net change in overall range-wide abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Decline of the Newfoundland population (subspecies percna) evidently has been due at least in part to competition from the introduced red squirrel (Benkman 1993).

Local declines and increases reflect variations in local conifer cone crops; widespread deforestation or low cone availability results in emigration of crossbills to other areas. Net reduction in total area of mature forest (or in overall cone availability) presumably would result in an overall decline in the crossbill population, so recent forestry practices and widespread regional tree mortality due to insect outbreaks likely are detrimental to crossbills, at least temporarily.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The UK population of common crossbills is believed to have increased considerably in recent years through large-scale afforestation in both lowland and upland areas. During the 1930s, the activities of a hard-core group of egg collectors in the birds' Breckland stronghold gave cause for concern. Today's stringent legal protection and the increase in the crossbill's populations mean that, at the present time, the birds are not considered to be threatened. However, the Scottish crossbill is listed on the IUCN's Red List as a bird of high conservation concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: To conserve the diversity of red crossbills, Benkman (1993) recommended protecting mature and old-growth stands, increasing rotation ages throughout the range of each of the required conifers, and leaving mature trees in cutover areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Needs: To conserve the diversity of red crossbills, Benkman (1993) recommended protecting mature and old-growth stands, increasing rotation ages throughout the range of each of the required conifers, and leaving mature trees in cutover areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The common crossbill is recorded as a Schedule 1 bird on the Wildlife and Countryside Act (as amended), along with all species of crossbill on the UK list.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Red crossbills do not adversely affect humans. Their predation on conifer seeds could conceivably impact forestry practices, but these impacts are negligible.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red crossbills are interesting and integral parts of the coniferous, forested habitats in which they live. They are a fascinating example of extreme specialization to a food type and subsequent rapid morphological adaptation.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red Crossbill

The Red Crossbill (Loxia curvirostra) is a small passerine bird in the finch family Fringillidae, also known as the Common Crossbill in Eurasia. Crossbills have distinctive mandibles, crossed at the tips, which enable them to extract seeds from conifer cones and other fruits.

Adults are often brightly coloured, with red or orange males and green or yellow females, but there is wide variation in colour, beak size and shape, and call types, leading to different classifications of variants, some of which have been named as subspecies.

Contents

Description

Crossbills are characterized by the mandibles crossing at their tips, which gives the group its English name. Using their crossed mandibles for leverage, crossbills are able to efficiently separate the scales of conifer cones and extract the seeds on which they feed. Adult males tend to be red or orange in colour, and females green or yellow, but there is much variation.

In North America, nine distinct Red Crossbill variants (referred to as call types) differing in vocalizations as well as beak size and shape are recognized.[1] Each call type evolved to specialize on different species of conifer. [2]

Breeding and irruption

The Red Crossbill breeds in the spruce forests of North America, as well as Europe and Asia. Some populations breed in pine forests in certain areas of all three continents, and in North America, also in Douglas-fir. It nests in conifers, laying 3–5 eggs.

This crossbill is mainly resident, but often irrupts south when its food source fails. This species forms flocks outside the breeding season, often mixed with other crossbills. The first known irruption, recorded by the chronicler Matthew Paris, was in 1254; the next appears to have been in 1593.[3] The engraver Thomas Bewick wrote that "It sometimes is met with in great numbers in this country, but its visits are not regular",[4] adding that many hundreds arrived in 1821. Bewick then cites Matthew Paris as writing "In 1254, in the fruit season, certain wonderful birds, which had never before been seen in England, appeared, chiefly in the orchards. They were a little bigger than Larks, and eat the pippins of the apples [pomorum grana] but no other part of them... They had the parts of the beak crossed [cancellatas] by which they divided the apples as with a forceps or knife. The parts of the apples which they left were as if they had been infected with poison."[4] Bewick further records an account by Sir Roger Twysden for the Additions to the Addittamenta of Matt. Paris "that in the apple season of 1593, an immense multitude of unknown birds came into England ... swallowing nothing but the pippins, [granella ipsa sive acinos] and for the purpose of dividing the apple, their beaks were admirably adapted by nature, for they turn back, and strike one point upon the other, so as to show ... the transverse sickles, one turned past the other."[4]

Taxonomy and systematics

Crossbill skull and jaw anatomy from William Yarrell's A History of British Birds (1843)

This species is difficult to separate from Parrot Crossbill and Scottish Crossbill, both of which breed within its Eurasian range, as plumage distinctions from those two species are negligible, though the head and bill are smaller than in either of the other species. Care is needed in identification, especially in Eurasia, where the glip or chup call is probably the best indicator. The identification problem is less severe in North America, where only Red Crossbill and White-winged Crossbill occur. However, there has been debate as to whether different call types should be considered separate species. For example, the South Hills Crossbill, occurring in the South Hills and Albion Mountains in Idaho has been described as a new species (Loxia sinesciuris) because it shows a very low degree of hybridization with the Red Crossbill.[5] There are also genetic differences between the call type populations.[6] Nevertheless, few ornithologists have chosen to give these forms species status.

Some large-billed, pine-feeding populations currently assigned to this species in the Mediterranean area may possibly be better referred to either Parrot Crossbill or to new species in their own right, but more research is needed. These include Balearic Crossbill L. curvirostra balearica and North African Crossbill L. curvirostra poliogyna, feeding primarily on Aleppo Pine (Pinus halepensis); Cyprus Crossbill L. curvirostra guillemardi, feeding primarily on European black pine (Pinus nigra); and an as-yet unidentified crossbill with a Parrot Crossbill-size bill feeding primarily on Bosnian Pine (Pinus heldreichii) in the Balkans. These populations also differ on plumage, with the Balearic, North African and Cyprus races having yellower males, and the Balkan type having deep purple-pink males; this however merely reflects the differing anthocyanin content of the cones they feed on, as these pigments are transferred to the feathers.

Diversity

Correlations between different classifications of Eurasian Crossbills
Distinct Eurasian Common Crossbill
populations
Associated
tree species
Summers' list
based on calls
The Sound Approach's
list based on calls[7]
Call-Type,
Flight Call
Balearic Crossbill, Loxia curvirostra balearicaAleppo Pine, Pinus halepensis
North African Crossbill, Loxia c. poliogynaAleppo Pine, Pinus halepensis3E
Corsican Crossbill, Loxia c. corsicanaEuropean Black Pine, Pinus nigra
Cyprus Crossbill, Loxia c. guillemardiEuropean Black Pine, Pinus nigra5D
Crimean Crossbill, Loxia c. mariaeEuropean Black Pine, Pinus nigra?
Luzon Crossbill, Loxia c. luzoniensisKhasi Pine, Pinus kesiya
Annam Crossbill, Loxia c. meridionalisKhasi Pine, Pinus kesiya
Altai Crossbill, Loxia c. altaiensisSpruces
Tien Shan Crossbill, Loxia c. tianschanicaSchrenk's Spruce, Picea schrenkiana
Himalayan Crossbill, Loxia c. himalayensisHimalayan Hemlock, Tsuga dumosa
Japanese Crossbill, Loxia c. japonica
Other Eurasian Crossbills
1A'British Crossbill'Type E - flight call "Chip"
1B'Parakeet Crossbill'Type X - flight call "Cheep"
2B'Wandering Crossbill'Type A - flight call "Keep"
Parrot Crossbill, Loxia ptyopsittacus2D
Scottish Crossbill, Loxia scotica3C
'Bohemian Crossbill'Type B - flight call "Weet"
4E'Glip Crossbill'Type C - flight call "Glip"
'Phantom Crossbill'Type D - flight call "Jip"
'Scarce Crossbill'Type F - flight call "Trip"
Correlations between different classifications of North American Crossbills
North American Red Crossbill subspecies based on biometricsJeff Groth's list
using call-types
Recorded on tree species
(Jeff Groth call types)
Newfoundland Crossbill, Loxia c. percnaType 8Black Spruce, Picea mariana
Lesser Crossbill, Loxia c. minorType 3Western Hemlock, Tsuga heterophylla
Sitka Crossbill, Loxia c. sitkensis (probably a junior synonym of L. c. minor)Type 3ditto
Loxia c. neogaeaType 1Tsuga species, Picea glauca, Pinus strobus
Loxia c. neogaeaType 4Douglas Fir, Pseudotsuga menziesii
Rocky Mountain Crossbill, Loxia c. bentiTypes 2, 7Type 2: Rocky Mountains Ponderosa Pine Pinus ponderosa scopulorum in west, various Pinus species in east; Type 7: possibly a general diet
Sierra Crossbill, Loxia c. grinnelliType 2, 7ditto
Bendire Crossbill, Loxia c. bendireiType 2, 7ditto
Mexican Crossbill, Loxia c. stricklandiType 6Pine species in section Trifoliae
Central American Crossbill, Loxia c. mesamericana
South Hills Crossbill (described as Loxia sinesciuris in 2009)[5]Type 9Isolated population of Lodgepole Pine, Pinus contorta latifolia

References

  1. ^ Benkman, C. W.; Parchman, T. L. and E. Mezquida (2010). "Patterns of coevolution in the adaptive radiation of crossbills.". Annals of the New York Academy of Sciences 106. 
  2. ^ Benkman, C. W. (2003). "Divergent selection drives the adaptive radiation of crossbills". Evolution 57 (5). 
  3. ^ Perry, Richard Wildlife in Britain and Ireland Croom Helm Ltd. London 1978 pp. 134–5.
  4. ^ a b c Bewick, Thomas (1847 (revised edition)). A History of British Birds, volume I, Land Birds. pp. 234–235. 
  5. ^ a b Benkman, Craig W.; Smith, Julie W.; Keenan, Patrick C.; Parchman, Thomas L.; Santisteban, Leonard (2009). "A New Species of the Red Crossbill (Fringillidae: Loxia) From Idaho". The Condor 111 (1): 169–176. doi:10.1525/cond.2009.080042. 
  6. ^ Parchman, T. L.; C. W. Benkman (2006). "Patterns of genetic variation in the adaptive radiation of New World crossbills (Aves: Loxia)". Molecular Ecology 15. 
  7. ^ Introduction to vocalizations of crossbills in north-western Europe
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: At least nine species exist in North America and additional species exist outside North America (AOU 1998). See Groth (1988) for information suggesting that Appalachian Red Crossbills comprise two distinct species. Sympatric breeding without interbreeding suggests that L. SCOTIA (Scottish Crossbill) is a valid species, not a subspecies of L. CURVIROSTRA (Knox 1990). According to Groth (1990, 1993), the Red Crossbill comprises at least seven different, rarely hybridizing, species, each specializing on a different species or even a single variety of conifer (Benkman 1993). More research is needed to clarify the taxonomic status of the eight North American call types of Red Crossbill (DeBenedictus 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!