Articles on this page are available in 1 other language: Spanish (5) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psarocolius decumanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATTTTCGGTGCATGAGCCGGAATGGTAGGTACCTCCCTAAGCCTCCTCATCCGAGCAGAGCTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTTTACAACGTAGTCGTCACAGCCCATGCATTCGTGATAATCTTCTTCATAGTTATACCCATTATAATCGGAGGGTTCGGAAACTGACTAGTTCCCCTAATAATTGGAGCCCCCGACATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTTCTCCTCCTAGCATCCTCCACAGTTGAAGCAGGCGTGGGAACAGGCTGAACAGTGTACCCCCCACTAGCAGGTAACCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTGCATTTGGCCGGTATCTCCTCAATTCTAGGAGCAATCAACTTTATCACAACAGCAATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCATTATTCGTCTGATCTGTCCTAATCACCGCAGTTCTCCTACTCCTATCCCTTCCCGTTCTTGCCGCAGGGATTACAATACTCCTCACAGACCGTAACCTCAACACTACATTCTTTGACCCCGCTGGAGGAGGAGACCCTGTCCTATACCAGCACCTATTCTGATTCTTCGGTCACCCAGAAGTTTATATCTTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Psarocolius decumanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common but patchily distrinuted' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Crested Oropendola

The crested oropendola also known as the Suriname crested oropendola (Psarocolius decumanus) is a New World tropical icterid bird. It is a resident breeder in lowland South America east of the Andes, from Panama and Colombia south to northern Argentina, as well as on Trinidad and Tobago. If the genus Gymnostinax for the Montezuma oropendola and its closest relatives were considered valid, this species would probably belong in that genus (Price & Lanyon 2002).

It is a common bird, seen alone or in small flocks foraging in trees for large insects, fruit and some nectar. The male is 46 cm long and weighs 300 g; the smaller female is 37 cm long and weighs 180 g.

The plumage of the crested oropendola has a musty smell due to the oil from the preen gland.

Description[edit]

Adult males are mainly black with a chestnut rump and a tail which is bright yellow apart from two dark central feathers. There is a long narrow crest which is often difficult to see. The iris is blue and the long bill is whitish. Females are similar but smaller, duller, and crestless.

Taxonomy[edit]

On Trinidad

There are four subspecies:

  • P. d. insularis of Trinidad and Tobago has much chestnut edging on the feathers of the wings and back.
  • The nominate subspecies P. d. decumanus occurs from Colombia south to the Amazon in Brazil.
  • P. d. maculosus breeds south of the Amazon. It is browner, and has yellow feathers scattered through the body plumage.
  • The northern form P. d. melanterus of Panama and western Colombia is very similar, differing only in the amount of chestnut feather tipping, and is of dubious status.

Behaviour[edit]

Painting by William Swainson, 1841, of Cassicus cristatus

The crested oropendola inhabits forest edges and clearings. It is a colonial breeder which builds a hanging woven nest, more than 125 cm long, high in a tree. It lays two blotched blue-grey eggs which hatch in 15–19 days, with another 24–36 days to fledging.

Each colony has a dominant male, which mates with most of the females following an elaborate bowing display. There may be 15-30 females and only 3-4 males. Outside the breeding season, this species is quite mobile, with some seasonal movements.

The distinctive songs of the male include a liquid vibrato CreeeEEEoooooooooo. Both sexes have a loud clack call.

References[edit]

  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y.. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Jaramillo, Alvaro & Burke, Peter (1999): New World Blackbirds. Christopher Helm, London. ISBN 0-7136-4333-1
  • Price, J. Jordan & Lanyon, Scott M. (2002): A robust phylogeny of the oropendolas: Polyphyly revealed by mitochondrial sequence data. Auk 119(2): 335–348. DOI: 10.1642/0004-8038(2002)119[0335:ARPOTO]2.0.CO;2 PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!