Overview

Distribution

Geographic Range

Yellow-rumped caciques (Cacicus cela) are widespread across northern South America. They can be found east of the Andes Mountains throughout the Amazon Basin. Yellow-rumped caciques are more numerous in the tropics than in temperate regions although some have been spotted along the southern border of Bolivia which is considered to be the southern (more temperate) extent of their range. They inhabit all northern countries of South America and extend east throughout the upper half of Brazil. They are native to the Amazon and have not been introduced into any other regions.

Biogeographic Regions: neotropical (Native )

  • Lowther, P. 1975. Geographic and ecological variation in the family Icteridae. The Wilson Bulletin, 87/4: 481-495.
  • Ridgely, R., G. Tudor. 1989. The Birds of South America. United States of America: Robert S. Ridgely, Guy Tudor, and World Wildlife Fund, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Yellow-rumped caciques are sexually dimorphic. Adult males range from 27 to 29.5 cm long and weigh approximately 100 g. Adult females typically reach 23 to 25 cm long and weight 60 to 80 g. Both sexes have similar colors, but females tend to be less colorful. Adults are mostly black but have a yellow spot on their wings and another bright yellow patch on their rump. They have pale blue eyes and a greenish yellow bill. When perched, the bright yellow colors can still be seen. This distinguishes yellow-rumped caciques from closely related red-rumped caciques (Cacicus haemorrhous).

First year yellow-rumped caciques have brown patches on the base of the bill and dark purple eyes. In second year birds, the bill is clear yellow and they have blue eyes. Males have olive edges on the belly feathers and females have traces of purple in their eyes. By third year they will express adult coloration.

Range mass: 60 to 103 g.

Range length: 23 to 30 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

  • Haverschmidt, F. 1948. Bird weights from Surinam. The Wilson Bulletin, 60/4: 230-239.
  • Webster, M. 1992. Sexual dimorphism, mating system and body size in the new world blackbirds (Icterinae). Evolution, 46/6: 1621-1641.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow-rumped caciques typically do not live deep inside forests. They are considered an “edge” species, preferring to live along the forest borders near open areas such as fields and lakes. They typically nest in tree canopies, but also may be found in dense shrubbery. Because of their preference for forest borders, yellow-rumped caciques are frequently seen near areas of human activities.

Range elevation: 400 (low) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Other Habitat Features: suburban ; estuarine

  • Munn, C. 1985. Permanent canopy and understory flocks in Amazonia: species composition and population density. Ornithological Monographs, 36: 683-712.
  • Robinson, S. 1986. Three-speed foraging during breeding cycle of yellow-rumped caciques (Icterinae: Cacicus cela). Ecology, 67/2: 394-405.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Yellow-rumped caciques are insectivorous, feeding their young arthropods, mainly grasshoppers, crickets, and katydids (Orthoptera), but also orb-weaver spiders (Araneidae). Adults are not only insectivorous, but also fulfill their protein demands by eating fruits and nectar. Fruits of chupa-chupa (Quararubea cordata) trees are a favorite, along with figs (Ficus trigona). They also hunt in tree canopies for caterpillers and other invertebrates.

Animal Foods: insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: fruit; nectar

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Giant cowbirds (Scaphidura oryzivor) have been noted as nest predators. They attack both yellow-rumped cacique nests and a common neighboring species: russet-backed oropendolas (Psarcolius angustifrons). Female giant cowbirds are more prone to visit the nests of oropendolas than caciques, but it has been suggested that the two neighboring birds have a mutualistic relationship. Cowbirds visiting unprotected oropendola nests may be driven away by male yellow-rumped caciques.

Where yellow-rumped caciques nest on islands, their nests may be protected from terrestrial predators, such as snakes, through predation in by black caimans (Melanosuchus niger). Stelopolybia fuscipennis is a species of wasp that has been seen to drive away monkeys in yellow-cacique nest colonies.

Mutualist Species:

  • russet-backed oropendolas (Psarcolius angustifrons)
  • Stelopolybia fuscipennis
  • black caimans (Melanosuchus niger)

Commensal/Parasitic Species:

  • Canaday, C. 1996. Loss of insectivorous birds along a gradient of human impact in Amazonia. Biological Conservation, 77/1: 63-77.
  • Robinson, S. 1988. Foraging ecology and host relationships of giant cowbirds in southeastern Peru. The Wilson Bulletin, 100/2: 224-235.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Yellow-rumped caciques are vulnerable to predators while searching for food in the understory. Their bright yellow color makes them highly visible. Birds in the genus Accipiter (goshawks or sparrowhawks) and Micrastur (forest falcons) are known predators. Yellow-rumped caciques are also subject to many nest predators. However, they nest in areas that are well-protected from most mammals, snakes, and other birds. Wasp-nest colonies in close proximity provide protection from mammals, however, yellow-rumped caciques must ensure enough space between themselves and these wasps to avoid attack. Stelopolybia fuscipennis is a species of wasp that has been seen to drive away monkeys. Yellow-rumped caciques also sometimes live in island environments, which protect them from snakes. Caimans, such as the black caiman (Melanosuchus niger), often eat or deter snakes before they reach nests. In driving away other bird species, colony size is important. Other birds are "mobbed" by the colony when they posed a threat to nests.

Known Predators:

Anti-predator Adaptations: aposematic

  • Robinson, S. 1985. Coloniality in the yellow-rumped cacique as a defense against nest predators. The Auk, 102/3: 506-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Songs are acquired through two phases: memorization and crystallization. Memorization begins within a few months of hatching and continues into the first breeding season. Yellow-rumped caciques don’t fully crystallize their songs until their third year. Vocal signals are used to attract mates, defend territories, and advertise status. Colonies share 5 to 7 song dialects that differ from other colonies and are changed throughout the breeding season. Members are able to adopt these changes quickly and allow the colony to distinguish outsiders. Songs have social significances and males counter-sing one another to establish dominance.

Communication Channels: acoustic

Other Communication Modes: mimicry

  • Trainer, J., R. Parsons. 2002. Delayed vocal maturation in polygynous yellow-rumped caciques. The Wilson Bulletin, 114/2: 249-254.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is no information on lifespan in the literature.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Yellow-rumped caciques are polygynous, meaning that one male mates with many females. They are a colonial species, with group nests typically occupying one to two trees. Access to females depends upon dominance, which has been shown to correlate with weight. Larger size means greater numbers of females. Males compete with one another through their size and communication with aerial grappling and face to face “shouting”. In addition, males counter-sing to one another. The individual who cannot keep up with crystallized songs is defeated. In all male bouts, there is a distinct winner and loser.

Females also compete with one another within a colony. As with males, size plays in important role in female dominance. Female yellow-rumped caciques fight to obtain prime nesting spot to ensure their eggs will be safe. Nest materials and spots have been stolen from by neighbors and aerial grappling and “shouting” also occurs. However, unlike males, not all female bouts have a distinct winner or loser.

Mating System: polygynous

The breeding season for yellow-rumped caciques lasts eight months, from July to February. Males mate with many females, but are limited by their ability to obtain and protect the females. After mating, males show no parental investment in the offspring except in aiding females in protecting the nest. While females are foraging or gathering materials, males assume duties for nest and territory protection. Re-nesting occurs at least once during the breeding season.

Females lay two eggs, each weighing 5 to 6 g. However, most of the time, only one egg survives. Eggs hatch about 15 days later and a single 2 to 3 g bird emerges. Mother birds feed her young arthropods. After about 25 days, young birds are able to fly on their own. Offspring mature in about two years, after having memorized most of the songs they will need in communication.

Breeding interval: Yellow-rumped caciques typically only breed once during the season, but some may breed twice.

Breeding season: Yellow-rumped caciques have an eight month breeding season that runs from July to February.

Range eggs per season: 0 to 2.

Range time to hatching: 13 to 14 days.

Range birth mass: 2 to 5 g.

Range fledging age: 35 to 65 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Other than mating with females and protecting their territories, males play no part in parental care. Females are responsible for all other reproductive activities and offspring care. Females build the nests, incubate the eggs, and feed the young. Female mass fluctuates between 60 and 80 g throughout the process. The nests are typically built high in the canopy and hang from branches. Nests are built largely with twigs and leaves.  Nestlings fledge when their weight reaches approximately 50 to 88 g, at about 25 days after hatching. Once young are capable of flying, mothers slowly gain their weight back which was lost while feeding young.

Parental Investment: female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Robinson, S. 1986. Three-speed foraging during breeding cycle of yellow-rumped caciques (Icterinae: Cacicus cela). Ecology, 67/2: 394-405.
  • Trainer, J. 1987. Behavioral associations of song types during aggressive interactions among male yellow-rumped caciques. The Condor, 89/4: 731-738.
  • Webster, M. 1992. Sexual dimorphism, mating system and body size in the new world blackbirds (Icterinae). Evolution, 46/6: 1621-1641.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cacicus cela

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCGTTAACCGATGACTATTTTCAACCAACCACAAAGATATTGGGACCCTGTACTTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACTGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTTTACAATGTAGTTGTCACGGCCCATGCATTTGTAATAATCTTCTTCATAGTTATACCTATTATGATCGGAGGGTTCGGAAACTGACTAGTCCCCCTGATAATTGGAGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTACTCCTCCTAGCATCCTCCACAGTAGAAGCAGGTGTAGGCACAGGCTGAACAGTATACCCTCCACTAGCAGGCAACCTGGCCCACGCCGGAGCCTCAGTCGATCTTGCAATTTTCTCCTTACACTTAGCCGGTATCTCCTCAATTCTGGGAGCAATCAACTTTATTACAACAGCAATCAACATAAAACCTCCTGCCCTTTCACAATACCAAACTCCTTTATTCGTCTGATCAGTCCTAATTACCGCAGTTCTCCTACTCCTATCTCTTCCTGTCCTTGCCGCAGGAATTACAATACTCCTCACAGACCGCAACCTTAACACTACATTTTTCGACCCCGCCGGAGGAGGAGATCCCGTACTGTACCAACATCTCTTCTGATTCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cacicus cela

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cacicus cela according to IUCN Red List is at low risk with no concern. They are abundant throughout their habitat.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Cacicus cela on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Yellow-rumped caciques do not appear to provide direct economic benefit to humans. However, loss of this bird is likely to contribute to human problems. Yellow-rumped caciques often live on the edges of forests and nearby towns. They are insectivorous and feed on a large number of pest insects. Along with this, many people enjoy listening to their songs.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow-rumped Cacique

The yellow-rumped cacique (Cacicus cela) is a passerine bird in the New World family Icteridae. It breeds in much of northern South America from Panama and Trinidad south to Peru, Bolivia and central Brazil. However, have been sighted as far north as Nayarit, Mexico

Description[edit]

The yellow rump

The male is in average 28 cm long and weighs about 104 g, with the female 23 cm long and weighing 60 g approximately. The yellow-rumped cacique is a slim bird, with a long tail, blue eyes, and a pale yellow pointed bill. It has mainly black plumage, apart from a bright yellow rump, tail base, lower belly and wing "epaulets". The female is duller black than the male, and the juvenile bird resembles the female, but has dark eyes and a brown bill base.

The song of the male yellow-rumped cacique is a brilliant mixture of fluting notes with cackles, wheezes and sometimes mimicry. There are also many varied calls, and an active colony can be heard from a considerable distance.[2]

It has three subspecies:

The latter two may be a separate species, saffron-rumped cacique.[4]

Ecology[edit]

Nesting in Peru
Yellow-rumped cacique nest

The yellow-rumped cacique is a bird associated with open woodland or cultivation with large trees. This gregarious bird eats large insects and fruit.

It is a colonial breeder, with up to 100 bag-shaped nests in a tree, which usually also contains an active wasp nest. The females build the nests, incubate, and care for the young. Each nest is 30–45 cm long and widens at the base, and is suspended from the end of a branch. Females compete for the best sites near the protection of the wasp nest. The normal clutch is two dark-blotched pale blue or white eggs. Females begin incubating after laying the second egg; hatching occurs after 13 or 14 days. The young fledge in 34 to 40 days, usually only one per nest.

Relationship with humans[edit]

The yellow-rumped cacique has benefited from the more open habitat created by forest clearance and ranching. It is not considered threatened by the IUCN.[5]

In Peruvian folklore, this species – like other caciques and oropendolas – is called paucar, or – referring to this species only – paucarcillo ("little paucar"). This species is apparently the paucar that, according to a folktale of Moyobamba, originated as a rumor-mongering boy who always wore black pants and a yellow jacket. When he spread an accusation against an old woman who was a fairy in disguise, she turned him into a noisy, wandering bird. The bird's appearance is thought to augur good news.[6]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Cacicus cela". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Jaramillo & Burke (1999)
  3. ^ Cuervo et al. (2006)
  4. ^ Jaramillo & Burke (1999)
  5. ^ BLI (2008)
  6. ^ moyobamba.com (2007), Enjoy Peru [2008]

References[edit]

  • Cuervo, Andrés M.; Hernández-Jaramillo, Alejandro; Cortés-Herrera, José Oswaldo & Laverde, Oscar (2007): Nuevos registros de aves en la parte alta de la Serranía de las Quinchas, Magdalena medio, Colombia [New bird records from the highlands of Serranía de las Quinchas, middle Magdalena valley, Colombia]. Ornitología Colombiana 5: 94-98 [Spanish with English abstract]. PDF fulltext
  • Enjoy Peru [2008]: Manu – Aves.[dead link] Retrieved 2008-DEC-22.
  • moyobamba.com (2007): Leyendas e historia de los barrios.[dead link] Retrieved 2007-SEP-28.

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!