Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Distribution

Global Range: RESIDENT: Himalayas from Nepal and northern India east to northern Burma and central China. INTRODUCED: established in Hawaii in 1918. Abundant on most islands by 1940s but has been declining since; now rare on Kauai and Oahu, still common on Molokai, Maui, and Hawaii (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 14 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Undergrowth, brushy areas, dense second growth; in forested regions. Hawaii: in virtually any habitat with leafy shrubs, most common in native rain forest, mamane scrub, and planted groves of conifers, black wattle and eucalyptus (Pratt et al. 1987). Nests in various sites: in weed clumps < 1 m above ground, in shrubs and trees several m above ground, near end of tree fern frond, etc. (Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats fruit, flower petals, buds, insects, snails.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Often in small (family?) groups (Pratt et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 15 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Hawaii: nesting season at least March-August; clutch size 2-4; nestling period about 11 days (Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leiothrix lutea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTCGGCGCATGAGCCGGGATAGTTGGTACCGCCCTAAGCCTGCTCATCCGAGCAGAACTAGGTCAACCTGGCGCCCTACTGGGAGACGACCAAGTTTATAACGTAATCGTCACAGCCCATGCTTTCGTAATAATCTTCTTTATAGTGATACCAATTATGATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCTTACTCCTACTAGCTTCCTCCACGGTAGAAGCAGGGGCAGGAACTGGTTGAACTGTCTACCCTCCCCTAGCTGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTACATCTAGCAGGGATCTCTTCAATCCTCGGAGCAATTAATTTCATCACAACAGCAATCAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCTCTATTCGTTTGATCGGTCCTAATTACTGCAGTACTTCTACTCCTATCCCTTCCAGTTCTTGCTGCAGGTATTACAATACTACTCACAGACCGCAACCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGGGACCCAGTACTCTACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTCATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leiothrix lutea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is reported to be locally common (Grewal et al. 2002), while national population sizes have been estimated at c.10,000-100,000 breeding pairs in China and c.100-10,000 introduced breeding pairs in Japan (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species has been heavily traded: since 1997 when it was listed on CITES Appendix II, 227,517 wild-caught individuals have been recorded in international trade (UNEP-WCMC CITES Trade Database, January 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-billed leiothrix

The red-billed leiothrix (Leiothrix lutea) is a member of the Leiothrichidae family, and is native to the Indian subcontinent. Adults have bright red bills and a dull yellow ring around their eyes. Their backs are dull olive green, and they have a bright yellow-orange throat with a yellow chin; females are somewhat duller than males, and juveniles have black bills. It has also been introduced in various parts of the world, with small populations of escapees having existed in Japan since the 1980s. It has become a common cagebird and amongst aviculturists it goes by various names: Pekin robin, Pekin nightingale, Japanese nightingale, and Japanese (hill) robin, the last two being misnomers as it is not native to Japan.[2]

Description[edit]

Two at Chester Zoo, England
Male at Chester Zoo, England

The leiothrix is about six inches in length, generally olive green, and has a yellow throat with orange shading on the breast. It also has a dull yellowish ring around the eye that extends to the beak.[2] The edges of the wing feathers are brightly colored with yellow, orange, red and black and the forked tail is olive brown and blackish at the tip. The cheeks and side of the neck are a bluish gray color.[3] The female is a lot paler than the male and lacks the red patch on the wings.[2] It doesn't fly frequently, except in open habitats. This bird is very active and an excellent singer but very secretive and difficult to see.[4]

Distribution and habitat[edit]

The leiothrix is usually found in India, Bhutan, Nepal, Burma and parts of Tibet.[5] This species is a bird of the hill forests, found in every type of jungle though it prefers pine forests with bushes. It has also been found at elevations ranging from near sea level to about 7,500 feet.[6]

The species was introduced to the Hawaiian Islands in 1918 and spread to all the forested islands except Lanai. Its population on Oahu crashed in the 1960s and it disappeared from Kauai, but is now common and increasing on Oahu.[7] The leiothrix was released in Western Australia but it failed to become established. This species was also introduced in Great Britain but permanent establishment was unsuccessful. It was introduced to France, where it is now established in several areas.

Ecology and behavior[edit]

The presence of the avian malaria parasite has been found in the blood of this species.[3]

Diet[edit]

This bird feeds on both plant and animal matter. It eats fruits such as strawberries, ripened papaya, guavas and also various species of Diptera, Mollusca, Lepidoptera, and Hymenoptera. Its food is usually gathered from foliage and dead wood and it usually searches for food in lower strata of vegetation.[4]

Reproduction[edit]

Eggs of Leiothrix lutea calipyga MHNT

The leiothrix can usually be found in a group of about ten to thirty birds during the non-breeding season; however, during the breeding season the birds break off into pairs and become territorial.[2] These birds have a song which consists of short powerful notes that are repeated continuously throughout the year but it is more persistent during the breeding season.[4] This period usually lasts from early April until September and they are usually found around well watered areas. The males sing long complex songs with a wide array of syllables to attempt to attract the female.[4]

The leiothrix is an open cup nester.[8] The nests of the red-billed leiothrix are composed of dry leaves, moss and lichen; however, they are not well hidden because concealment isn't really a primary factor when determining a nest site.[8] Several nests are found between April and June and are placed within ten feet of the ground. Dense vegetation provides the shrub nesting species protection against predators.[8]

The eggs of the leiothrix are found in clutches of two to four eggs with an average of three.[3] They are broad and blunt in shape with some gloss on the outside and they also have a pale blue color and red like brown spots that encircle the larger end of the eggs. The newly hatched birds have bright red skin and a rich orange red gape.[3]

References[edit]

  1. ^ BirdLife International (2012). "Leiothrix lutea". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d Long, John L. Introduced Birds Of The World. 1981
  3. ^ a b c d Whistler , Hugh . Popular Handbook Of Indian Birds. 4th ed. 1963.
  4. ^ a b c d Male, T.D., Fancy, S.G, and Ralph, C.J. "Red- Billed Leiothrix." The birds of North America (1998)
  5. ^ Hvass, Hans. Birds of the World In Color. 1964.
  6. ^ Berger, Andrew. Hawaiian Birdlife. 1972.
  7. ^ Hawaii's Birds. Honolulu: Hawaii Audubon Society. 2005. p. 104. ISBN 1-889708-00-3. 
  8. ^ a b c Amano, Hitoha, and Kazuhiro Eguchi. "Nest Site Selection of the Red-billed Leiothrix and Japanese Bush Warbler in Japan." (2002)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes L. ASTLEYI.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!