Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Icterus nigrogularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTCCTGGGAGACGACCAGGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATTGGGGGGTTCGGCAACTGACTAGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCTTTCCTCCTCCTCCTAGCATCTTCTACAGTCGAAGCAGGTGTAGGTACAGGTTGAACAGTGTACCCCCCACTAGCAGGTAACCTAGCCCATGCTGGAGCCTCAGTCGACCTTGCAATTTTCTCACTACACCTAGCTGGCATCTCTTCAATTCTAGGAGCAATCAACTTTATTACAACCGCAATCAATATAAAACCCCCTGCTCTCTCACAATACCAAACTCCCCTATTCGTATGATCAGTATTAATCACCGCAGTACTTCTACTCCTATCCCTTCCTGTCCTCGCCGCAGGGATCACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCCGCCGGGGGAGGAGACCCTGTACTATATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Icterus nigrogularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow oriole

For the bird alternatively named yellow oriole in Australia, see Green oriole.

The yellow oriole (Icterus nigrogularis) is a passerine bird in the family Icteridae. It should not be confused with the green oriole, sometimes alternatively called the Australasian yellow oriole, Oriolus flavocinctus, which is an Old World oriole.

The yellow oriole is also called the 'plantain' and 'small corn bird', and in Venezuela it is known as 'gonzalito'. It breeds in northern South America in Colombia, Venezuela, Trinidad, the Guianas and parts of northern Brazil, (northern Roraima state, and eastern Amapá). The yellow oriole is a bird of open woodland, scrub and gardens. Its nest is a 40 cm-long hanging basket, suspended from the end of a branch. The normal clutch is three pale green or grey eggs.

This is a 20–21 cm long, 38 g weight bird, with mainly yellow plumage, as its name suggests. The adult male has a black eye mask, thin black throat line, black tail and black wings with a white wing bar and some white feather edging.

The female is similar but slightly duller, and the juvenile bird has an olive-tinged yellow back, and lacks black on the face.

There are four subspecies of yellow oriole, of which three are restricted to islands. They differ from the widespread nominate race of the mainland in body and bill size, and minor plumage details.

This species eats mainly large insects, but will also take nectar and some fruit.

The song of the yellow oriole is a pleasant melodious fluting, with some buzzing. The calls include a cat-like whine, and chattering noises.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!